`Zamore et a].
`
`(10) Patent N0.:
`(45) Date of Patent:
`
`US 7,691,995 B2
`Apr. 6, 2010
`
`US007691995B2
`
`(54)
`
`(75)
`
`IN VIVO PRODUCTION OF SMALL
`INTERFERING RNAS THAT MEDIATE GENE
`SILENCING
`
`Inventors: Phillip D. Zamore, Northborough, MA
`(US); Juanita McLachlan, Worcester,
`MA (US); Gyorgy Hutvagner,
`Worcester, MA (US); Alla Grishok,
`Newton, MA (US); Craig C. Mello,
`Shrewsbury, MA (US)
`
`(73)
`
`Assignee: University of Massachusetts, Boston,
`MA (US)
`
`Notice:
`
`Subject to any disclaimer, the term of this
`patent is extended or adjusted under 35
`U.S.C. 154(b) by 891 days.
`
`(21)
`
`(22)
`
`(65)
`
`(60)
`
`(51)
`
`(52)
`(58)
`
`(56)
`
`App1.No.: 10/195,034
`
`Filed:
`
`Jul. 12, 2002
`
`Prior Publication Data
`
`US 2006/0009402 A1
`
`Jan. 12, 2006
`
`Related U.S. Application Data
`
`Provisional application No. 60/305,185, ?led on Jul.
`12, 2001.
`
`Int. Cl.
`(2006.01)
`C07H 21/04
`U.S. Cl. ................................................... .. 536/245
`
`Field of Classi?cation Search ............... .. 536/24.5
`See application ?le for complete search history.
`
`References Cited
`
`U.S. PATENT DOCUMENTS
`
`5,631,146
`A
`5,770,580
`A
`5,972,704
`A
`6,022,863
`A
`6,057,153 A *
`6,506,099 B1
`6,506,559 B1
`6,531,647 B1
`6,573,099 B2
`2001/0008771 A1
`2002/0086356 A1
`2002/0132257 A1
`2002/0137210 A1
`2002/0160393 A1
`2003/0108923 A1
`2003/0190654 A1
`2004/0038921 A1
`2004/0053411 A1*
`
`5/1997
`6/1998
`10/1999
`2/2000
`5/2000
`1/2003
`1/2003
`3/2003
`6/2003
`7/2001
`7/2002
`9/2002
`9/2002
`10/2002
`6/2003
`10/2003
`2/2004
`3/2004
`
`SZostak et al. ........... .. 435/91.1
`Ledley et al.
`Draper et al.
`Peyrnan ..................... .. 514/44
`George et al. .......... .. 435/320.1
`Bartlett
`Fire et al.
`Baulcombe et al.
`Graham
`Seibel et al. .............. .. 435/455
`Tuschl et al.
`Giordano et al.
`Churikov
`Syrnonds et al.
`Tuschl et al.
`Heidenreich et al.
`Kreutzer et al.
`Cullen et al. .............. .. 435/455
`
`FOREIGN PATENT DOCUMENTS
`
`8/2000
`2359180 A1
`9/2003
`0983 370 B1
`1/1994
`WO 94/01550
`WO 9401550 A1 * 1/1994
`WO 99/32619
`7/1999
`WO 99/49029
`9/1999
`WO 99/53050
`10/1999
`
`W0 9953050 A1 * 10/1999
`W0
`WO 99/61631
`12/1999
`W0
`WO 00/01846
`1/2000
`W0
`WO 00/44895
`8/2000
`W0
`WO 00/63364
`10/2000
`W0
`WO 01/75164 A2 10/2001
`W0
`WO01/92513 A1
`12/2001
`WO
`WO 02/44321 A2
`6/2002
`W0
`W0 02/055692 A2
`7/2002
`W0
`W0 02/059300 A2
`8/2002
`W0
`W0 03/033700 A1
`4/2003
`W0
`W0 03/062394 A2
`7/2003
`W0
`W0 03/064621
`8/2003
`W0
`W0 03/093441
`* 11/2003
`W0
`W0 WO 2004/022748
`3/2004
`
`OTHER PUBLICATIONS
`
`Ui-Tei et al. FEBS Letters 2000, vol. 479, pp. 79-82.*
`Zamore et al. Cell 2000, vol. 101, pp. 25-33.*
`Zhang et al. Cell 2004, vol. 118, pp. 57-68.*
`Ambion, Inc., “SilencerTM Express (Cat #1680, 1681, 1682) Instruc
`tion Manual ”, pp. 1-42.
