Proc. Natd Acad. Sci. USA
`Vol. 78, No. 8, pp. 4936-4940, August 1981
`Biochemistry
`
`Cloning and analysis of strong promoters is made possible by the
`downstream placement of a RNA termination signal
`(promoter efficiency/RNA synthesis/RNA polymerase/gene expression)
`REINER GENTZ*, ANNETTE LANGNER*, ANNIE C. Y. CHANGt, STANLEY N. COHENt, AND
`HERMANN BUJARD*t
`*Molekulare Genetik der Universitat, 6900 Heidelberg, Federal Republic of Germany; and tDepartments of Genetics and Medicine, Stanford University Medical
`Center, Stanford, California 94305
`Contributed by Stanley N. Cohen, May 29, 1981
`
`Downstream placement of a strong transcrip-
`ABSTRACT
`tional termination signal has made possible the cloning of bacte-
`riophage T5 promoters known to exhibit high signal strength. The
`cloning system constructed contains two easily assayable indicator
`functions whose expression is controlled by the integration of pro-
`moters and terminators, respectively. By assessing transcription
`within the indicator regions, the efficiency of promoters as well
`as termination signals can be determined in vitro and in vivo.
`
`The efficiency of interaction between Escherichia coli RNA
`polymerase and transcriptional promoters of E. coli varies
`within a wide range when measured in vitro (1). For unregu-
`lated promoters, the rate ofcomplex formation in vitro reflects
`promoter strength in vivo (1, 2). However, despite the iden-
`tification of more than 80 different promoter sequences and
`extensive study of promoter-RNA polymerase interactions (for
`survey, see refs. 3-5), the contribution of specific structural
`features to the functional activity of such sequences is not
`understood.
`Promoters from various bacterial and viral sources have been
`cloned in E. coli, and their signal strength in vivo has been stud-
`ied by using expression from distal promoterless sequences en-
`coding (3-galactosidase ((-Gal) or other proteins (6, 7) as an in-
`dicator of promoter activity. Attempts to clone small DNA
`fragments carrying the strong promoters of bacteriophage T5,
`which in vitro far exceed other promoters in the rate ofcomplex
`formation with RNA polymerase and the rate of initiation of
`RNA synthesis (1, 2), have been unsuccessful; however, frag-
`ments of T5 DNA containing both a strong promoter and a
`strong termination signal have been cloned (8). Subsequently,
`electron microscope analysis has shown that transcriptional re-
`gions of several E. coli plasmids are organized in well-defined
`units where termination signals appear to balance transcription
`initiated at promoters ofdifferent strengths (9). Together, these
`findings suggested that the cloning of strong promoter signals
`from phage T5 or other sources might require the downstream
`placement of comparably strong termination signals.
`We report here the construction and analysis of bacterial
`plasmid vectors that enable the cloning of promoters of high
`signal strength; such cloning is made possible by the positioning
`ofa transcriptional termination signal downstream from the site
`ofinsertion ofsuch promoters. The constructed plasmids, which
`allow estimation ofthe strength ofpromoter signals in vitro and
`in vivo, contain indicator genes in positions that also permit
`selection for termination signals. Using these vectors, we have
`isolated a library of T5 promoter sequences suitable for bio-
`chemical and physical investigations of promoter function and
`
`The publication costs ofthis article were defrayed in part by page charge
`payment. This article must therefore be hereby marked "advertise-
`ment" in accordance with 18 U. S. C. §1734 solely to indicate this fact.
`
`also potentially useful for achieving high-level transcription of
`heterologous genes introduced distal to the promoter signals.
`
`MATERIALS AND METHODS
`Restriction endonucleases, E. coli DNA polymerase, and bac-
`teriophage T4 DNA ligase were purchased from several com-
`mercial sources, and reactions were carried out as suggested by
`the supplier. EcoRI synthetic linker and adapter sequences
`were obtained from Collaborative Research (Waltham, MA).
`Phagefd DNA (replicative form) and plasmid pAD16/30 con-
`taining a 28-base-pair (bp) HindIII/BamHI adapter sequence
`were gifts from H. Schaller. lac repressor was a gift from A.
`Riggs. Isolation of bacteriophage T5 DNA (2), plasmid DNA
`(10), E. coli RNA polymerase (2), and termination factor rho
`(11) have been described previously.
