United States Patent (19)
`Balschmidt et al.
`
`||||||||||||III
`US005164366A
`5,164,366
`11
`Patent Number:
`Nov. 17, 1992
`(45) Date of Patent:
`
`54 HUMAN INSULIN ANALOGUES
`75) Inventors: Per Balschmidt, Espergaerde; Jens
`J.V. Brange, Klampenborg, both of
`Denmark
`73) Assignee: Novo Nordisk A/S, Bagsvaerd,
`Denmark
`21 Appl. No.: 453,445
`22 Filed:
`Dec. 20, 1989
`
`63
`
`Related U.S. Application Data
`Continuation of Ser. No. 416,218, Oct. 2, 1989, aban
`doned, which is a continuation of Ser. No. 332,697,
`Apr. 3, 1989, abandoned.
`Foreign Application Priority Data
`(30)
`Dec. 23, 1988 DK) Denmark ............................. 7215/88
`Sep. 28, 1989 DK Denmark ............................. 4777/89
`51
`Int. Cl. ........................ C07K 7/40; A61K 37/26
`52) U.S. C. ........................................ 514/3; 530/303;
`435/69.4
`58) Field of Search ............................ 530/303; 514/3;
`435/69.4, 68.1
`
`56)
`
`References Cited
`U.S. PATENT DOCUMENTS
`3,903,069 9/1975 Geregory ............................ 530/303
`
`
`
`4,320,196 3/1982 Morihara et al. ....................... 514/3
`4,701,440 10/1987 Grau ....................................... 514/3
`FOREIGN PATENT DOCUMENTS
`O254516 1/1988 European Pat. Off. ................ 514/3
`WO/891.0937 11/1989 World Int. Prop. O. .............. 514/3
`OTHER PUBLICATIONS
`Frank, B., "Self-Assocation and Confernational Stud
`ies on Human Poinsulin and Insulin Analogs', Abstract,
`Conference on Insulin, 1989.
`Chance, R., "Preparation of a New Series of Insulin
`Analogs", Conference on Insulin, Sep. 1989.
`Nakagawa, S. et al., Journal of Biological Chemistry,
`262(25): 12054-58, Sep. 1987.
`Primary Examiner-Merrell C. Cashion, Jr.
`Assistant Examiner-Susan M. Perkins
`Attorney, Agent, or Firm-Steve T. Zelson
`
`ABSTRACT
`57
`The present invention relates to novel human insulin
`analogues exhibiting a low ability to associate in solu
`tion, a method for the preparation of such insulin ana
`logues, insulin preparations containing the human insu
`lin analogues of the invention and a method of treating
`Diabetes Mellitus using these human insulin analogues.
`
`35 Claims, 5 Drawing Sheets
`
`MPI EXHIBIT 1072 PAGE 1
`
`MPI EXHIBIT 1072 PAGE 1
`
`DR. REDDY’S LABORATORIES, INC.
`IPR2024-00009
`Ex. 1072, p. 1 of 18
`
`

`

`U.S. Patent
`
`Nov. 17, 1992
`
`Sheet 1 of 5
`
`5,164,366
`
`
`
`I I J [] u [ H
`
`
`
`III pu?H
`
`MPI EXHIBIT 1072 PAGE 2
`
`MPI EXHIBIT 1072 PAGE 2
`
`DR. REDDY’S LABORATORIES, INC.
`IPR2024-00009
`Ex. 1072, p. 2 of 18
`
`

`

`U.S. Patent
`
`Nov. 17, 1992
`
`Sheet 2 of 5
`
`5,164,366
`
`27 9/_/
`
`0002 I [ es I Huweg
`
`
`
`MPI EXHIBIT 1072 PAGE 3
`
`MPI EXHIBIT 1072 PAGE 3
`
`DR. REDDY’S LABORATORIES, INC.
`IPR2024-00009
`Ex. 1072, p. 3 of 18
`
`