`Ambion, “RNA Interference and Gene SilencingiHistory and Over
`view” (May 20, 2002), pp. 1-10.
`Brummelkamp, T.R., et al., “A System for Stable Expression of Short
`Interfering RNAs in Mammalian Cells”, Scienceexpress, 296:550-3
`(2002).
`Castanotto, D., et al., “Functional siRNA expression from transfected
`PCR products”, RNA, 8:11, 1454-60 (2002).
`Candy, A.A., et al., “Fragile X-related protein and VIG associate with
`the RNA interference machinery” Genes & Development, 16: 2491
`6, (2002).
`Chiu, Y.L., et al., “RNAI in Human Cells: Basic Structural and
`Functional Features of Small Interfering RNA”, Molecular Cell.,
`101549-61 (2002).
`Devroe, E., et al., “Retrovirus-delivered siRNA”, BMC Biotechnol
`ogy, vol. 2, p. 15 (2002).
`Elbashir, S.M., “Functional anatomy of siRNAs for mediating ef?
`cient RNAi in Drosophila melanogaster embryo lysate”, The EMBO
`Journal, 20(23):6877-6888 (2001).
`Elbashir, S.M., et al., “Duplexes of 21-nucleotide RNAs mediate
`RNA interference in cultured mammalian cells”, Nature, 411:494-8
`(2001).
`Elbashir, S.M., et al, “RNA interference is mediated by 21- and
`22-nucleotide RNAs”, Genes & Development, 15:188-200(2001).
`(Continued)
`Primary ExamineriBrian Whiteman
`(74) Attorney, Agent, or FirmiLahive & Cock?eld, LLP;
`Debra J. Milasincic, Esq.; James H. Velema, Esq.
`
`(57)
`
`ABSTRACT
`
`The invention provides engineered RNA precursors that
`when expressed in a cell are processed by the cell to produce
`targeted small interfering RNAs (siRNAs) that selectively
`silence targeted genes (by cleaving speci?c mRNAs) using
`the cell’s own RNA interference (RNAi) pathway. By intro
`ducing nucleic acid molecules that encode these engineered
`RNA precursors into cells in vivo with appropriate regulatory
`sequences, expression of the engineered RNA precursors can
`be selectively controlled both temporally and spatially, i.e., at
`particular times and/ or in particular tissues, organs, or cells.
`
`68 Claims, 6 Drawing Sheets
`
`Benitec - Exhibit 1003 - page 1
`
`
`
`US 7,691,995 B2
`Page 2
`
`OTHER PUBLICATIONS
`
`Grishok, A., et al., “Target dependent accumulation of small RNAs
`during RNAi in C. elegans”, 2001 International Worm Meeting
`Abstract #307.
`Hammond, S.M., et al., “Post-Transcriptional Gene Silencing By
`Double-Stranded RN ”, Nature Reviews Genetics, 2:110-119
`(2001).
`Hutvagner, G., et al., “A Cellular Function for the RNA-Interference
`Enzyme Dicer in the Maturation of the let-7 Small Temporal RN ”,
`Science, 293:834-838 (2001).
`Hutvanger, G., et al., “Intersection of the RNA interference and small
`temporal RNA pathways,” Meeting Abstract for Cold Spring Harbor
`Symposium on Eukaryotic mRNA processing, Aug. 22, 2001.
`Hutvanger, G., et al., “In vitro processing of pre-let-7 RNA” 2001
`RNA Society Meeting Abstracts, May 31, 2001.
`Hutvagner, G., et al. “RNAi: nature abhors a double-strand”, Current
`Opinion in Genetics & Development, 12:225-232 (2002).
`Ketting, R.F., et al. Dicer functions in RNA interference and in
`synthesis of small RNA involved in developmental timing in C.
`eleges Genes & Development, 15: 2654-26591(2001).
`Levin, J .Z., et al. “Methods of double-stranded RNA-mediated gene
`inactivation in Arabidopsis and their use to de?ne an essential gene in
`methionine biosynthesis”, Plant Molecular Biology, 44:759-775
`(2000).