`The binding of RNA polymerase to promoters and subse-
`quent analysis of the complexes by nitrocellulose filter binding
`have been described (2). Identification and isolation of lac op-
`erator-containing DNA fragments by repressor binding utilized
`the procedure of Riggs et al (12). The conversion of protruding
`5' single-stranded DNA extensions to blunt ends and DNA lig-
`ation reactions have been described (13). Synthetic linker and
`adapter sequences were present in 3- to 10-fold excess relative
`to the various DNA fragments. Transformation ofE. coli strains
`C600r-m' (our laboratory collection), the M15 deletion-mutant
`DZ 291 (obtained from A. V. Fowler), and BMH71-18, an MiS
`derivative carrying the laCjq mutation (obtained from B. Muel-
`ler-Hill), was carried out as described (14).
`Selection oftransformants involved plating on LB plates con-
`taining chloramphenicol (Cm, 20 Ag/ml), ampicillin (Ap, 100
`gg/ml), or varying amounts of tetracycline (Tc; 2-70 tug/ml).
`Selection for presence of the lac operator or production of the
`a fragment of (3-Gal was carried out on plates containing the
`antibiotic plus 5-bromo-4-chloro-3-indolyl (3-O-galactoside at
`40 ug/ml (15). Induction of lac expression by isopropylthio-
`galactoside was as described (15). In vitro and in vivo RNA was
`prepared and analyzed as described previously (1) except that
`[a-32P]UTP and [32P]phosphate were used for labeling in vitro
`and in vivo, respectively. In vivo RNA was isolated from plas-
`mid-containing C600 cells after a 10-min labeling period.
`
`RESULTS
`Experimental Strategy. We have constructed a family of
`plasmids (Fig. 1) that carry two DNA segments that can be
`brought under the control of a single promoter and are sepa-
`rated by an endonuclease cleavage site suitable for the cloning
`
`Abbreviations: bp, base pair(s); Cm, chloramphenicol; Tc, tetracycline;
`3-galactosidase.
`Ap, ampicillin; (B-Gal,
`
`4936
`
`Mylan v. Genentech
`IPR2016-00710
`Genentech Exhibit 2060
`
`

`
`Biochemistry: Gentz et al.
`
`Proc. Natl. Acad. Sci. USA 78 (1981)
`
`4937
`
`Hincil
`
`Hincil
`
`/O
`
`-gal
`
`J
`
`t
`Hpail
`
`BamHI I aSa/l
`+ DNA Pol.
`Ligase
`
`(Hindil)
`
`ca
`
`HindIII
`
`pBU1O
`
`ter.fd
`
`Ligas
`
`-
`
`tet
`
`HindIII
`
`HpaII/DNA
`\
`dII
`
`Pol.
`
`HindIII
`
`EcoRI es
`
`1-
`
`. Ligase, bla(
`
`pBR322
`(EcoRI/DNA Pol./Hindill)
`
`Construction of plasmids for cloning terminators and promoters. A 780-bp DNA fragment carrying the E. coli lac regulatory region
`FIG. 1.
`(promoter/operator: P/O), an NH2-terminal portion of the (3-Gal structural gene ((-gal) sufficient for intracistronic complementation of the M15
`deletion, and a portion of the lacI-gene (I) was isolated from a HincdI digest of pACYC214 plasmid (unpublished data) DNA by repressor binding
`and subsequent adsorption to nitrocellulose (16). By using the Hpa II cleavage site within (-gal, the fragment was reduced in size and provided with
`BamHI and Sal I termini by various subclonings (pBU8, pBACH16). The resulting fragment (leftmost part of the figure) contains the intact control
`region of the lac operon and a portion of the (-gal structural gene encoding 66 NH2-terminal amino acids (a). Introduction of this fragment, by
`blunt-end ligation, into the HindIll site of pACYC184 (17) yielded pBU10, avector suitable for terminator cloning. The major terminator of the
`coliphage fd genome was isolated as a 338-bp Sau3A fragment (18), ligated to a BamHI/Hindl adaptor sequence, and introduced into pBU10 to
`yield pLBU1. Cleavage of the lac sequence in pBU10 byHpa II endonuclease destroyed the lac promoter and, upon cleavage withHindM, liberated
`a fragment containing the lac operator and a region coding for functional a fragment. Integrating this DNA sequence into pBR322 (19) led to pBU12a.
`Finally, replacement of the HindIl/Sal I portion of pBU12a by the HindM/Sal I fragment of pLBU1 containing the fd terminator resulted in
`pBLU3, a vector suitable for the cloning of efficient promoters at the EcoRI site. The regions encoding Cm, Ap, and Tc resistance are indicated as
`cat, bla, and tet, respectively.