`

`U.S. Patent
`
`Nov. 17, 1992
`
`Sheet 3 of 5
`
`5,164,366
`
`lO
`
`20
`
`3 O
`
`4 O
`
`50
`
`6 O
`
`GAATTCCATTCAAGAATAGTTCAAACAAGAAGATTACAAACTATCAATTTCATACACAAT
`
`l2O
`11:
`OO
`9 O.
`8 O
`7 O
`ATAAACGACCAAAAGAATGAAGGCTGTTTTCTTGGTTTTGTCCTTGATCGGATTCTGCTG
`METLysAla ValPheLeuVal LeuSerLeullegly Phecys'Trp
`
`3 O
`l40
`50
`6 O
`17 O
`8 O
`GGCCCAAccAGTCACTGGcGATGAATCATCTGTTGAGATTCCGGAAGAGICTCTGATCAT
`AlaGlinProValThrClyAspGluSerSerValGlulleProGlugluSerLeulleIle
`
`9 O
`
`2 OO
`
`2O
`
`220
`
`23 O.
`
`24 O
`
`CGCTGAAAACACCACTTTGGCTAACGTCGCCATGGCTAAGAGATTCGTTAACCAACACTT
`Ala Glu AsnThrThrLeu AlaAsnValAlaMETAlays Arg PheValAsnGlin His Leu
`
`250
`
`26 O
`
`27 O
`
`28 O
`
`29 O
`
`3 OO
`
`GTGCGGTTCCCACTTGGTTGAAGCTTTGTACTTGGTTTGCGGTGAAAGAGGTTTCTTCTA
`CysGlySerhisleuVal Glu AlaleuTyrLeuVal CysGlyGlu ArgGlyPhePheTyr
`
`3 O
`32O
`33 O
`34 O
`350
`36 O
`CAccAAGGCTGCTAAGGGTATTGTcGAACAATGCTGTACCTCCATCTGCTCCTTGTACCA
`ThrLys AlaAlaLysGlyIleValGluglincys Cys ThrSerIlecysSerLeuTyrglin
`
`37 O
`
`380
`
`39 O.
`
`4 OO
`
`ATTGGAAAACTACTGCAGCTAGACGCAGCCCGCAGGCTCTAGA
`Leuglu AsnTyrCysSer
`
`A/G 3
`
`MPI EXHIBIT 1072 PAGE 4
`
`MPI EXHIBIT 1072 PAGE 4
`
`DR. REDDY’S LABORATORIES, INC.
`IPR2024-00009
`Ex. 1072, p. 4 of 18
`
`

`

`U.S. Patent
`
`Nov. 17, 1992
`
`Sheet 4 of 5
`
`5,164,366
`
`
`
`A/G 4
`
`MPI EXHIBIT 1072 PAGE 5
`
`MPI EXHIBIT 1072 PAGE 5
`
`DR. REDDY’S LABORATORIES, INC.
`IPR2024-00009
`Ex. 1072, p. 5 of 18
`
`

`

`U.S. Patent
`
`Nov. 17, 1992
`
`Sheet 5 of 5
`
`5,164,366
`
`NCOI
`Ei
`
`Noo
`EcoRI.
`
`
`
`
`
`
`
`EcoR/SEN
`precursor gu
`pKFN- 864
`a.
`
`
`
`
`
`
`
`or/
`
`Nco
`
`
`
`SScori
`%u. P
`sign:leader
`insulin Onolo
`precursor gue
`AR pKFN-866
`
`Xbo
`TPI
`
`Egg"
`- APS-
`
`
`
`
`
`
`
`A/G 4 (OOW7)
`
`MPI EXHIBIT 1072 PAGE 6
`
`MPI EXHIBIT 1072 PAGE 6
`
`DR. REDDY’S LABORATORIES, INC.
`IPR2024-00009
`Ex. 1072, p. 6 of 18
`
`

