`
`lrq1o
`
`i, i.,
`
`Fqrt3-
`
`r&q
`
`7:
`
`f5lqlqlJ'
`
`I
`
`NUMBER
`
`NUITTBER
`i)?13')9,658
`
`FIUilO DATE
`fi8/?S/8
`
`letr
`J-14'
`
`PAUL 5- NELS0Nr UNI0N CITYr CA-
`
`*olc 0NT I NUI frlG DATA **************** ****ryy'dilF
`V.EIIIFIED
`AL.--
`
`,,,'li:i 1z\
`( -/ !
`niL'
`N n *'""ial
`
`1
`
`,t
`
`{**ronErr
`'[ vrnrr:r N/PCT
`fi e-r.
`
`A PPL ICA T I 0N S* **.rt,t***** ** tr16,r/ (
`
`0rLI6tr f ILINS LICiNSij. fRANTTD #tl16lfrt)
`prlorlty clrlmed Elycs
`llgcondluonrmrt Eyct
`
`i{0ilAlr sALIFAi{cHIl(
`?t,71 N-!{. 41 ST 5Tf?ltTr STE. A-1
`UATNESV.ILLI-r FL ]26.i6
`
`Fot
`35 I
`
`fiat
`
`lffiUr/
`
`r.lm:rr5ffinu.-b-.r{
`
`. \Jf\
`
`r w{lL
`
`ij}-!ffiu#,."-suLTIFu{'jcTI0i{ALc0NTRi]LLi.DpC1-;EGLA$1j
`t*+e+*-l itrAG[r\r.t ]( silL'[0 p]JA r
`i
`OL X60hI{JCLECTIDs 5YN?HIS I $
`, -- :fe&
`U.S. OEPT. ot cOMM.f,.t. & TM Offlc. - frTO436L (rav. 1G78f ,
`.tQr
`$*
`c\
`
`PARTS OF APPLICATION
`$ril-Ep $EplnltelY
`
`nl4tt
`
`CLAIMS ALLqWED
`Prlnt Claim
`
`T
`
`DRAWING
`
`lssuE .
`A --.
`BA'rcH ole
`NUMBER / / )
`
`o,pmilrffi$effiurrure
`itDTllNlT lfltt3 Prlmary Examlner
`
`and conltactore onlY.
`
`
`
`Page 1 of 43
`
`ILMN EXHIBIT 1012
`
`
`
`.
`
`,/i
`, ,.i i/ iraf
`l{APPROIED FOR
`i , lJ_ ,,t,
`
`'.ISENSE
`
`INITIALS
`
`Recelved
`or
`Mailed
`
`7rf
`(7o,-,
`' , o'rf
`/-2?
`
`!r,&.-
`
`-
`'':k '"'
`
`ill /39#6S,s
`
`Entered
`or
`Counted
`
`13.
`
`14.
`
`15.
`
`16.
`
`17.
`
`18.
`
`19.
`
`20.
`
`21.
`
`22.
`
`29.
`
`24.
`
`25,.
`
`26.,
`
`,o,ti
`
`' 31.
`
`rr,\i
`
`tr
`ffii
`ffii"
`
`if
`"tf
`
`ffi
`ffii
`ffil
`ffi
`lri
`t
`
`itI
`
`
`
`Page 2 of 43
`
`
`
`\
`
`,
`
`PATENT APPLIcATIoN sERIAL No.
`
`U.S. DEPARN4ENT OF COMMERCE
`PA"TENT AI{D TRAEEMARK OFFICE
`FEE RECORD SHEET
`
`s 11@r ,ffid$Yffi, $ffiffifr,, Wffi$ $# ffir
`
`.ffi,ffiS1{
`
`./
`
`ai
`
`PTO-I556
`(5 / 87)
`
`/
`
`
`
`Page 3 of 43
`
`
`
`2rg
`
`of Patents and Tlademarls
`D.e zfi2sr
`
`[1/399558
`-. JCKET NO. cl-r
`
`Transmitted herewith fs1 fillng is the patent application of:
`
`Inventor(s): Paul S. Nel-son
`'i{ethod for FunctlonaLizlng and Labeling the 3r Terminus of a Synthetic
`Entitled: 0LigonucLeotide Uslng a Uitque Multifuictional ControLled Pore Glass (I4F-CPG)
`Reagent ln Solld Phase 0l-lgonucleotLde Synthesls
`Enclosed are:
`I X I
`Declaration and Power of Attorney form(s)
`Three (3)
`I xI
`sheets of drawings and two sets of soft oopies
`Assignment(s) of the iwention to Clontech Laboratorles. Inc.
`I x]
`
`I xl
`t xl
`I xl
`
`Irtter re Assignment(s)
`Declaration$) claining stafiN alr a small busines entity/nonprofit organization
`Acknowledgemcnt postcard
`
`CI-AIMS AS FILED
`Number filed Number Ertra
`
`Basic Fee
`
`Total Claims
`
`lndependent C1aims
`
`26
`
`-2fr z
`
`-3 =
`
`Rate
`
`x$6
`
`x $18
`
`$185
`
`36
`
`Total Filing Fee
`
`s22r
`
`IX]
`lxI
`lxI
`
`g22r
`
`to Deposit Aocount No. 19-0065. A duplicate copy
`
`Please charge
`sf rhis sheet is enclosed.
`The Commissioner is hereby authorized to charge any additional filing fees which may be
`required, or credit any overpayment, ot Deposit Aocount No. 194065. A duplicate oopy of ttti*
`sheet is enclosed"
`This application is being nailed by Express lrdail under
`appears below.