`
`these showed that in all instances the fd terminator had been
`inserted in an orientation opposite to the direction of transcrip-
`tion within the fd phage genome (Fig. 2; ref. 18). Sequence
`analysis also revealed a translational stop codon in frame with
`the a protein less than 10 bp downstream from the HindIII
`cleavage site at the junction between the lac-derived segment
`and thefd-derived DNA fragment (Fig. 2); the construct would
`be expected to produce a 71-amino acid a fragment.
`For the cloning of exogenous promoters, the lac promoter
`in the lac tet construct had to be removed or destroyed in such
`
`of transcription termination signals. In the absence of an inter-
`vening terminator, the level of transcription of both segments
`is identical and reflects the efficiency ofthe upstream promoter;
`reduced transcription ofthe distal DNA segment upon insertion
`of a transcription terminator reflects termination efficiency.
`To assay the level of transcription, we chose DNA segments
`that contain genes encoding f-galactosidase (P-gal) activity and
`Tc resistance. Because the NH2-terminal polypeptide (a frag-
`ment) can restore p-Gal activity in lac M15 deletion mutants
`(20), we used just the portion of the lac operon that produces
`a functional a fragment.
`By using efficient termination signals, we expected to obtain
`the stable integration of DNA fragments containing strong pro-
`moters; these could be identified by the relatively high level
`ofTc resistance that resulted from transcriptional read-through
`past the terminator into the distal tet region.
`Construction of Plasmid Vectors. A vehicle for the selective
`insertion oftranscription terminators between the two indicator
`genes was obtained by fusing a 560-bp fragment carrying the
`lac promoter-operator region and part of the lacZ structural
`gene to the tet region ofpACYC184 (Fig. 1). The resulting plas-
`mid, pBU10, has the following properties (Table 1; Fig. 2): (i)
`it complements the M15 deletion of the lac operon; (ii) the Tc
`resistance it specifies is under control of the lac promoter, as
`shown in M151adq strains; (iii) the HindIII cleavage site be-
`tween the lac gene fragment and the tet gene is restored; (iv)
`the stop codon immediately following the HindIII site limits the
`length of the lacZ gene product to 68 amino acids.
`The HindIII cleavage site ofpBUlO was used for the insertion
`of various transcriptional terminators; only the results obtained
`with the major terminator of the bacteriophage fd genome,
`yielding the pLBU1 plasmid (Fig. 1), are described. Insertion
`of this terminator upstream from the tet gene resulted in a 90%
`reduction in the level ofTc resistance but no detectable change
`in the level of p-Gal activity in M15 deletion strains (Table 1).
`Seven independent plasmid isolates from such clones contained
`the expected 352-bp HindIl-generated DNA fragment carry-
`ing the fd terminator. Electrophoretic analysis of all seven
`BamHI-cleaved isolates and DNA sequence analysis of one of
`
`Table 1.
`
`Plasmid
`
`pBU10
`
`pBU12
`
`pLBU1
`
`pLBU3
`
`pGBU207
`
`pBR322
`
`(-Gal activity
`a-Compl.
`Op.-Ind
`+
`
`+
`
`+
`
`+
`
`+++
`
`+
`
`+
`
`+
`
`+
`
`-
`
`Properties specified by plasmid constructs
`Tc
`E. coli
`resistance,
`jig/ml
`strain
`C600
`20
`M15
`20
`M15iq
`<2
`+IPTG*
`20
`C600
`3
`M15
`3
`C600
`2
`M15
`2
`<1
`C600
`M15
`<1
`C600
`>70
`>70
`M15
`C600
`60
`M15
`60
`The properties of transformed cells were determined by replica plat-
`ing freshly grown cultures (logarithmic phase) at identical densities
`in microtiter dishes. Tc-containing plates were freshly prepared. In-
`cubation was for 14 hr at 37CC. Isogeneic strains before and after trans-
`formation with pBR322 served as controls. Presence of the lac operator
`(Op.-Ind.) was determined in a lac+ background. a-Protein synthesis
`(a-Compl.) was assessed in M15 deletion strains by evaluating the col-
`ony color on plates containing bromochloroindolyl galactoside.
`* Isopropyl thiogalactoside.
`
`

`
`4938
`
`Biochemistry: Gentz et al.