`

`1.
`
`HUMAN INSULIN ANALOGUES
`
`5,164,366
`2
`meric, hexameric and even polymeric insulin. The equi
`librium can e.g. be determined by ultracentrifugation,
`by osmometry or by gel filtration methods, vide e.g. R.
`This is a continuation of Ser. No. 07/416,218 filed
`Valdes Jr. and G. A. Ackers, "Methods in enzymol
`Oct. 2, 1989 which is a continuation of Ser. No. 332,697 5 ogy", vol. 61 (Enzyme Structure, part H. eds.; Hirs &
`filed Apr. 3, 1989, both abandoned.
`Timasheff), Academic Press 1979, pages 125-142. In
`normal formulations of insulin preparations this equili
`TECHNICAL FIELD
`bration is shifted in such a way that the insulin to a very
`high degree is on a hexameric form.
`The present invention relates to novel human insulin
`analogues exhibiting a low ability to associate in solu- 10
`Substitutions in the insulin molecule can be intro
`tion, a method for the preparation of such insulin ana-
`duced with the purpose of improving the profile of
`logues, insulin preparations containing the human insu-
`activity of the insulin in the treatment of Diabetes.
`lin analogues of the invention and a method of treating
`Thus, Published International Application No. WO
`Diabetes Mellitus using these human insulin analogues.
`86/05497 discloses that one or more substitutions of Glu
`15 in the insulin molecule by a neutral amino acid residue
`BACKGROUND ART
`causes a shifting of the zone of precipitation of the insu
`lin in such a way that a slow release after injection is
`Ever since the discovery of insulin in 1922 many
`different types of insulin preparations have been used
`obtained.
`for the treatment of Diabetes mellitus. At the beginning
`Moreover, Published European Application No. EP
`exclusively insulin solutions exhibiting a rapidly com- 20 214 826 discloses insulin analogues being particularly
`mencing and relatively rapidly ceasing insulin activity
`rapidly absorbed after injection. This effect is a result of
`were used, but later on insulin preparations exhibiting a
`the fact that by means of certain substitutions in particu
`wider profile of activity procured by lowering the solu-
`lar in the B9-B12 region and in the B26-B28 positions in
`bility of insulin by means of additions as e.g. zinc salt
`the insulin molecule a suppression of the association
`and/or protamines have been produced. For reasons of 25 tendency of the insulin is obtained so that it is essentially
`availability the insulin used herefor has normally been
`present as monomer or dimer. However, a number of
`recovered from Pancreas from domestic animals, most
`these insulin analogues exhibits a reduced biological
`frequently oxes, pigs and sheep, however, recently
`activity.
`preparations containing human insulin of biotechnologi-
`Throughout the years a large number of artificially
`cal origin have also appeared on the market.
`30 prepared analogues of human insulin has been de
`The structure of human insulin is shown in the fol-
`scribed, usually with the purpose of elucidating the
`lowing formula
`influence of the structure on the activity, vide e.g.
`
`A-Chain
`
`S-e-S
`
`7
`H-Gly-Ile-Val-Glu-Gln-Cys-Cys-Thr-Ser-Ile-Cys-Ser
`1
`2
`3
`4
`5
`6
`8
`9
`10 11
`12
`S
`
`B-Chain
`H-Phe-Val-Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val
`2
`3
`4.
`5
`6
`7
`8
`9
`10
`1
`2
`
`A-Chain (contd.)
`20
`Leu-Tyr-Gln-Leu-Glu-Asn-Tyr-cys-Asn-OH
`13
`4
`5
`16
`7
`8
`9
`21
`
`s
`
`S
`B-Chain (contd.)
`Giu-Ala-Leu-Tyr-Leu-Val-cys-Gly-Glu-Arg-Gly-Phe
`13
`4
`15
`16
`17
`18,
`9
`20
`21
`22
`23
`24
`
`B-Chain (contd.)
`Phe-Tyr-Thr-Pro-Lys-Thr-OH
`25
`26
`27
`28
`29
`30
`
`The insulins from certain domestic animals are very
`similar in structure to human insulin. Thus dog and pig
`Marke et al., Hoppe-Seyler's Z. Physiol Chem. 360
`insulin differ from human insulin only by containing Ala
`(1979), 1619-1632. Investigations of the influence of
`in position 30 in the B-chain and rabbit insulin only by
`containing Ser in the same position. These insulins may 60 substitutions in the (B22-B26)-sequence of the insulin
`be converted into human insulin by replacement of the
`on the receptor binding have been of particular interest,
`B30-amino acid residue with Thr by semisynthetic pro-
`as said sequence is considered to be an essential site of
`cedures as described by Morihara et al, Nature 280
`binding for the insulin receptor, and as naturally occur
`(1979), 412–413 and Marcussen (U.S. Pat. No.
`ring mutations have been found with substitutions in
`4,343,898).
`65 said site. Vide e.g. S. Shoelson et al. PNAS 80 (1983),
`When such an insulin is dissolved at physiological pH 7390-7394 and M. Kobayashi et al.: Biomed. Res. 5 (3)
`value a concentration-dependent association equilib-
`(1984), 267-272. Very low biological activities were
`rium is established between monomeric, dimeric, tetra-
`found for analogues in which Phe (B24) or Phe (B25)
`
`MPI EXHIBIT 1072 PAGE 7
`
`MPI EXHIBIT 1072 PAGE 7
`
`DR. REDDY’S LABORATORIES, INC.
`IPR2024-00009
`Ex. 1072, p. 7 of 18
`
`