`
`CFR 1.10 and
`
`certiflcate
`
`of Reoord
`
`CERTmCATE OF rdArLrNC By FXPRESS MAIL (3J CFR 1.10)
`l"tail No.: l,g034p?845x I
`Date of Deposir A.gusr 2g, t9g9
`FIPr€ss
`lh.tUy certify tat tnrs papel is teing eepositeC witn the United Sta
`Office to Addressee" seMce under 3J cFR 1.10 on the date indicatcd above and is adoressec to the
`Commissioner of Patents anA tae11ts, Washingon, D.CzVLgt.
`
`l
`
`Dorls C. SaLlwanchlk
`Name of person rnailing paper
`
`
`
`Page 4 of 43
`
`
`
`q
`
`y.$K
`
`*\ 01/39 655 A0/- 4
`
`)
`
`{
`
`Cl-t
`
`.*
`
`,:t
`
`frs'
`f%
`/ttL.r
`i"6
`i4,
`l, I
`
`associated with a variety of hlJman diseases such as the hemoglobinopathies
`(Saiki, R.K, S. Scharf, F. Fdoona, ICB. Mullis, G.T. Hor& HA Erlich' and N.
`f /f Arnheim [19S5J Science 8;A:1350-1354; Embury, $.]1., S.J. Scharf, R.K Saiki,
`I Mi" Gholso4 M. Golbug N. rArnheim, and HA Erlich [1984 N. Engl" J. Med.
`3L62656660) and cancer (I-tL E, B. Hjelle, R. Morgan, F. Hech! and J.M.
`/ /
`'l 1/ Bishop t1984 Nature 330:186-188; Rodenhuis, S., ML van de Wetering, W.J.
`Moor, S.G. Evers, N. van tu*"ijb and J.L. Bos [1987] N. Engl. J. Med.
`f
`3L72929-935). Previously, if no convenient restriction sites were altered by the
`f
`base change, then the only recourse has been to clone and sequence the affected
`gene. Recently, polymerase chain reaction (PCR) amplification of the DNA
`segment in question, coupled with hybridization of specific oligonucleotide probes,
`has allowed sequence determination witlout the need for molecular cloning. The
`applicability of the latter technique is dependent on the availability of versatile
`
`and inexpensive oligonucleotide probes.
`Methods to covalently attach labels and reporter molecules to
`oligonucleotides have permitted their use as non-radioactive hybridization probes.
`
`t\ ti
`
`/'i
`
`New technologies in non-isotopic gene probes (Agrawat, S, C. Christodoulou, and
`lt,7 / 7 M.J. Gait [1936] Nucl. Acids Res. 14:6227-6245; Connolly, BA [198fl Nucl.
`
`2).
`
`
`
`Page 5 of 43
`
`
`
`-)
`
`'29-l
`
`Acids Res. 15:313t-j139; Jablonski, E., E.W; Moomaw, R.H. Tullis' and J.L. Ruth
`11936l Nucl. eriJJ Res. 74:61L5:5128; Haralambidis, J, M. Chai and G.W.
`i,'
`lf
`{
`ft"gi"t llgS[Nucl. Acids Res. 15:48577!576; I-r, P., P.P. Medon, D.C.Skingle,
`- 4 4'
`lr
`JA l-an-ser, dnd R.H. Spons [1984- Nucl. Acids Res. ].5:527515287), DNA
`sequencing analysis (smi; tM.:S rfos M.w. Hunkaptll ,r, t.!.Lo***"r,
`and L.E. Hood F985J Nucl. Acids Res. 13:2399fr412; Sproaq 8.S., B. Beijer, P.
`6ilr
`Rider, and P. Neundr V98T, Nucl. Acids Res. 15:4837"-!8a8; fuisorge, W., B.
`.s q'
`-C. Schwager, and M. 7rlr&;e ,I1987l"Nucl. Acids Res.
`Sproag J. Stegemann,
`L5:a5%-*I602), electron microscopy,(Sproag 8.S., B. *i;o, ta p. Rider t1984
`lrlf!
`Nucl. eiias Res. L5:61SVf1%), and X-ray crystallography (Sproat et aL
`ISST
`Nucl. Acids Res. 15:483W8) have provid-ed impetus for the development arid
`imFrovement of such methods. As applications continue to emerge, more
`convenient oligonucleotide labeling techniques and reagents will be required.
`Cur-rent methods to introduce chemical modifrcations into oligonucleotides
`employ special phosphoramidite reagents during solid phase qptftesis. Attention
`has focused on the 5' terminus and a number of protected amino-alkyl
`phosphoramidites have been reported (furawal et al, supra; Connolly, gupra:
`Jablonski et al, supra; Snith et al, supra; Sproat et al. [198!J.[ucl. Acids Res.
`15:6181-6196; Sinha, N.D. and R.M. Cook [f988]Nucl. e]4, fi,es. 16:26 59;?669)
`g f
`/r
`17
`to incorporate a 5' terminal aliphatic primarl'amine. Oligonuclcotides modified
`by, these reagents can be subsequently derivatized with fluorophores, biotin, and
`other molecules. Similarly, phosphoramidite reagents have also been described
`which incorporate a thiol functionality on the 5' terminus (Sproat et A. ]tSA\,
`Nucl. Acids Res. 15:483!fU8; Ansorge et al, supra; Connolly, B.AI1985] Nucl.
`Acids Res. 13:448+,*502\.
`/f
`Techniques modiffing the 3' terminus are inconvenient and t,
`convenient and tedious.