`McCaffrey, et al., “RNA interference in adult mice”, Nature,
`418:38-9 (2002).
`McManus, M.T., et al., “Gene Silencing in Mammals by small inter
`fering RNAs”, Nature Reviews, Oct. 2002, vol. 3, pp. 737-747.
`McManus, M.T., et al., “Gene silencing using micro-RNA designed
`hairpins”, 8:842-50 (2002).
`Moss, E.G., “MicroRNAs: Hidden in the Genome”, Current Biology
`., 12:(R138-R140 (2002).
`Moss, E.G., et al., “Non-coding RNAs: Lightning strikes twice”,
`Curr. Biol., 10(12):R436-9 (2000).
`Paddison, et al., “Stable suppression of gene expression by RNAi in
`mammalian cells”, PNAS 99:1443-1448 (2002).
`Paddison, PJ., et al., “Short hairpin RNAs (shRNAs) induce
`sequence-speci?c silencing in mammalian cells”, Genes Dev.,
`16:948-958 (2002).
`Plasterk, R.H.A., “RNA Silencing: The Genome’s Immune System”,
`Science 296:1263i5 (2002).
`Panomics, “TranSilent siRNA Vector Mix”., Cat.# SRxxxx_., 3-19
`(2003).
`Parrish, S., et al., “Functional anatomy of a dsRNA trigger. differen
`tial requirement for the two trigger strands in RNA interference”,
`Molecular Cell, Nov. 2000, vol. 6, pp. 1077-1087.
`Paul, C.P., et al., “Effective expression of small interfering RNA in
`human cells”, Nat. Biotech, 29:505-3 (2002).
`Pasquinelli, A.E., “Conservation of the sequence and temporal
`expression of let- 7heterochronic regulatory RNA”, Nature, 408 : 86-9
`(2000).
`Pasquinelli, A.E. “MicroRNAs: deviants no longer”, Trends in
`Genetics ., 18(4):171-173 (2002).
`Pasquinelli, A.E., et al. “Control of Developmental Timing By
`MicroRNAs and their Targets”, Annu. Rev. Cell Dev. Biol., 18:495
`513 (2002).
`Reinhart, B.J., et al., “The 21-nucleotide let-7 RNA regulates devel
`opmental timing in Caenorhabditis elegans”, Nature 403:901-906
`(2000).
`Riddihough, G., “The Other RNA World”., Science ., 296: 1259
`(2002).
`SchwarZ, D.S., et al., “Why do miRNAs live in the miRNP?”., Genes
`& Development ., 16:1025-1031 (2002).
`Slack, F.J., et al., “The lin-41 RBCC Gene Acts in the C. Elegans
`Heterochronic Pathway between the let-7 Regulatory RNA and the
`LIN-29 Transcription Factor”, Mol. Cell. 5(4):659-69 (2000).
`Smith, N.A., et al., “Total silencing by intron-spliced hairpin RNAs”,
`Nature 407:319-20 (2000).
`StorZ, G., “An Expanding Universe of Noncoding RNAs”, Science
`196:1260-62 (2002).
`Sui, G., et al., “A DNA vector-based RNAi technology to suppress
`gene expression in mammalian cells”, PNAS., 99: 8, 5515-20 (2002).
`
`Ui-Tei, K., et al., “Sensitive assay of RNA interference in Drosophila
`and Chinese hamster cultured cells using ?re?y luciferase gene as
`target”. FEBS Letters 479:79-82 (2000).
`Waterhouse, P., M., et al., “Virus resistance and gene silencing in
`plants can be induced by simultaneous expression of sense and
`antisense RNA,” Proc. Natl. Acad. Sci. USA, Nov. 1998, vol. 95, pp.
`13959-13964.
`Yang, D., et a1 ., “Evidence that processed small dsRNAs may mediate
`sequence-speci?c mRNA degradation during RNAi in Drosophila
`embryos”. Curr. Biol., Oct. 5, 2000, vol. 10, No. 19, pp. 1191-1200
`Yang, S., et al. “Speci?c Double-Stranded RNA Interference in
`Undifferentiated Mouse Embryonic Stem Cells”, Molecular and
`Cellular Biology:21(22): 7807-7816 (2001).