`

`5,164,366
`3
`4.
`the side chain (Cy) is sp2-hybridized (the bonds having
`are substituted, and therefore it was concluded that the
`presence of these two amino acids is of decisive impor
`a planar structure).
`tance to the receptor binding
`Also with the purpose of stabilizing the molecule
`against chemical degradation, Asn in position A21 and
`The present invention is based on the surprising rec
`ognition that certain human insulin analogues in which
`/or B3 may furthermore be replaced by another amino
`one of the amino acid residues Pheb24 or Pheb25) is
`acid residue.
`not present exhibit a low association tendency in solu
`The present human insulin analogues can be charac
`terized by the following formula I
`tion and at the same time exhibits an unchanged or even
`
`A-Chain
`
`S-a-ul-ul-S
`
`(I)
`
`H-Gly-Ile-Val-Glu-Gln-Cys-Cys-Thr-Ser-Ile-Cys-Ser
`
`B-Chain
`
`S
`
`H-Phe-Val-Y-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val
`A-Chain (contd.)
`
`Leu-Tyr-Gln-Leu-Glu-Asn-Tyr-cy-Y-OH
`
`B-Chain (contd.)
`Glu-Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Phe
`
`B-Chain (contd.)
`
`higher in vitro biological activity than human insulin.
`The deletion of either Pheb24 or Pheb25 will have the
`effect that Lys B29) is transferred into Lys B28). The
`position of a positive charge in this position in the
`human insulin molecule is considered to be the impor
`35
`tant aspect of the present invention.
`SUMMARY OF THE INVENTION
`In its broadest aspect the present invention is there
`fore related to human insulin analogues in which there
`40
`is a positively charged amino acid residue, i.e. Lys or
`Arg in the position B28, i.e. in position 8 in the B-chain
`calculated from GlyB20).
`The present insulin analogues have surprisingly a low
`association tendency and at the same time an increased
`45
`physical stability compared to other insulin analogues
`with low association tendency. Introduction of a posi
`tive charge in position B28 may be accomplished in two
`ways. Either by deleting one of the amino acid residues
`in position B24, B25, B26, B27 or B28 in the human
`50
`insulin molecule leading to a human insulin analogue
`with a Lys in position B28 or by substituting ProB28
`the human insulin molecule with a Lys or Arg. If an
`Arg is preferred in position B28 the deletion of one of
`the amino acid residues in position B24, B25, B26, B27
`55
`or B28 may furthermore be combined with a substitu
`tion of the original Lys29 with an Arg residue.
`The present human insulin analogues may further
`more contain one or more modifications in the C-termi
`nal end of the B-chain compared to human insulin.
`Thus, the amino acid residues in position B25 to B27
`and the amino acid residue(s) following the Lys28) or
`Arg2 may be arbitrarily chosen among the naturally
`occurring amino acid residues or B29 or B30 or both
`may be lacking.
`According to one aspect of the present invention
`Tyr26) may be substituted by another uncharged
`amino acid residue wherein the second carbon atom in
`
`65
`
`wherein X1, X2, X3, X5, Y1 and Y2 may be any naturally
`occurring amino acid residue, X4 is Lys or Arg, X6 may
`be any naturally occurring amino acid residue carrying
`the C-terminal hydroxy group or -OH or X5 and X6
`together form the C-terminal hydroxy group.
`In an embodiment of the invention X5 is selected from
`the group consisting of any naturally occurring amino
`acid residue except Pro.
`In the above formula Y and/or Y2 may in one en
`bodiment be selected from the group consisting of any
`naturally occurring amino acid residue except Asn.
`In the above formula IX may more specifically be
`Phe, Ala, His, Thr, Ser, Asn or Tyr,
`X2 may more specifically be Tyr, Thr, Glu, Asp, Ala,
`His, Ser or Phe,
`X3 may more specifically be Pro, Glu, Asp, Ser, Thr
`or His,
`X5 may more specifically be Lys, Thr, Ser, Ala, Asp
`or Glu,
`X6 may more specifically be Thr-OH, Ser-OH, Ala
`OH, Asp-OH, Giu-OH or -OH,
`Y1 may be Asn., Glu, Asp, His, Ser, Thr, Val, Leu, Ile,
`Ala, Met, Trp, Tyr, Gln or Gly, more preferably Gly,
`Asp, Glu or Ala, and
`Y2 may be Asn., Glu, Asp, His, Ser, Thr, Val, Leu, Ile,
`Ala, Met, Trp, Tyr, Gin or Gly, more preferably Glu or
`Asp.
`One group of the present human insulin analogues
`can be characterized as such in which one of the amino
`acid residues in position B24 or B25 has been deleted,
`that the amino acid residue in position B26, optionally,
`is substituted by another uncharged amino acid residue
`in which the carbon atom in the y-position is sp2-hybri
`dized, that, optionally, one or more of the amino acid
`residues in positions A21, B3 and B30 differ from the
`amino acid residue in the corresponding positions in
`human insulin, and that, optionally, no amino acid resi
`due is present in position B30.
`
`MPI EXHIBIT 1072 PAGE 8
`
`MPI EXHIBIT 1072 PAGE 8
`
`DR. REDDY’S LABORATORIES, INC.
`IPR2024-00009
`Ex. 1072, p. 8 of 18
`
`