`Irmaitre et al. (Irmaitre, M, B. Bayard, and B. LebleuJ-198{_Proc. Natl. Acad.
`Sci. USA 84:il87fi52; I-emaitre, M, C. Bisb4 B. Bayard, and B. I-ebleu [1934
`//4:,
`
`q?
`",
`
`t.i
`l,!i'
`
`!{J
`
`I
`
`dl"
`
`nt'
`
`10
`
`15
`
`20
`
`25
`
`
`
`Page 6 of 43
`
`
`
`\
`
`Cl--.l
`
`3
`Nucleosides and Nucleotides 6:3LL:315) have described the attachment of a
`/y
`ribonucleoside to the 3' terminus of an oligonucleotide using T4 RNA ligase.
`Terminal 3' modification was achieved after periodate-oxidation of tle ribose
`ring followed by redutti* qqiattion. Another procelure by Zuckerman et al.
`(Zuckerman, R, D. C-orey, and P. Schuttz .lLgl4Nucl. Acids Res. 15:5305-.5321)
`+j4"7'
`incorporates a 3' terqinal thiol group via solid phase oligonucleotide synthesis.
`Although this procedure is more efEcieng it requires many qynthetic steps and
`purifications. Thus, there remains a need for a simple and efficient method to
`synthesize 3' labeled oligonucleotides.
`
`t
`
`,
`t.l
`^ ( (- - L tlC ' Briefrsummary of the Invention
`,o
`i
`The subject invention concerns a reagent for use in solid phase
`oligonucleotide synthesis, having the following structure:
`
`.\,/"
`
`,zc:
`\*-*
`Ro-Y/
`
`(r)
`
`10
`
`.......--f"''"-
`15
`.-- 'l; " y-
`i vl t-/
`ll
`
`.i
`
`wherein:
`
`C = carbon atom;
`
`?5 {'
`
`![ = any solid such as controlled pore gtass (cPG tcPG Biosupport, Inc.,'
`Fairfield ND, alkylamine OG, wherein alkyl can be from 1 to 50 carbon atoms,
`f
`and isomeri'c forms thereot any chemigal psdification of CPG, wherein the
`modification can be aminss, hydroryls, carboryls, sulftrydryls, or disulfides,
`
`uy
`
`
`
`Page 7 of 43
`
`
`
`)
`
`4
`CI-l
`polystyrene and any solid support stable to all the conditions of solid phase
`oligonucleotide qynthesis; W can also be a non-solid phosphoramidite group,
`4P(OR3)N&Rs, wherein R, i -CFI3, -CH2CI{2CN, or alkane of 1 to 50
`carbon atoms, inclusive, and isomeric forms thereof and t{.4, Rs = met}ryl, ethyl,
`isopropyl, or alkane as defined above (if W is a non-solid phosphoramidils gfoup
`it is not restricted to the 3' terminus);
`
`+
`
`X : a cleavable linking ann connecting carbon C to W which can be any
`combination of atom groups (e.g., -(CIIz)o-, {CO-, -&y-NHC0-, -CONH-)
`that covalent$ connects to the solid phase (\il) through a cleavable linkage, and
`is stable to all tle conditions of solid phase oligonucleotide qynthesis. Cleavable
`linkages include esters which are cleaved with ammonium hydroxide and
`disulfides which are cleaved urith reducing agents. After oligonucleotide synthesis,
`cleavage of X from the solid phase results in the transfer of the entire
`multifunctional linking arm to thc 3' terminus of the qnthesized oligonucleotide.
`Preferably, X = -O-{O-{FIr{FIr{O- (succinic acid) which is readily cleaved
`from the solid phase with ammonium hydroxide;
`
`r1i,'
`
`5
`
`,ttl
`NJil
`' l-tt>
`
`10
`
`15
`
`| 't-
`
`L./
`
`/2,
`I.'i
`20!
`IL-
`
`/7,
`'i
`2s/
`Jk
`
`Y = a linking ann connecting carbon C to &O- that is at least one carbon atom
`long and can be any combination of atom groups (e.g., {CFI2)'-, -OCO-, 4O2,
`-NHCO-, -€ONH-)
`that co\.alently connects to OR1 and is stable to all the
`conditions of solid phase oligonucleotide qynthesis;
`
`Z = a tinking ann connecting carbon C to R2-A- that is at least one carbon
`atom long and can be any combination of atom groups (e.g., -(CFIz)o-, -OCO*,
`{O2, -NFICO-, -€ONH-)
`that covalently connects to AR2 and is stable to all
`the conditions of solid phase oligonucleotide synthesis;
`
`{
`
`
`
`Page 8 of 43
`
`
`
`il
`I
`
`R1O = a protected hydroxide group where
`hydroryl protecting grouP, €€., Rr can be
`rlimgthsxylriqfl (DMT);
`
`\
`
`cL1
`& is a base stable-acid labile
`rnonomethoxytrityl (MMT) or
`
`f' 5 /"7
`
`A = -NH-, --S-, or any furrcti-onal grotlp that is capable of attaching a reporter
`molecule or any detectable comple,:q
`
`,'4
`
`10
`
`I
`f fJ
`
`v
`
`,,.li" ? e"-
`lrs
`/ ^'
`t/i2
`
`{
`?.rr.
`--__ffi*^
`*f
`[rd]X
`
`25''7
`
`Rz = corresponding protecting group for A that is stable to all the conditions of
`solid phase
`and
`
`lligonucleo{dg,synthesi5
`
`B = fI, -€FI3, .-7--A-Ry-Y-O&, or any combination of atom groups that are
`inert to solid phase oligonucleotide synthesis.