`
`Proc. Nad Acad. Sci. USA 78 (1981)
`
`l
`
`20
`
`40
`
`60
`
`80
`
`100
`
`5' GAATTCGGTCGCTTGTTCAGGGCAGGGTCGTTAAATAGCCGCTTATGTCTATTGCTGGTTTACCGCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGG
`
`120
`
`140
`
`160{
`
`180
`
`200
`
`4;> I--al
`-I44-0
`CACACAGGAAACAGCTATGACCAT ......... AAGCTTGGCCGGATCTAAAGT ......... GGATCCGGCCAAGCTTTAATGCGGTAGTTTATCACAGTTAA
`
`780
`
`800
`
`820
`
`840
`
`,C tet
`ATTGCTAACGCAGTCAGGCACCGTGTATGAAATC- 3'
`
`Nucleotide sequences connecting the various cloned regions of pLBU3. Most leftward is the sequence of unknown origin intervening
`FIG. 2.
`between the EcoRI site (position 1) and the -15 position of the lac promoter (163), followed by the sequence of the lac fragment (163-435) and the
`fd DNA (446-778); the last portion of sequence shows the transition between the fd DNA and the tet region (778-800). Stop codons in all three
`frames are underlined, and translation initiation sites of both the a fragment and the first tet protein are indicated. ----, EcoRI (1), HindHI (435,
`778), and BamHI (778) cleavage sequences; arrows, borders between the sequences of different origins.
`
`a way that a site for the subsequent insertion of promoters was
`retained. To do this, we used the Hpa II cleavage site at position
`-17 of lac (5); a 250-bp fragment was isolated from a Hpa II/
`HindIII double digest of pBU10 and introduced into plasmid
`pBR322 to generate an EcoRI endonuclease cleavage site. Col-
`onies that showed both a reduced level ofTc resistance and the
`presence of a lac operator sequence, which could be detected
`on the multicopy plasmid by its ability to bind the lac repressor
`and induce chromosomal ,3-Gal synthesis, were identified. En-
`donuclease analysis (HindIII/EcoRI double digest, data not
`shown) of plasmids recovered from several isolates yielded two
`types ofvectors; one ofthese (represented by pBU12) harbored
`the expected 253-bp lac fragment, whereas the other (repre-
`sented by pBU12a) yielded a 420-bp fragment.
`DNA sequence analysis (Fig. 2) showed that in pBU12a a 160-
`bp fragment of unknown origin had been inserted between the
`EcoRI site and position -15 of the lac promoter; fortuitously,
`the fragment was found to contain two to three stop codons in
`each ofthe possible translational reading frames (Fig. 2), making
`the fragment an efficient terminator of any translation origi-
`nating upstream from the translation initiation site for the a
`fragment. pBU12a was therefore used for our further experi-
`ments. Replacing the HindIII/ Sal I segment of pBU12a (Fig.
`1) with an identically generated fragment of pLBU1 carrying
`thefd terminator yielded pLBU3 (Fig. 1). Although this plasmid
`contained the tet region and a DNA sequence encoding the a
`fragment of lac, it conferred neither Tc resistance nor /3-Gal
`activity to an E. coli M15 strain (Table 1) and thus seemed to
`be a candidate for the intended T5 promoter cloning vehicle.
`Properties of Constructed Vectors. Expression of both the
`a-complementing peptide and the Tc resistance encoded by
`plasmid pBU10 is regulated by the lac promoter (Table 1);
`expression of the Lac phenotype and Tc resistance occur in
`strain C600 as a result of titration of the lac repressor by the
`operator located on the multicopy plasmid; such induction also
`results in expression of the tet gene carried by the plasmid, in-
`dicating lac promoter control of Tc resistance. The Lac phe-
`notype occurs in the M15 mutant, which has part of the lacZ
`gene deleted from the chromosome, by a complementation. In
`the M 15 lacjq host, which overproduces the lac repressor, both
`lac expression and Tc resistance are repressed. Control of tran-
`scription into both gene segments by the lac promoter is further
`shown by the inducibility of lac expression by isopropyl thio-
`galactoside in the M15 ladq strain, and the concurrent loss of
`expression as a consequence of destruction of the lac promoter
`in the pBU12 plasmid (Table 1).
`
`Interruption of the lac promoter sequence at a Hpa II site
`as described above abolishes the remaining transcription
`through the fd terminator into the Tc gene as well as a com-
`plementation; the residual Tc resistance encoded by pBU12a
`results from a partially restored promoter sequence at the EcoRI
`site, which is located within the -10 region ofthe lac promoter.