`

`5,164,366
`5
`6
`Asp421-desPheB25,des.Thr530-human insulin
`According to a more simple definition such analogues
`Asp28-des(Pheb25-human insulin
`are human insulin analogues in which TyrB26) is not
`Asp-desPheb25-human insulin
`present, in which Phe P25 has optionally been substi
`Lys B28-human insulin
`tuted by another uncharged amino acid residue in
`which the carbon atom in the y-position is sp2-hybri
`Lys B28,ThrB29-human insulin
`Arg528-deslys B29-human insulin
`dized, in which one or more of the amino acid residues
`in positions A21, B3 and B30, optionally, differ from the
`The human insulin analogues according to the pres
`ent invention may advantageously be used in the treat
`amino acid residues in human insulin and in which op
`tionally no amino acid residue is present in position B30.
`ment of Diabetes as the decreased ability to association
`Examples of uncharged amino acid residues in which
`leads to a faster uptake in the bloodstream than an ordi
`Cy is sp2-hybridized are Tyr, Phe, His, Trp and Asn.
`nary insulin not only after the normally used subcutane
`ous injection but also by non-parenteral use, vide e.g.
`It is possible to introduce further substitutions or
`Published International Application No. WO87/06137.
`derivatizations in the human insulin analogues men
`Also their improved physical stability will make them
`tioned above if the properties do not change substan
`more advantagous in the Diabetes treatment.
`tially. Such further derivatizations could be esterifica
`tion or amidation of carboxyl groups, acylation or alky
`The insulin analogues according to the present inven
`tion may be prepared by altering the proinsulin gene
`lation of amino- or hydroxyl groups or could be deami
`through replacement of codon(s) at the appropriate site
`dation of carboxamide groups. Further substitutions
`maybe exchange of Thr48) with His or of His B10) with
`in the native human proinsulin gene by codon(s) encod
`Asp. Moreover, it is possible to add or delete a single or
`ing the desired amino acid residue substitute(s) and/or
`20
`by deleting the codon(s) corresponding to the desired
`a few amino acid residues at the C- and/or the N-termi
`deletion(s). Alternatively, the whole DNA-sequence
`nal of preferably the B-chain.
`encoding the desired insulin analogue may be synthe
`One group of the human insulin analogues according
`sized. The gene encoding the desired insulin analogue is
`to the invention will have the structure shown in for
`then inserted into a suitable expression vector which
`mula II below, where X means Tyr, His, Phe or Asn, Y
`25
`when transferred to a suitable host organism, e.g. E.
`means Thr, Ser, Ala, Asp or Glu or a deletion and
`coli, Bacillus or yeast, generates the desired product.
`where optionally one or both of the underscored Asn
`have been changed to Asp by substitution or deamida
`The expressed product is then isolated from the cells or
`the culture broth depending on whether the expressed
`tion or the underscored Asn in the A-chain may be Gly.
`product is secreted from the cells or not.
`
`O
`
`15
`
`30
`
`A-Chain
`
`S-mesonaa-nui-S
`
`(II)
`
`H-Gly-Ile-Val-Glu-Gln-Cys-Cys-Thr-Ser-Ile-Cys-Ser
`
`S
`
`B-Chain
`
`S
`H-Phe-Val-Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val
`A-Chain (contd.)
`Leu-Tyr-Gln-Leu-Glu-Asn-Tyr-Cys-Asn-OH
`
`B-Chain (contd.)
`Glu-Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Phe
`
`B-Chain (contd.)
`X-Thr-Pro-Lys-Y-OH
`
`Preferred human insulin analogues according to the
`invention are the following:
`desPhe-25-human insulin
`desTyrB26-human insulin
`desThrB27-human insulin
`desProB28-human insulin
`des Pheb25-porcine insulin
`des ProB28-porcine insulin
`des Pro B28-rabbit insulin
`des Pheb25,des Thr530-human insulin
`desTyrB26,des Thr530-human insulin
`SerA2ll-desProB28-human insulin
`Gly421)-desiProB28-human insulin
`Gly/21-desPheb25-human insulin
`Asp421)-des(Pheb25-human insulin
`HisB25-des.TyrB26,des.ThrB30-human insulin
`Asn-B25-desTyrB26,des.ThrB30-human insulin
`
`55
`
`65
`
`The novel insulin analogues may also be prepared by
`chemical synthesis by methods analogue to the method
`described by Märki et al. (Hoppe-Seyler's Z. Physiol.
`Chem., 360 (1979), 1619–1632). They may also be
`formed from separately in vitro prepared A- and B
`chains containing the appropriate amino acid residue
`substitutions and deletions, whereupon the modified A
`and B-chains are linked together by establishing disul
`phide bridges according to known methods (e.g.
`Chance et al., In: Rick DH, Gross E (eds) Peptides:
`Synthesis-Structure-Function. Proceedings of the
`seventh American peptide symposium, Illinois, pp.
`721-728),
`The insulin analogues may furthermore be prepared
`by a method analogue to the method described in EP
`patent application No. 0163529A, the disclosure of
`which is incorporated by reference hereinto. By such
`
`MPI EXHIBIT 1072 PAGE 9
`
`MPI EXHIBIT 1072 PAGE 9
`
`DR. REDDY’S LABORATORIES, INC.
`IPR2024-00009
`Ex. 1072, p. 9 of 18
`
`