`Yu, J -Y, et al., RNA interference by expression of short-interfering
`RNAs and hairpin RNAs in mammalian cells, PNAS vol. 99, No.
`9:6047-52 (2002).
`Zamore, P.D., et al., “Ancient Pathways programmed by small
`RNAs”, Science, 196:1265-9 (2002).
`Notice of Opposition to European Patent No. EP 1 144 623 and
`Opposition papers ?led in EPO by Atugen AG on May 28, 2003.
`Notice of Opposition to European Patent No. EP 1 144 623 and
`Opposition papers ?led in EPO by Janssen Pharmaceutica N.V. on
`May 28, 2003.
`Papers ?led in EPO in opposition to European Patent No. EP 1 144
`623 by Aventis Pharma Deutschland GmbH on May 28, 2003.
`Papers ?led in EPO in opposition to European Patent No. EP 1 144
`623 by Dr. Martin Grund on May 28, 2003.
`Papers ?led in EPO in opposition to European Patent No. EP 1 144
`623 by siRNA Therapeutics Inc. on May 19, 2003.
`Elbashir, Sayda M., et a1 ., “Duplexes in 21-nucleotide RNAs mediate
`RNA interference in cultured mammalian cells,” Nature, vol.
`411:494-498 (2001).
`Hutvagner, Gyorgy, et al., “A Cellular Function for the RNA-Inter
`ference Enzyme Dicer in the Maturation of the let-7 Small Temporal
`RNA,” Science, vol. 293:834-838 (2001).
`Moss, Eric G., “Non-coding RNAs: Lightning strikes twice,” Current
`Biology, vol. 10:R436- R439 (2000).
`Pasquinelli, Amy E., et al., “Conservation of the sequence and tem
`poral expression of let- 7heterochronic regulatory RNA,” Nature, vol.
`408:86-89 (2000).
`Smith, Neil A., et al., “Gene expression: Total silencing by intron
`spliced hairpin RNAs,” Nature, vol. 407:319-320 (2000).
`European Search Report Application No. /Patent No. EP02746979.
`0-2101 PCT/US02/22010 dated Oct. 11, 2005.
`European Search Report Application No. /Patent No. EP02746979.
`0-2101 PCT/US02/22010 dated Dec. 28, 2005.
`Berns, Katrien et al, “A Large-scale RNAi Screen in Human Cells
`Identi?es New Components of the p53 Pathway,” Nature, vol. 428,
`431-437 (2004).
`Boden, Daniel et al, “Enhanced Gene Silencing of HIV-1 Speci?c
`siRNA Using MicroRNA Designed Hairpins,” Nucleic Acids
`Research, vol. 32(3): 1 154-1 158 (2004).
`Brummelkamp, Thijn R. et al, “Loss of the Cylindromatosis Tumour
`Suppressor Inhibits Apoptosis by Activating NF-KB,” Nature, vol.
`424, 797-801 (2003).
`Brummelkamp, Thijn R. et al, “Stable Suppression of Tumorigenic
`ity by Virus-mediated RNA Interference,” Cancer Cell, vol. 2, 243
`247 (2002).
`Chang, Kenneth et al, “Lessons from Nature: microRNA-based
`shRNA Libraries,” Nature Methods, vol. 3(9):707-714 2006.
`Chen, Chang-Zheng et al, “Micro RNAs Modulate Hematopoietic
`Lineage Differentiation,” Science, vol. 303, 83-86 (2004).
`Cleary, Michele A. et al, “Pproduction of Complex Nucleic Acid
`Libraries Using Highly Parallel In Situ Oligonucleotide Synthesis,”
`Nature Methods, vol. 1(3):241-248 (2004).
`Dickens, Ross A. et al, “Probing Tumor Phenotypes Using Stable and
`Regulated Synthetic microRNA Precursors,” Nature Genetics, vol.
`27(11):1289-1295 (2005).
`Fewell, Gwen D. et al, “Vector-based RNAi Approaches for Stable,
`Inducible and Genome-wide screens,” Drug Discovery Today, vol.
`11(21/22):975-982 (2006).
`He, Lin et al, “MicroRNAs: Small RNas With A Big Role in Gene
`Regulation,” Nature, vol. 5, 522-531 (2004).