`This residual promoter activity is repressed by lac repressor
`[i.e., in the laCIq strain (unpublished data)].
`Cloning of Promoters ofColiphage T5. A population ofabout
`200 short fragments of T5 DNA was obtained by double diges-
`tion of the 120-kilobase phage genome with Hae III and Alu I
`endonucleases. These fragments were ligated with excess syn-
`thetic EcoRI linkers, and the resulting molecules were cleaved
`with EcoRI endonuclease and ligated into the EcoRI cleavage
`site of pLBU3. Transformation of E. coli C 600 and selection
`for both /3-Gal activity and high-level Tc resistance yielded 35
`colonies resistant to Tc concentrations between 8 and 70 pUg/
`ml. Plasmids were isolated from 13 clones resistant to 70 Ag/
`ml, which appeared from earlier experiments using multicopy
`plasmids to be the highest level detectable in E. coli K-12 (21).
`Digestion of the various isolates with EcoRI liberated between
`1 and 10 DNA fragments from each constructed plasmid. Com-
`plexing of such fragment mixtures with RNA polymerase, fol-
`lowed by filter binding analysis, identified between one and
`three fragments of each plasmid that interacted efficiently with
`the enzyme (Fig. 3); these fragments were isolated from poly-
`acrylamide gels and individually recloned in pLBU3. In each
`case, they gave rise to colonies resistant to Tc at 70 jig/ml.
`Plasmids isolated from such clones carried the expected DNA
`fragments, as shown by EcoRI cleavage and gel electrophoresis.
`The promoter library obtained in this way contains about 25
`different strong promoters of coliphage T5 (23).
`Characterization of the pGBU207. One of the above plas-
`mids (pGBU207, Fig. 4) that contained an EcoRI-generated
`fragment of only 212 bp was selected for further study; the ef-
`ficiency RNA polymerase binding to the 212-bp fragment was
`compared with binding to two fragments carrying the previously
`characterized T5 promoters P25 and P26 (25). The results (Fig.
`3) show that the putative promoter (P207) present on the
`pGBU207 plasmid exhibits binding similar to that ofP., and P26,
`which are among the most efficient E. coli RNA polymerase-
`binding sequences identified from any source (26).
`The site(s) ofin vitro transcription occurring on the pGBU207
`plasmid were mapped by analysis of RNA transcripts made on
`plasmid DNA fragments produced by cleavage with different
`restriction endonucleases (Fig. 4). Cutting of the plasmid with
`
`

`
`Proc. Natl. Acad. Sci. USA 78 (1981)
`
`4939
`
`bp
`
`500
`
`750 900
`
`1
`=2
`
`3 4 56
`
`7 8
`
`I
`
`-
`
`150
`
`a
`
`EcoRl
`
`X
`
`Hind Ill
`-
`
`-Lac
`a-gal
`0
`
`BamIll HindIll
`BamHfI
`aspBR322-
`-
`tet
`
`f-d
`ter
`
`EcoRI
`T5 -5
`P207
`-132-
`- 546
`740
`-________________ 890
`500
`NUMBER OF NUCLEOTIDES
`
`0
`
`1000
`
`Analysis of in vitro transcripts of pGBU207. (Upper) Elec-
`FIG. 4.
`trophoretic separation of transcripts obtained under various condi-
`tions (lane 1, molecular weight standard; lanes 2-4, template cleaved
`with EcoRI,HindIl, andBamHl, respectively). The transcripts of 130,
`540, and 900 nucleotides, and the 740-nucleotide RNA terminated by
`the phage fd signal are by far the most abundant products of the plas-
`mids transcription. Lanes 5-7 show transcription of BamHI-digested
`pGBU207 at 50 mM KCl (5), at 50 mM KCl with E. coli rho protein,
`and at 150 mM KCl with GTP replaced by ITP (24). As shown by the
`disappearance of the 740-nucleotide RNA species, low salt and ITP
`abolish the termination. At 50 mM KCl, however, addition of rho pro-
`tein restores termination to about 50% efficiency. Lane 8 shows tran-
`scripts of the covalently closed circular form of the plasmid at 150mM
`KCl. (Lower) Overview of the transcriptional unit. X, 160-bp fragment
`integrated between the EcoRI and the lac DNA; arrows, sizes of tran-
`scripts expected from templates cleaved with various restriction
`endonucleases.