`

`O
`
`15
`
`20
`
`5,164,366
`7
`8
`method an insulin precursor of the human insulin ana
`logues according to the present invention or a pharma
`logue wherein the basic amino acid in position B28 or
`ceutically acceptable salt thereof in aqueous solution or
`B29 (if the final product shall have a basic amino acid in
`suspension, preferably at neutral pH. The aqueous me
`this position) is connected to Gly41 by means of either a
`dium is made isotonic, for example with sodium chlo
`peptide bond or a peptide chain of varying length is
`ride, sodium acetate or glycerol. Furthermore, the
`expressed and secreted by yeast with correctly posi
`aqueous medium may contain zinc ions, buffers such as
`tioned disulphide bridges and is then converted into the
`acetate and citrate and preservatives such as m-cresol,
`desired human insulin analogue by the Morihara
`methylparaben or phenol. The pH value of the prepara
`method (Morihara supra) or the so-called transpeptida
`tion is adjusted to the desired value and the insulin
`tion reaction (see U.S. Pat. No. 4,343,898).
`preparation is made sterile by sterile filtration.
`Accordingly the present insulin analogues may be
`The present insulin analogues may also be mixed with
`prepared by inserting a DNA-sequence encoding a
`other insulin analogues having a protracted insulin ac
`precursor of the insulin analogue in question into a
`tivity to prepare insulin preparations consisting of a
`suitable yeast expression vehicle which when trans
`mixture of rapid acting and protracted insulin.
`ferred to yeast is capable of expressing and secreting the
`The insulin preparations of this invention can be used
`precursor of the insulin analogue in which Lys28,
`similarly to the use of the known insulin preparations.
`Arg528), Lys29 or Arg29) is connected to GlyA1 by
`a peptide bond or a peptide chain with the formula III
`TERMINOLOGY
`The abbreviations used for the amino acids are those
`-R-R-
`(III)
`stated in J. Biol. Chem. 243 (1968), 3558. The amino
`acids are in the L configuration. Unless otherwise indi
`wherein R is a peptide chain with namino acid residues,
`cated, the species of insulins stated herein is human.
`n is an integer from 0 to 33 and R is Lys or Arg when
`culturing the transformed yeast strain in a suitable nutri
`BRIEF DESCRIPTION OF THE DRAWINGS
`ent medium. The precursor is then recovered from the
`25
`culture broth and reacted with an amino compound
`The invention is further illustrated with reference to
`the accompanying drawings in which
`with the formula IV
`FIG. 1 shows the expression plasmid pYGABA
`14276,
`FIG. 2 shows the yeast vector paB24,
`FIG. 3 shows the DNA sequence of the 0.4 kb
`EcoRI-Xbal fragment from the plasmid pKFN-864, and
`FIG. 4 shows the preparation of the expression plas
`mid pKFN-866.
`DETAILED DESCRIPTION
`DNA-sequences encoding modified insulin precur
`sors were constructed with basis in the expression cas
`sette, which is contained in the BamHI restriction frag
`ment from the expression plasmid pYGABA as shown
`in FIG. 1, has a lenght of 1103 basepairs and contains
`essentially the following (listed in succession starting
`from the 5'-end): The GAPDH promoter (Travis et al.,
`J. Biol. Chem., 260 (1985), 4384-4389) followed by the
`coding region consisting of: The 83 N-terminal amino
`acids of the MF a 1-leader sequence encoded by the
`wild-type yeast DNA-sequence as described by Kurjan
`& Herskowitz followed by the two codons AAA and
`AGA encoding Lys and Arg and again followed by the
`coding region for the insulin precursor single chain des
`Thr30- human insulin (SCI), which is a synthetically
`constructed gene using preferred yeast codons. After
`two stop-codons, a Sall restriction site is positioned, and
`the rest of the sequence constitutes the MFa1-sequence
`containing the terminator region. The sequence is con
`structed using entirely standard techniques.
`The method employed was "oligonucleotide site di
`rected mutagenesis', which is described by Zoller &
`Smith, DNA, Vol. 3, No. 6 (1984), 479-488. The
`method is briefly described in the following, and is
`described thoroughly in Example 1. The insulin precur
`sor sequence is isolated from the expression plasmid and
`inserted into a single-stranded genom, circular M13
`bacteriophage vector. A chemically synthesized com
`plementary DNA-strand is then annealed to the single
`stranded genom. The DNA-strand contains the desired
`sequence surrounded by sequences completely homolo
`gous to insulin sequences on the circurlar DNA. The
`
`Q-OR"
`(IV)
`wherein Q is a single amino acid residue, preferably
`Thr, or a dipeptide, and R' is a carboxy protecting
`group (e.g. methyl or tert-butyl), using trypsin or tryp
`sin-like enzyme as a catalyst in a mixture of water and
`organic solvents analogously as described in U.S. Pat.
`No. 4,343,898 (the disclosure of which is incorporated
`by reference hereinto) whereupon the carboxy protect
`ing group is removed and the insulin analogue is iso
`lated from the reaction mixture.
`If the insulin analogues contain an amino acid residue
`different from Lys or Arg as the C-terminal residue in
`the B-chain, they may also be prepared by a method
`analogue to the method described in Published Euro
`pean Application No. EP 195 691 the disclosure of
`which is incorporated by reference hereinto. By this
`method insulin analogue precursors of the type having a
`45
`bridge between the A- and B-chain consisting of a single
`pair of basic amino acid (Lys, Arg) are made in yeast
`and then converted into the insulin analogue by an
`enzymatic conversion.
`If the C-terminal amino acid residue in the B-chain is
`Lys or Arg, then the insulin analogues can be prepared
`from the above biosyntetic precursors by enzymatic
`cleavage with trypsin.
`Human insulin analogues of the invention in which
`substitutions are only present within the last amino acid
`55
`residues nearest to the C-terminal of the B-chain may
`moreover be prepared in a manner known perse from
`e.g. porcine insulin as described in K. Inoye et al.; JACS
`101 (3), (1979), 751-752, whereby the porcine insulin is
`first split with trypsin to des-(B23-30)-human insulin,
`whereupon the latter, also enzymatically, is coupled
`with a synthetic peptide having the desired amino acid
`sequence.
`The present insulin analogues may be used for the
`preparation of novel insulin preparations with insulin
`activity to be substituted for human or porcine insulin in
`the insulin preparations heretofore known to the art.
`Such novel insulin preparations contain the insulin ana
`
`30
`
`35
`
`50
`
`65
`
`MPI EXHIBIT 1072 PAGE 10
`
`MPI EXHIBIT 1072 PAGE 10
`
`DR. REDDY’S LABORATORIES, INC.
`IPR2024-00009
`Ex. 1072, p. 10 of 18
`
`