`
`Specifically exemplified herein is MF-CPG@(3' Amine-ON CPG) whereig
`with reference to (I) above, \{ = long chain alkyl amine CPG; X =
`; B = H; Y - 4rtlriZ = 4*lr; A = -NH-; Rz =
`(Fmoc), trifluoroacetyl (fFA), or any base labile.acid stable
`amine protecting gpup; and & = DMT.
`The structure of MF-CPGo(3' Amine-ON CPG) is as follows:
`
`Fmoc-NH-€H,
`\,/ t.(
`
`./H
`
`,/\
`DMT-HI+
`
`\o-"o-"r*rrr<o-"r*rramine cPG
`
`wherein the alkyl of alkylamine can be from 1 to 50 carbon atom$, inclusive, and
`
`isomeric forms thereof.
`
`
`
`Page 9 of 43
`
`
`
`CI-l
`
`Tho subject invention is useful in solid phase oligonucleotide qnthesis
`(both oligodeoxynbonucleotide and oligonucleotide) to chemically modrS the 3'
`terminus of a synthetic oligonucleotide with any chemical functional goup.
`Useful functional groups are primary amines, sulftrydryls, disulfides, and any other
`group tlpically used for conjugation of reporter molecules. Also, the subject
`invention can be used for attaching a label to a functional group introduced at
`the 3' terminus of a synthetic oligonucleotide. Labels include any reporter
`molecules such as biotin, haptens, fluorophores, proteins, enzymes, and
`antrbodies. Such modified and labeled oligonucleotide probes can be used in any
`application where the said probe hybridizes to completnentary sequences of a
`target polynucleotide. Further, the invention can be used for detecting low copy
`genes by using the pollmerase chain reaction (PCR) to amplifi the target gene
`segment and then emptoying the invention for detecting'the presence of specific
`polpucleotide in samples con$ning the same, biological samples, an4 for
`example, clinical samples such as serum and blood. Still further, the subject
`invention can be used for the diagnosis of infectious diseases and patlogens,
`detection of oncogenes, diagnosis of genetic disorders, and detection of point
`mutations or single base substitutions. The subjest invention has utility in the
`areas of anti-sense molecular biologl, electron microscopy, X-ray crystallography,
`and site-specific cleavage of DNA
`Thus, the subject invention concenu a novel multifunctional controlled
`pore glass reagent (MF-CP9o) (Frgure 1), useful to incorporate 3' terminal
`2a6 "
`primary aliphatic amines into synthetic oligonucleotides. MF-CPG.:: comprises a
`unique succinic acid linking arm which possesses both a masked ptir"rl'amine
`for label attachment and a dimethox;rtrityl protected hydroxyl for nucleotide chain
`elongation. Using IvfF-CF$& a simple and convenient technique has been
`devised to attach nonlradioactive labels to the 3' terminus of oligonucleotides.
`Bifunctional probes can then be constructed by nP labeling the 5' terminus with
`
`10
`
`15
`
`20
`
`25
`
`.*?
`/
`
`
`
`Page 10 of 43
`
`
`
`' 7'
`Cl-L
`T4 kinase and gamna 9P-AT?. Using such bifimctional oligonucleotide probes
`in conjunction with PqR'anpryftion, a person can detect a single base
`substitution in a target DNA segment. Exemplified herein is the detection of a
`single base substitution of the hqqan H-ras protooricogene employing either
`functionalig. The invention technique thus expands the potential applications for
`
`oligonucleotides as hybridization probes.
`
`10
`
`15
`
`T,Lf
`
`20
`
`25
`
`biotinylated H-ras
`
`tr'igure 3: Detection of poln1 mutations in the human H-ras gene using
`speciEc bifunctional oligonucleotide probes.
`
`h g t'L.),i(c"'DetaleA pruosure ot trre rnuention
`
`Materials and Methods
`Long chain alkylamine CPG was purchased from Pierce Ctremical Co.
`Biotin-)O(-NHS ester, PCR amplimers, and the Gene-tect Non-Isotopic Detection
`System were obtained from Oogtech Iaboratories, Inc. Teq pobrnerase was
`acquired from Perkin Elmer Cetus HPLC was performed on a Rainin Rabbit
`HPX Sptem using aquapore C8 reverse phase columns (Applied Biosystems,
`Inc.) for both preparative (100 x-10 mm) and analytical (30 q {.f mm) runs. A
`'-3).2)
`Biosearch Clclone DNA qnthesizer was used for oligonucleotide synthesis.
`The subject invention comprises a novel sn6 simple method to qmthesize
`3'$beled oligonucleotides. In conventional solid phase DNA synthesis, the 3'
`;f--r
`y'ermnal nucleotide is pre-attached to the CPG support from the 3' hydroryl
`through a succinimic acid $king arm, and the oligonucleotide is slmthesized from
`the y trydroryl by repetitive cycles of chemical reactions. In the subject
`*'
`'/
`
`,/
`
`{
`
`q
`
`
`
`Page 11 of 43
`
`
`
`I
`
`Cl-t
`
`invention, a 3' primary aliphatic amine replaces the pre-attached nucleoside with
`a{m to Wr u multitunctional CPG, Ivtr'-CPff*
`a unique multitunctional
`lnTr,g
`(Figure 1) which transfers a pnmary a4ne to the 3' terminus of a synthesized
`oligonucleotide without changing any chemistry or adding extra steps. MF-CPG-fi c
`possesses a uniquely engineered linking arm that complies with four important
`criteria. First, the linking arm is attached to the CPG through an ester
`functionality that is readily cleavcd wi& llaonium hydroxide treahent. Second,
`the linking arm contains a masked primary aliphatic aming which is acid stable
`
`and resistant"to all the reagents used in normal oligonucleotide synthesis. Third,
`in addition to being acid stable, the amine protecting group is readily removed
`with ammonium hydroxide treatment. Fourth, the h$g arm contains a
`dimetho:rytrityl protected primary hydroxyl group for oligonucleotide chain
`elongation. Hence, the method is fully adaptable to commercial DNA
`qnthesizers and is as e?sy as slnthesizing normal oligonucleotides.