`ment. By appropriately arranging their integration sites relative
`to two independent indicator functions (i.e., the a fragment of
`E. coli p-Gal and the tet region of pBR322), the interactions of
`promoters and terminators can be studied. Placement of stop
`codons between indicator genes uncouples their translation and
`allows use of their easily assayable products to estimate the rel-
`ative efficiency of transcription initiation and termination sig-
`nals. Because the adventitious 160-bp sequence (X in Fig. 4)
`preceding the coding region of the first indicator gene (the a
`peptide) contains stop codons in all three reading frames, any
`translation initiated within the cloned promoter-carrying up-
`stream fragment-is interrupted. This organization oftranslation
`signals not only permits reproducible synthesis of functional a
`and tet protein from translation start sites located within a po-
`lycistronic mRNA but most likely also maintains transcriptional
`polarity at a constant level.
`Bacterial clones that express the products ofthe two indicator
`genes are identified by assaying for different levels ofTc resis-
`tance or screening for lac gene expression, thus enabling the
`cloning of strong terminators as well as promoters. Among the
`highly active terminators found in this way was the major ter-
`minator ofbacteriophagefd, surprisingly integrated in a direc-
`tion opposite to its natural orientation. This signal showed about
`a 93% efficiency of termination in vivo and nearly 100% effi-
`ciency in vitro (Fig. 5), although a major component of the nat-
`ural termination signal [an oligo(dT) stretch downstream from
`the region of dyad symmetry of the terminator] is in a non-
`functional position when the terminator is integrated in the re-
`verse orientation. However, the reverse orientation yields mul-
`tiple stop codons between the lac-derived fragment and the
`termination signal (17), providing conditions for rho-dependent
`termination (27). Consequently, rho protein increases termi-
`nation frequency in vitro 25- to 50-fold (Fig. 4, lane 6). The fact
`
`Biochemistry: Gentz et al
`
`1.6 -
`
`0.5 -
`
`0.3
`
`:-
`
`P25
`- P26
`- P207
`
`AL_-t
`4b
`
`a
`
`b
`
`c
`
`d
`
`e
`
`a
`
`b
`
`c
`
`d
`
`e
`
`Interaction of cloned coliphage T5 DNA fragments with E.
`FIG. 3.
`coli RNA polymerase. (Left) Two examples from the library of T5 pro-
`moters. Lanes b and c are digests of pGBU34 and pGBU12 with EcoRI.
`In lanes c and e the fragments carrying promoters are identified (ar-
`row) after complexing of the EcoRI digest with limiting concentrations
`of RNA polymerase followed by nitrocellulose filterbinding. Such frag-
`ments were subsequently isolated and recloned. Lane a shows size
`standards (in kilobases). (Right) Nitrocellulose filter binding assay of
`a fragment mixture containing the strong T5 promoters P25 and P26
`[Hpa II digest of HindiI-cleaved T5 DNA (22)] together with the 212-
`bp fragment isolated from pGBU207. Lanes e, d, and c show that the
`extent of polymerase binding at limiting but increasing amounts of
`the enzyme is the same for all the fragments (fragment sizes 400, 310,
`and 212 bp, respectively). Lanes a and b show the control gel for end-
`labeled fragments used to prepare the mixture. Analysis of the filter
`binding assays was on 10% acrylamide gels.
`
`EcoRI endonuclease yielded primarily a single RNA species
`about 130 nucleotides long. The size of the transcript increased
`to 550 nucleotides when a HindIII digest ofpGBU207 was used
`as a template. BamHI-digested DNA yielded transcripts about
`740 and 900 nucleotides long. Correlation of transcript length
`with the distance of the DNA cleavage site from a fixed point
`indicates that, in all ofthese instances, in vitro transcription was
`being initiated at the same promoter and that it progressed to-
`ward the tet region of the plasmid (Fig. 4). These experiments
`also show the functioning of the termination signal introduced
`between the lac fragment and the tet gene; under the high-salt
`conditions used for this in vitro transcription experiment, about
`50% of the transcripts are terminated within thefd DNA frag-
`ment giving rise to the 740-nucleotide RNA, whereas read-
`through transcripts extend to the BamHI cleavage site located
`890 bp downstream from the promoter. The data in lanes 5-7
`of Fig. 4 show that low ionic strength and replacement of GTP
`by ITP abolishes termination at position 740; on the other hand,
`addition of termination factor rho increases the termination ef-
`ficiency at 50 mM KCl 20- to 50-fold.