`

`O
`
`15
`
`5,164,366
`10
`primer is then extended in vitro into the entire length of
`merase. Then, the reaction was carried out for 16 hours
`the circular genom biochemically using Klenow poly
`at 16 C.
`merase. This strand will give rise to single-stranded
`Transformation of JM101:
`phages, which when grown in E. coli give the possibility
`The reaction mixture above was transformed in dif
`ferent dilutions into CaCl2-treated E. coli JM101 cells
`of isolating double-stranded DNA with the desired
`using standard techniques and plated in 2XYT topagar
`sequence. From this double-stranded DNA, a restric
`on 2XYT agar plates. (2XYT=tryptone 16 g/liter,
`tion fragment can be isolated and reinserted into the
`yeast extract 10 g/liter, NaCl 5 g/liter. 2XYT topa
`expression vector.
`gar=2XYT with 0.4% agarose added and autoclaved.
`MODES FOR CARRYING OUT THE
`2XYT agar plates=2XYT with 2% agar added and
`INVENTION
`autoclaved). The plates were incubated at 37 C. over
`night.
`The invention is further illustrated by the following
`Identification of positive clones:
`Examples.
`The method used was plaque-lift hybridisation which
`is described in the following: a nitrocellulose-filter was
`placed on a plate with a suitable plaque-density, so that
`the filter was wetted. The filter was then bathed in the
`following solutions: 1.5 M NaCl, 0.5M NaOH for 30
`sec., 1.5 M NaCl, 0.5M Tris-HCl, pH 8.0 for 1 min.,
`2x SSC (0.3 M NaCl, 0.03M sodium citrate) till later
`use. The filter was dried on 3MM filter paper and baked
`for 2 hours at 80 C. in a vacuum oven.
`The mutagenisation primer with the sequence
`5'TTGGAGTGTAGAAACCTCTT-3' was labelled
`radioactively in the 5' end in a 30 uliters volume con
`taining 70 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 5 mM
`DTT, 10 pmol oligonucleotide, 20 pmol y-32P-ATP and
`3.5 units of T4 polynucleotide kinase. The mixture was
`incubated at 37 C. for 30 min. and then for 5 min. at
`OO C.
`The dried filter was prehybridised for 2 hours at 65
`C. in 6XSSC, 0.2% bovine-serum albumin, 0.2% Ficol,
`0.2% polyvinylpyrrollidon, 0.2% sodium-dodecyl-sul
`phate (SDS) and 50 g/ml salmon-sperm DNA. Then,
`the reaction mixture containing the labelled probe was
`added to 15 ml of fresh prehybridisation mix, and the
`filter was bathed herein overnight at 28 C. with gentle
`shaking. After hybridisation the filter was washed 3
`times for each 15 min. in 2XSSC-0.1% SDS and au
`toradiographed. After wash in the same solution, but
`now at 52 C., and another autoradiography, plaques
`containing DNA-sequences complementary to the
`mutagenisation primer were identified.
`Re-screening of positive clones:
`Because the identified clone is a result of a heterodu
`plex, the plaque was plated again. The hybridisation and
`identification were repeated.
`Purification of double-stranded M13-phage DNA:
`A re-screened clone was used for infection of the E.
`coli strain JM101. A culture containing approximately
`10° phages and 5 colonies of JM101 was grown for 5
`hours in a 5 ml 2XYT medium at 37 C. Then, double
`stranded, circular DNA was purified from the pellet
`according to a method described by Birnboim & Doly,
`Nucleic Acids Res., 2 (1979), 1513.
`Isolation of a restriction fragment containing modi
`fied insulin precursor:
`The DNA-preparation (appr. 5 ug) isolated above
`was digested with 10 units of the restriction endonucle