`Since a reporter molecule no\il can be easily attached to the 3' terminus
`of any oligonucleotide, both the 5' and 3' termini can be used to label the
`oligonucleotide. Such bifunctional oligonucleotide probes are both sensitive and
`specific in detecting single base substitutions in target DNA when used in
`conjunction with PCR. The sensitivity and specificity are the same regardless of
`the detection system; autoradiography or colorimetric detection with a
`streptavidin-alkaline phosphatase conjugate. The convenienco of using MF-CPG{ ..:.
`to non-isotopically label an oligonucleotide at the 3' terminus with subsequent
`3? labeling at the 5' terminus makes this reagent an attractive alternative to
`current methods of functionalizing oligonucleotides. Thus, the invention
`technique expands the potential for applications smFloyrng functionalized
`oligonucleotides.
`The preparation of MF.CPG@.js outlined in Figure 1. N-Fmoc-O-DlvIlk':
`2-t't
`3-nmins-1,2-propanediol was first derirratized with succinic anhydride. The
`
`10
`
`15
`
`20
`
`25
`
`a(
`
`
`
`Page 12 of 43
`
`
`
`-)
`
`Cl-L
`
`caxbCI(yl gfoup of the suqcinylated derivative was convertgd to a p-nitrophenyl
`ester and directly reacted with long chain alkylamine CPG to give MF CPpj.
`After capping, the loading capacity of MF-CPG.f*,was determined to be 27.8
`pmolg.
`f -
`l\"r-.
`Two bifunctional oligonucleotide probes were coilttructed using MF-CPG:.
`as follows: First, two 3r amino-modified oligonucleotides'
`GGCGCCGGCGQTGTGG'GCAA-X (H-ras, wild tyPe) and
`GGCGCCGGCGATGTACCCaA-X (H-ras, codon 13 Asp).F = 3' prim:ry
`amine modi{cation], were qynthesized using MP-CPG. The coupling efEciency
`4
`of the first nucleodde, which is indicative of 3' primary amine incorporatio& was
`^797Vo in both cases. After standard cleavage and deprotection with ammonium
`fJ.L
`hydroxide, the qrude 3' amino-modified oligonucleotides were biotinylated with
`Biotin-)O(-NtIS ester. The long linking arm of Biotin-)O(-NHS ester, a 14 atom
`spaoer QOq consisting of trro e-aminocaproic acid moieties linked in series, was
`used to make the biotins m€re available fo: deJection, After size exclusion on
`Sephadex G-25 (Phamacia), the biotinylated oligonucleotides were purified by
`preparative HPLC on a C8 reverse phase column. Analytical HPLC
`chromatograms are shourn in Figpre 2. The presonce of biotin was confirmed by
`a p-methylamino-cinnamalde$e colorimetric test" Finally, the constnrction of
`the bifunctioaal probes was completed by eP labeling of the 5' ends with T4
`kinase and gamna 3?-AiI?.
`The applicability of these bifunctisnal oligonucleotide probes was assessed
`in detecting single base substitutions in the H-ras protooncogene. The probes
`
`used were specific either for the wild tlpe H-ras sequence * *SJ{GGT) ,/
`or for the transforming mutant sequence at codon 13 (GAT) tntti.tt snUiiitutes'
`aspartate for glycine. A 110-base pair segment which includes codonJ3 of *" ,.r/
`H-ras gene was amplified from genomic DNA using the polymerase lfdnt Ay
`autoradiography (Figure 3B), the codon 13 aspartate probe hybridized only with
`
`10
`
`15
`
`20
`
`25
`
`,fe
`
`
`
`Page 13 of 43
`
`
`
`10
`
`CI-l
`
`the amplified DNA carryin-g the H-ras codon 13 aspartate mutation and not with
`DNA from normal placentq a transformed mouse fibroblast cell line (NIH3T3)
`harboring a mutant human H-ras gene with a codon 12 valine substitution
`(GTT), or with placental DNA amplified in the region surround N-ras codons L2
`and 13. Hybridization with the wild gpe codon 13 H-ras probe (Figure 3A),
`howeyer, showed a signal only with amplified DNA from normal placenta and the
`NIH3T3 cell line whose murine H-ras gene can also be amplified using our
`current nmplimers. CrosB hybridization between the human and mouse wild type
`H-ras genes was unexpected but may indicate that the sequences probed are
`identical in the two species.
`
`When the same hybridizcd filters were incubated with streptavidin-alkaline
`phosphatase and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP), colorimetric
`
`signals were seen over the same slots exhibiting a radiographic signal (Figure 3C
`and 3D). Thus, when used in coljunction with PC& these bifunctional probes
`are both sensitive and specific in detecting single base pair mismatches in target
`DNA. Furthermore, anloligonucleotide probe from a single MF-CPq/e.^
`preparation can be either biotinylated or radiolabeled without compromising
`hybridization sensitivity.