`To quantitate the intensity of transcription initiated at the
`P207 promoter relative to transcription of other regions of the
`pGBU207 plasmid, transcripts of whole plasmid DNA were
`hybridized to endonuclease fragments of the plasmid (Fig. 5).
`In vivo and in vitro transcriptions from the P207 promoter were
`8 and 15 times, respectively, the transcription initiated at the
`bla promoter, which in turn was about 3 times more frequent
`than transcription ofthe tet region on the pBR322 (control) plas-
`mid. Transcription from P207 into the tet region was prevented
`by the cloned terminator with almost 100% efficiency in vitro
`and about 93% efficiency in vivo.
`
`DISCUSSION
`The plasmid constructs described here permit the analysis of
`different transcription signals within the same genetic environ-
`
`

`
`4940
`
`Biochemistry: Gentz et al.
`
`In vivo
`
`I
`
`740
`
`490
`
`620
`Size, bp
`
`FIG. 5. Comparison of relative amounts of RNA produced under
`the control of P207, Pbl., and Ptt in vitro and in vivo. 32P-Labeled RNA
`made in vitro with pGBU207 and pBR322 as templates and in vivo in
`plasmid carrying C600 cells were hybridized to Southern blots to which
`the following DNA fragments were fixed: 740-bp EcoRI/BamHI frag-
`ment of pGBU207. containing a 600-bp region under control of P207
`(Fig. 4); 620-bpHindIH/Sal I; and 490-bp EcoRI/HincII fragment (the
`last two both were from pBR322 and contained a part of the tet and bla
`regions, respectively). The densitometric tracings of the autoradio-
`grams show the relative amounts of 32P-labeled RNA hybridizing to
`the DNA fragments indicated, The filter-bound RNADNA hybrids
`were extensively treated with RNase prior to autoradiography. The
`pGBU207-derived RNA hybridizing to the 620-bp fragment is the read-
`through product of P207 into the tet region.
`
`that the clonedfd sequence terminates transcription efficiently
`despite the loss ofthe oligo(dT) stretch may be attributed to the
`newly acquired rho function which is not found for the termi-
`nation in the fd genome (22).
`Our plasmid constructs have permitted cloning of promoter-
`carrying fragments from the "early" region ofbacteriophage T5,
`by using selection for read-through past the termination signal
`into the tet region-which results in colonies that are resistant
`to high levels of Tc. All such clones contain plasmids carrying
`at least one T5 DNA segment that binds efficiently to RNA
`polymerase (Fig. 3; ref. 23). We have not been able to stabilize
`such promoter-carrying fragments in any vector system lacking
`an efficient downstream termination signal. In some casess plas-
`mids expressing high-level Tc resistance had a reduced copy
`number. This effect was not observed when a Cm resistance
`gene was used in place of Tc.
`The promoter-containing fragment cloned in pGBU207 binds
`RNA polymerase with high efficiency (Fig. 3) and initiates tran-
`scription toward the tet region, conferring a level of Tc resis-
`tance (70 ,ug/ml) that is 35 times higher than is seen when tran-
`scription is initiated from the lac promoter under comparable
`conditions. This finding is consistent with our analysis of tran-
`scripts produced in vitro from various regions ofpGBU207 plas.
`mid; the P207 promoter yields 15 times the RNA produced by
`the /3-lactamase promoter, which in turn, is about twice as ef-
`ficient as the fully induced lac wild-type promoter (unpublished
`data).
`The system described here allows the quantitative study in
`vivo of transcription initiation and termination signals having
`a wide range of efficiencies. Comparison of in vivo results with
`
`2.
`
`3.
`
`4.
`
`5.
`
`6.
`
`7.
`8.
`
`9.
`
`10.
`
`11.
`12.
`
`13.
`
`14.
`
`15.
`
`16.
`
`17.
`
`18.
`
`Proc. Natl. Acad. Sci. USA 78 (1981)
`signal strength determined in vitro and with the DNA sequence
`should contribute to a better understanding of the
`structure-function relationship of such signals.
`Finally, plasmids such as pGBU207 may be useful as cloning
`vehicles for achieving high levels oftranscription ofexogenously
`derived DNA fragments. Removal of the DNA sequence en-
`coding the a fragment enables positive selection for the inte-
`gration ofexogenously derived DNA fragments because expres-
`sion of Tc resistance by such constructs requires the coupling
`of the tet region to the T5 promoter.