`ase BamHI in 60 uliters of 100 mM. NaCl, 50 mM Tris
`HCl, pH 7.5, 10 mM MgCl2, and 1 mM DTT for 2 hours
`at 37 C. The DNA-products were separated on an
`agarose-gel, and the fragment was purified from the gel.
`Ligation to the yeast vector pAB24 (FIG. 2):
`The isolated restriction fragment was ligated to the
`yeast vector pAB24 digested with the restriction endo
`nuclease BamHI in the following reaction mixture:
`Fragment 0.2 ug, vector 0.02 ug, 50 mM Tris-HCl, pH
`
`EXAMPLE
`Construction of an expression plasmid, which can be
`used to express des Pheb25-SCI.
`The expression cassette, which is contained in the
`expression plasmid pYGABA (shown in FIG. 1) on a
`20
`BamHI restriction fragment, was isolated: The expres
`sion plasmid was incubated with the restriction endonu-.
`clease BamHI. The conditions were: 20 tug of plasmid,
`50 units of BamHI, 100 mM. NaCl, 50 mM TrishCl, pH
`7.5, 10 mM MgCl2, and 1 mM DTT in a volume of 100
`25
`uliters. The temperature was 37° C. and the reaction
`time 2 hours. The two DNA-fragments were separated
`on a 1% agarose gel, and the desired fragment was
`isolated.
`Ligation to the M13 vector M13mp18:
`30
`The isolated restriction fragment was ligated to the
`bacteriophage vector M13mp18 also cut with the re
`striction endonuclease BanhI in the following reaction
`mixture: Fragment 0.2 ug, vector 0.02 ug, 50 mM Tris
`HCl, pH 7.4, 10 mM MgCl2, 10 mM DTT and 1 mM
`35
`ATP in a volume of 20 uliters. 5uliters of this mixture
`were transformed into the E. coli strain JM101. The
`presence of fragment in the vector and the orientation
`of the fragment was determined by restriction enzyme
`mapping on double-stranded M13-DNA isolated from
`the transformants.
`Isolation of single-stranded (ss) DNA (template):
`From the transformant described above ss-DNA was
`isolated according to a method described by Messing in
`Gene, 19 (1982), 269-276.
`5'phosohorylation of the mutaqenisation primer:
`The mutagenisation primer with the sequence 5'-
`TTGGAGTGTAGAAACCTCTT-3 was phosphory
`lated in the 5'-end in a 30 uliters reaction mixture con
`taining 70 mM Tris-HCl, pH 7.0, 10 mM MgCl2, 5 mM
`50
`DTT, 1 mM ATP, 100 pmol oligonucleotide and 3.6
`units of T4 polynucleotide kinase. The reaction was
`carried out for 30 min. at 37° C. Then, the enzyme was
`inactivated by incubating the mixture for 10 min. at 65
`C.
`Annealing of template and phosphorylated mutageni
`sation primer:
`Annealing of template and primer was carried out in
`a 10 liters volume containing 0.5 pmol template, 5
`pmol primer, 20 mM Tris-HCl, pH 7.5, 10 mM MgCl2,
`50 mM. NaCl and 1 mM DTT by heating for 10 min. at
`65 C. and cooling afterwards to 0°C. .
`Extension/ligation reaction:
`To the reaction mixture above, 10 uliters of the fol
`lowing mixture were added: 0.3 mM dATP, 0.3 mM
`65
`dCTP, 0.3 mM dGTP, 0.3 mM TTP, 1 mM ATP, 20
`mM Tris-HCl, pH 7.5, 10 mM MgCl2, 10 mM DTT, 3
`units of T4 DNA ligase and 2.5 units of Klenow poly
`
`45
`
`55
`
`MPI EXHIBIT 1072 PAGE 11
`
`MPI EXHIBIT 1072 PAGE 11
`
`DR. REDDY’S LABORATORIES, INC.
`IPR2024-00009
`Ex. 1072, p. 11 of 18
`
`

`

`15
`
`30
`
`5,164,366
`11
`12
`pharose (RFF previously equilibrated with 50 mM
`7.4, 10 mM MgCl2, 10 mM DTT, 1 mM ATP in a total
`volume of 20 uliters. 5 uliters of this reaction mix was
`acetic acid, 50% (by volume) ethanol adjusted to pH