`
`Following are examples which illustrate procedures, including the best
`mode, for practicing the invention. These examples should not be construed as
`limiting. All percentages are by weight and all solvent mixture proportions are
`by volume unless otherwise noted.
`
`To a solution of N-Fmoc-O-DMT-3-amino-1,2-propanediol (2.2 g, 3.5
`mmol) and 4-dimethylaminopyridine (200 mg, 0.9 mmst) in antrydrous pyridine
`(12 mt) was added succinic anlrydride (300 mg, 3 mmol). The reaction was
`
`10
`
`15
`
`20
`
`c L rlJsc
`
`tl.\
`
`
`
`Page 14 of 43
`
`
`
`Cl-l
`
`tt
`stirred at room temperature for 17 hours.; The consumption of starting material
`was followed by TLC rsing methanol-dicbloromethane (1:a9) as the mobile
`phase. Ttre mixture was diluted in ethyl acetate (100 ml), washed with 0.5 M
`sodium chloride (l6tOO ml) and sattuated sodium chloride (11 100 mI), and
`dried over anlrydroiJroair- sulfate. After concentrating W r"≤vaporation
`and drying under high vaorum (45"C), 1.74 g of a yellow solid was obqined.
`
`The yellow solid was dissolved in dry dioxane (10 ml) containing anlrydrous
`pyridine (0.5 ml) and p-nitrophenol (350 mg, 2.5 mmol).
`Dicyclohexylcarborliimide (1,0 g 4.8 mmol) *as added and the mixhrre was
`stirred at ampient temperature. After a few minuteq dicycloherylurea began to
`precipitate. The reaction was monitored by TI-C (methanol-dichloromethane,
`1:9) and after 3 hours, the dicycloherylurea was collected by filtration. Long
`chain alkylamine CPG (5.0 g) was suspended in the filtrate containing the p)
`nitophenyl ester derivative, triethylamine (1.0 ml) was added, and the mixture
`was shaken overnrght at room temperature. The derivatized support was
`copiously washed with dimethylformamide, methanol, and diethyl ester and dried
`in vacuo. Before capping the unreacted alkylamine groups, the toading capaclty
`of the lv[F-CPg:pyas assayed by determining the amount of dimethoartrityl
`cation released upon freatment with perchloric acid according to published
`procedures (9tigqnucteotiag qies r
`M.J. Gait (ed.),
`IRL Press, O:dord, 1984).
`Finally, capping of lvIF-CP$was achiwed by treatment with acetic
`anhydride-pyridine-DlvlAP (10:90:1. vlvlw) for one hour- The support was
`thoroughly washed witti methanol and diethyl ether and dried under high vacuum
`to give 4.95 g of MF-cPff* The capped t*-ctg: gave a negative ninhydrin
`test (Smirtr et al., supra).
`3'Amine-"ry{
`structural formula:
`
`G, prepared by the above process, has the following
`
`5
`
`10
`
`15
`
`za
`
`25
`
`)'>
`
`
`
`Page 15 of 43
`
`
`
`<-*:-
`
`'r{Jor
`
`5
`
`?F'+"
`
`8[-ul*.
`10 {'
`
`L5
`
`2A
`
`25
`
`I
`
`t2
`
`cL1
`
`Fmoc-NH{FI2
`\
`\ \
`./\
`
`,/\
`./\
`DMT-€H2
`
`ca
`
`-O+O-Ctt -Crt"-CO-altytamine CPG
`
`Two 3' amino-modified oligonucleotides,
`GGCGCCGGCGGTGTGGGCAA-X (H-ras, wild type) and
`GGCGCCGGCGATGTGGGCAA-X (H-ras, codon 13 Asp) f = 3' primary
`nmins modificationJ, were synthesized using MP-CPG on a Biosearch C,lclone
`I
`DNA qmthesizer. Standard columns were packed with Tgmol of lv{F-CP9l p0
`DNA spthesis was performed by suggested manufacturdr protocols without any
`
`program changes. The coupling efficiency of the first nucleotide was determined
`
`by measuring the deprotected dimethox5rtrityl cation concentration. Solid support
`cleavage and deprotection were accomplished with concentrated nmmonium
`
`hydroxide.
`
`Each srude amino-modified oligonucleotide was dissolved in 0.8 ml of 0.1
`M NaHCOy't',{aCO3 OH 9). Biotin-)O(-NHS ester in dimethylformamide (L00
`mg/ml, 0.25 mI) was added and the mixture as allowed to react for 16 hours at
`room temperature. The biotinylated probes were purified on Sephadex G-25
`columns ( LX 40 cm) and then by preparative HPLC. Analytical HPLC
`' 7r7
`chromatograms of the purified 3' biotinylated probes are shown in Figure 2.
`The presence of biotin was confirmed by a p-methylaminocinnamaldehyde
`colorimetric test.
`
`[:v
`
`
`
`Page 16 of 43
`
`
`
`Cr 'ilc (
`
`10
`
`& L,\e1sf
`
`?n
`
`25
`
`The,H-ras biotinylated probes were 32P 5', end labeled using a
`modification of the method descnted by Berent et al. (Berent' S'L'' M'
`Uanmouai, R.M. Torcz5nski,P.W- Brag& and dP. noUonJtSSSJ BioTechniques
`-tittofo"d
`in 30 pl of'
`ng of the oligonucleotide probe *ut"
`amiriJa water and heated to 65"C for 3 minutes. The oligomers were then
`taken up to 50pl of a reactionbuffer which contained 50 nIU Tris-Hcl (PH 7'5)'
`10 nl\d Mggfl pM DTT, 0.1 mlu spermidin e, t0 pl gamma 3?'ATP (specific
`$'-'-
`,t-7t
`activity 6000 g{ffiIq, ild LTn units of T4 kinase. This reaction mixhre was
`incubated at 3TCfor 30 rio.it"s follovred by the addition of another 1+?p units
`of kinase and further incubation for 30 minutes. The labeled probe was then
`isolated using a G-25 Sephadex cohlmn.