`These studies have been supported by Grants Bu 338/7,10,12 from
`the Deutsche Forschungsgemeinschaft to H. B. and National Institutes
`ofHealth Grants AI 08619 and GM 27241 to S. N.C. and by a European
`Molecular Biology Organization Short-Term Fellowship to H.B.
`von Gabain, A. & Bujard, H-. (1979) Proc. NatltAcad. Sci. USA 76,
`1.
`189-193.
`von Gabain, A. & Bujard, H. (1977) Mol Gen. Genet. 157,
`301-311.
`Rosenberg, M. & Court, D. (1979) Annu. Rev. Genet. 13,
`319-353.
`Siebenlist, U., Simpson, R. B. & Gilbert, W. (1980) Cell 20,
`269-281.
`Reznikoff, W. S. & Abelson, J. N. (1978) in The Operon, eds.
`Muller, J. H. & Reznikoff, W. S. (Cold Spring Harbor Labora-
`tory, Cold Spring Harbor, NY), pp. 221-243.
`Casadaban, M. J. & Cohen, S. N. (1980) J. Mol Biol 138,
`179-i207.
`West, R. W., Jr. & Rodriguez, R. L. (1980) Gene 9, 175-193.
`Breunig, K. (1979) Dissertation (Universitat Heidelberg, Hei-
`delberg, Federal Republic of Germany).
`Stueber, D. & Bujard, H. (1981) Proc. Natl Acad. Sci. USA 78,
`167-171.
`Clewell, D. B. & Helinski, D. R. (1969) Proc. Natt Acad. Sci.
`USA 62, 1159-1166.
`Knopf, K. W. & Bujard, H. (1975) Eur. J. Biochem. 53, 371-385.
`Riggs, A. D., Bourgeois, S., Newby, R. F. & Cohn, M. (1968)].
`Mol Biol 34, 365 -368.
`Backman, K., Ptashne, M. & Gilbert, W. (1976) Proc. Nati. Acad.
`Sci. USA 73, 4174-4178.
`Cohen, S. N., Chang, A. C. Y. & Hsu, L. (1972) Proc. Natl Acad.
`Sci. USA 69, 2110-2114.
`Miller, J. H. (1972) in Experiments in Molecular Genetics, ed.
`Miller, S. H. (Cold Spring Harbor Laboratory, Cold Spring Har-
`bor, NY), pp. 47-55.
`Landy, A., Olchowski, E., Ross, W. & Reiness, G. (1974) Mol
`Gen. Genet. 133, 273-281.
`Chang, A. C. Y. & Cohen, S. N. (1978) J. Bacteriol 134,
`1141-1156.
`Beck, E., Sommer, R., Auerswald, E. A., Kurz, C., Zink, B.,
`Osterburg, G., Schaller, H., Sugimoto, K., Sugisaki, H., Oka-
`moto, T. & Takanani, M. (1978) Nucleic Acids Res. 5, 4495-4503.
`Bolivar, F., Rodriguez, R. L., Betlach, M. C., Heyneker, H. L.,
`Boyer, H. W., Crossa, J. H. & Falkow, S. (1977) Gene 2, 95-113.
`Ullman, A. & Perrin, D. (1970) in The Lactose Operon, eds.
`Beckwith, J. R. & Zipser, D. (Cold Spring Harbor Laboratory,
`Cold Spring Harbor, NY), pp. 143-172.
`Cabello, F., Timmis, K. & Cohen, S. N. (1976) Nature (London)
`259, 285-290.
`Konings, R. N. & Schoenmakers, G. G. (1978) in The Single-
`Stranded DNA Phages, eds. Denhardt, D. T., Dressler, D. &
`Ray, D. S. (Cold Spring Harbor Laboratory, Cold Spring Harbor,
`NY), pp. 507-530.
`Gentz, R. (1981) Diplomarbeit (Universitaet Heidelberg, Hei-
`delberg, Federal Republic of Germany).
`Neff, N. F. & Chamberlin, M. J. (1978) J. Biol Chem. 253,
`2435-2460.
`Stueber, D., Delius, H. & Bujard, H. (1978) Mol Gen. Genet.
`166, 141-149.
`Niemann, A. (1981) Diplomarbeit (Universitat Heidelberg, Hei-
`delberg, Federal Republic of Germany).
`Adhya, S. & Gottesman, M. (1978) Annu. Rev. Biochem. 47,
`967-996.
`
`19.
`
`20.
`
`21.
`
`22.
`
`23.
`
`24.
`
`25.
`
`26.
`
`27.