`
`Benitec - Exhibit 1003 - page 2
`
`
`
`US 7,691,995 B2
`Page 3
`
`Kawasaki, Hiroaki et al, “Short Hairpin Type of dsRNAs that are
`Controlled by tRNAVAL Promoter Signi?cantly Induce RNAi-medi
`ated Gene Silencing in the Cytoplasm of Human Cells,” Nucleic
`Acids Research, vol. 31(2):700-707 (2003).
`Lee, Nan Sook et al, “Expression of Small Interfering RNAs targeted
`against HIV-1 rev Transcripts in Human Cells,” Nature Biotechnol
`ogy, vol. 19, 500-505 (2002).
`McManus, Michael T. et al, “Gene Silencing Using Micro-RNA
`Designed Hairpins,” RNA, vol. 8, 842-850 (2002).
`Miyagishi, Makoto et al, “U6 Promoter-Driven siRNAs with four
`uridine 3 ’ Overhangs Ef?ciently Suppress Targeted Gene Expression
`in Mammalian Cells,” Nature Biotechnology, vol. 19, 497-500
`(2002).
`Paddison, Patrick J. et al, “Cloning of Short Hairpin RNAs for Gene
`Knockdown in Mammalian Cells,” Nature Methods, vol. 1(2):163
`167 (2004).
`Paddison, Patrick J. et al, “A Resource for Large-scale RNA-inter
`ference-based Screens in Mammals,” Nature, vol. 428, 427-431
`(2004).
`Paddison, Patrick J. et al, “Short Hairpin Activated Gene Silencing in
`Mammalian Cells,” Methods in Molecular Biology, Ed. Jonatha M.
`Gott, Humana Press, Totowa, New Jersey, 85-100 (2004).
`Paul, Cynthia P. et al, “Effective Expression of Small Interfering
`RNA in Human Cells,” Nature Biotechnology, vol. 20, 505-508
`(2002).
`
`Silva, Jose M. et al, “Second-generation shRNA Libraries Covering
`the Mouse and Human Genomes,” Nature Genetics, vol.
`37(1 1): 1281-1288 (2005).
`Siolas, Despina et al, “Synthetic shRNAs as potent RNAi Triggers,”
`Nature Biotechnology, vol. 23(2):227-231 (2005) .
`Stegmeier, Frank et al, “A Lentiviral microRNA-based System for
`Single-Copy Polymerase II-regulated RNA Interference in Mamma
`lian Cells,” PNAS, vol. 102(37): 13212-13217 (2005).
`Van de Wetering, Marc, et al, “Speci?c Inhibition of Gene Expression
`Using a Stably Integrated, Inducible Small-interfering-RNA Vector,”
`European Molecular Biology Organization, vol. 4(6):609-615
`(2003).
`Westbrook, Thomas F. et al, “A Genetic Screen for Candidate Tumor
`Supressors Identi?es REST,” Cell, vol. 121, 837-848 (2005).
`Zeng, Yan et al, “Both Natural and Designed Micro RNAs Can Inhibit
`the Expression of Cognate mRnas When Expressed in Human Cells,”
`Molecular Cell, vol. 9, 1327-1333 (2002).
`Zeng, Yan et al, “Sequence Requirements for Micro RNA Processing
`and Function in Human Cells,” RNA, vol. 9, 112-123 (2003).
`Zheng, Lianxing et al, “An Approach to Genomewide Screens of
`Expressed Small Interfering RNAs in Mammalian Cells,” PNAS, vol.
`101(1): 135-140 (2004).