`//'
`I1".
`Erample 4 dFgll,Amplificatipn of, the H-ras I'rotooncogenes
`emprrcatioq of genoaic DNA by the pollmerase chain reaction (PCR)
`has been previously described (Liu et al., supF; Saiki et aL, supra). Two
`different sets of ampli$ing primen (amplimers) were used to ampliff specific ras
`oncogene segments of genomic DNA. ATGACGGAATATMGCTGGT (5' Hr;
`ras amplimer) and CTCTATAGTGGGGTCGTAfi (3', H-ras amplimer) were
`used to ampHry the region around codons 72 and 13 of the H-ras gene;
`ATGACTGAGTACAAACTGGT (5', N-ras amplimer) and
`CTCTATGGTGGGATCATATT (3', N-ras amplimer) were used to amplif the
`same codon region oJ the N-ras gene. t4;9 ot genomrc DNA ttt
`in
`"-_n-ryed
`a 100 #l volume containing 50 nl\d KCl, 10 ml\d Tris (pH S.3)' 1.5 ml\d MgCl,
`o.r e5"a;, 0.S mM all four dNTPs, and 2.5 units Taq pollmerase. The first.
`amplification cycle included denaturation at 95"C for 5 minutes, annealing at
`55.C for 2 minutes, and primer extension at 68FC for 2 minutes. The ls6nining
`35 cycles,were performed with 2 minute incubation periods at each temperature.
`
`/y
`
`
`
`Page 17 of 43
`
`
`
`14
`
`Cl-l
`
`The generation of target DNA wittr an H-r,as codon 13 Asp mutation was
`accomplished by the method described in Rg$[| tz et aL (Rochlita C.F., G.K
`?:515-519). In this reaction, the
`Scot! J.M. Dodso& and CC. Benz
`EilS$).DNA
`sequence of the 3' amplifying oligodrer has been noted above. The 5'
`amplimer, howg{errencompsses the 20 nucleotide sequence at codon 12 and 13
`./
`of H-ras gld contains a point mutation encoding .a glycine to aspartate change
`-/
`in coddfi 13 (GGCGCCGGCGATGTGGGCAA). DNA generated through PcR
`amplification was used as target DNA in oligonucleotide hybridization analysis.
`In this manqer, fts amplifie{ DNA incorporates the oligonucleotide with the
`codon 13 aspartate mutation.
`
`10
`
`C'L tiic
`
`15
`
`20
`
`25
`
`{
`
`Tetramgthvlammonium Chloride ffN,IAC)
`N*.{of the amplified samples were added to 80J{l of 0.4 N NaOH, and
`heated to 95"C for 2 minutes. The reaction mixtures were neutralized with 100
`71lot 2 M Tris-HCl (pH 7,4, and the solution slotted onto Amersham Hybond
`av
`nylon filter. The DNA was crosslinked onto the filter by IJV radiation under
`conditions suggested by the manufacturer.
`The slot blots were pre-hybridize-d for 2 horus at g7'Cwith 10:15 mls of
`5X SSPE, 5X Denhardtis ,0.SVoSDS, and L00 nI,I sodium pyr"ph"rf,ate (pH
`7.5). A labeled proU.ias then added to this solution to a final concentration
`of 5g 106 cpm/ml and the filters were hybridrzed at SffC for 4 to 72 hours.
`t,
`Following this incubati6n, the filters were washed once at room temperature with
`6X SSC for 20 minutes, and twice at 61oC in 3 M T\4AC, 50 mI,I Tris-HCl (pH
`8), 2 mM EDTA, and 0.17a SDS. The filters were tben washed once at room
`temperature with 6X SSC. Hybridization \pas detected both by autoradiography,
`and by colorimetric de-tection with a streptavidin-alkaline phosphatase conjugate
`(Ctontech's Gene-tect System) on the same slot blot.
`3
`
`" /s-
`
`
`
`Page 18 of 43
`
`
`
`L5
`
`cL1
`
`I-abelmtGts)
`-TE'i-
`,fl '3' non-isotopic oligonucleotide (NIO) labeling kits are complete kits
`dJsigned to conveniently label spthetic oligonucleotides at the 3' terminus with
`either biotin or fluorescein The labeling pr-ocess is divided into two procedures
`which are outlined in Sequence 1. First" an oligonucleotide is functionalized with
`a primary aliphatic amine at its 3' terminus using 3'Amine-ON CPG (Sequence
`2). 3' AminE-ON CPG is a uilique CPG that incorporates a primary nmine on
`the 3' terminus of an oligonucleotide. It is fully ssmpatlble with automated
`DNA syrthesizers. Secondly, the 3' amino-modified oligonucleotide is reacted
`with Biotin-)O(-NHS ester or FITC. All buffers and reagents are supplied for
`this labeling procedure. Biotin-)O(-NHS ester is a unique producf having an
`e,fira long linl+g arm Q!f) consisting of L4 atoms (Sequence 3).
`4^'/
`( t t ttL urt or ,o.poo"oJ
`3' Amine-ON CPG, four 16gtol columns (Clontech Catalog No.
`5?.?.G1; Oontech Laboratories, Inc., Palo Alto, CA).
`
`rD
`
`0.5 ml.
`4. N,N-Dimethylformamide, 1.0 ml.
`
`s) ':
`lle
`v
`
`/0,
`
`t I
`
`i
`
`f't tilc
`
`)
`
`10
`
`15
`
`20
`
`25
`
`
`
`Page 19 of 43
`
`
`
`)
`
`76
`
`cL-1
`
`DUTO
`
`\----l
`|
`I ono Synlheslror
`(NHFnoc
`I
`|
`,__
`Ho-orteo -oV-€At\
`tt..Vt-
`ot
`| ""t
`a.a*Hz
`+
`Ho- ol,n' -o1r\o*
`LC- llHS
`II aioUn -
`I?
`s Ho- otteo-lTiiill
`
`Sequence 1. Scheme for non-isotopic oligonucleotide
`labeling with C[.ONlECtfs MGI-abel Kits, using
`3' Amine-ON CPG
`
`, o
`oll
`our-oX \tArAr
`rrlNtrlll
`D
`emocnn/
`
`oAc
`'V-V\'2"\'l"zi're'
`HHolol'^"
`o
`
`oMe
`
`oMe
`
`Sequence 2. 3' Amine-ON CPG
`
`'l')
`//
`
`I {
`
`I
`
`Ii
`
`.l
`
`.r'1
`
`10
`
`{,*,,,
`
`iII
`
`,l\i 1s
`
`Y
`
`20
`
`25
`
`30
`
`
`
`Page 20 of 43
`
`
`
`1
`
`L7
`
`cL1
`
`n-J
`
`oA
`
`rl
`
`"--(_J
`
`ll
`
`rr
`vo
`
`Sequenrb 3. Biotin-)O(-NHS ester
`
`10
`
`15
`
`/'*"-*--*-
`
`T.
`
`oL
`20 /.a-
`
`/''{
`
`25
`
`30
`
`Jfl..
`
`f 't
`
`t
`
`, I ,l'
`'
`
`\, .":
`
`Mtstdl
`eL
`Modiffing the 3' terminus with a primar.v aliphatic amine
`L. ....$ttach a 3' Amine-ON to your automated DNA slnthesizer.
`"//\- I
`/ 2. Enter the oligoaucleotide sequence you wish to qmthesize. Make
`./r .
`sure you enter the 3' terminal base of your sequence as the 2nd
`base from ttre 3' end. Note that 3' Amine-ON CPG has a
`bifunction+-H$g arm'attached to it instead of the 3' terminal
`base. Ftenceltne 3' base is not on the CPG as with normal
`'.oligonucleotide qmthesis. This must be accounted for when you
`enter the sequence. Since automated qynthesizers assume that t.he
`3' base is attached to the CPG' a nonsense base must be entered
`at the 3' terminus when using 3' Amine-ON CPG.
`3.. kiitiate the synthesis using the Trityl-Off mode, i.e, remove the
`ti:L:-
`L-
`rL ^
`final DMT protecting group. If desired, the primary amine
`incorporation can be determined by measuring the deprotected
`rlimethoxlnrityl concentration of the first coupling rycle, qpically
`Y 2 >95vo.
`
`---ra
`
`/v
`
`
`
`Page 21 of 43
`
`
`
`Deprotection
`Ar''
`I'v
`
`4'
`
`0,:l"
`
`5.
`
`L8
`
`CJ-.t
`
`Cleave the 3' ,anihs-modified oligonucleotide from the CPG by
`treating it with l ml of ammonium hydroxide at room lsmperaturo
`for Zhogrs. It iS convenient to use lue"-f tip qyringes for this step.
`Be careful not to let the ammonia evaporate.
`
`Complete the deprotection by transfening the ammonium hydroxide
`solution to a 1.5 ml screw cap microcentifuge tube and heat at
`55"C for 6 holrs to overnigbt. Evaporate to drlmess by vacuum
`centrifirgation ol rotary evaporation (C;aution: ammonia gas builds
`up at 55oC; cool to 4oC before opening the screw cap
`microcentrifuge tube). The 3' amino-modified oligonucleotide is
`now ready for labeliqs. As an option, you may wish to quantitate
`the primary amine groups by a published procedure (Smith et al.
`
`10
`
`rs CL
`,f1.^
`ilL
`
`{t;L 6.
`
`6fr-
`{v tz. 7.
`zo r/*
`
`8.
`
`25
`
`dtn9+rrya)
`
`The following reaction is designed for a l pmol qmthesis. In a 1.5
`ml microcenuifuge tube, dissolve the total cnrde J' smins-podified
`oligonucleotide (from step 5) in 900 pl deionized water.
`Add 100 p of 10X labeling buffer.
`Biotin labeliry '(Clontech Cat. No. KL072-7)z Add 250;zl of a
`freshly prepared Biotin-)O(-NHS ester in N,N-dimetfrgfortamiae
`(DltF). Prepare irnmediately before use by dissolving 25 mg of
`Biotin-)C(-NHS ester in ?5041Dlvtr. Vortex immediately after
`additionA 0
`FTI1C hbeting (Clontech Cat. No. K1073-1): Same procedure as
`with biotin labeling except replace 25 mgBiotin-)O(-NHS ester with
`25 mg of FITC.
`
`Li
`
`
`
`Page 22 of 43
`
`
`
`ilo g.
`
`I
`
`,4f ,
`lv
`t
`
`5
`
`-^)
`
`CJ-l
`
`t9
`Incubate at roon termperature overnight.