`
`* cited by examiner
`
`Benitec - Exhibit 1003 - page 3
`
`
`
`US. Patent
`
`Apr. 6, 2010
`
`Sheet 1 of6
`
`US 7,691,995 B2
`
`FIG. 1
`
`stHNA pathway
`.._.ll
`developmentally
`regulated transcription
`
`pa Way
`
`experimentally
`introduced dsFlNA
`
`stRNA
`
`siRNA
`
`Benitec - Exhibit 1003 - page 4
`
`
`
`US. Patent
`
`Apr. 6, 2010
`
`Sheet 2 of6
`
`US 7,691,995 B2
`
`FIG. 2A
`
`G A U
`U
`5 ’ —GGCAAAUGAGGUAGUAGGUUGUAUAGUA U AU A
`'
`C
`
`3 ' —UCGUUUCUUUQE'AUCGUGUAACAUAUCAU ACUACA
`l
`/ \
`IL
`J
`stem \ loop
`unpaired
`nucleotide
`
`bulge
`
`(SEQ ID NOzl)
`
`FIG. 213
`
`G A U
`5 ' —GGCAAACGUACGCGGAAUACUUCGAUU A U AU A
`C
`3 ' -UCGUUUGCAUGCGCCUUAUGAAGCUAA U ACUACA
`
`(SEQ H) 110:2)
`
`FIG. 2C
`
`G A U
`5 ' -GGCAAAUGCUUGAAGCAGCUCUGGAGUA U AU A
`C
`3 ' -UCGUUUACGAACUUCGUCGAGACCUCAU ACUACA
`
`(SEQ ID NO:3)
`
`Benitec - Exhibit 1003 - page 5
`
`
`
`US. Patent
`
`Apr. 6, 2010
`
`Sheet 3 of6
`
`US 7,691,995 B2
`
`FIG. 2D
`
`5’—GGCAAAUGCUUGAAGCAGCUCUGGAGUAIJl??aj
`3’—UCGUUUACGAACUUCGUCGAGACCUCAU2%;H?fj
`
`G A
`
`(SEQ ID NO:4)
`
`FIG. 2E
`
`5'—GGCAAAUGCUUGAAGCAGCUCUGGAGUAGG
`3’—UCGUUUACGAACUUCGUCGAGACCUCAUGG
`
`(SEQ ID N0:5)
`
`Benitec - Exhibit 1003 - page 6
`
`
`
`U S. Patent
`
`Apr. 6, 2010
`
`Sheet 4 of6
`
`US 7,691,995 B2
`
`FIG.
`
`3
`
`buffer siRNA ESP
`030303h0urs
`
`5
`
`C u d m 0. e w V a b c
`,._,
`
`Benitec - Exhibit 1003 - page 7
`
`
`
`US. Patent
`
`Apr. 6, 2010
`
`Sheet 5 of6
`
`US 7,691,995 B2
`
`as .UHh
`
`Benitec - Exhibit 1003 - page 8
`
`
`
`Benitec - Exhibit 1003 - page 9
`
`
`
`US 7,691,995 B2
`
`1
`IN VIVO PRODUCTION OF SMALL
`INTERFERING RNAS THAT MEDIATE GENE
`SILENCING
`
`This application claims priority from US. Provisional
`PatentApplication Ser. No. 60/305,185, ?led on Jul. 12,2001,
`Which is incorporated herein by reference in its entirety.
`
`STATEMENT AS TO FEDERALLY SPONSORED
`RESEARCH
`
`This invention Was made With Government support
`GM62862-01 awarded by the National Institutes of Health.
`The Government has certain rights in the invention.
`
`TECHNICAL FIELD
`
`This invention relates to ribonucleic acid interference
`(RNAi), and more particularly to RNAi in vivo.
`
`BACKGROUND
`
`20
`
`2
`messenger RNA (mRNA) of a target gene; (ii) a second stem
`portion comprising a sequence of at least 18 nucleotides that
`is suf?ciently complementary to the ?rst stem portion to
`hybridiZe With the ?rst stem portion to form a duplex stem
`(e.g., a stem that can be processed by the enZyme Dicer); and
`(iii) a loop portion that connects the tWo stem portions. In
`another aspect, the invention features the engineered RNA
`itself. The RNA precursor targets a portion of the mRNA of
`the target gene, disrupts translation of the mRNA by cleaving
`the mRNA, and thereby prevents expression of the protein to
`be inhibited. The target genes can be, for example, human
`genes, e.g., mutant human genes, e.g., having a point muta
`tion, or they can be viral or other genes.
`In these molecules and precursors, the ?rst stem portion
`can be fully complementary (i.e., completely complemen
`tary) to the mRNA sequence. In other embodiments, the stem
`portion can be complementary, i.e., the sequence can be sub
`stantially complementary (e.g., there can be no more than one
`or tWo mismatches over a stretch of 20 nucleotides). Simi
`larly, the second stem portion can fully or substantially
`complementary to the ?rst stem portion. The ?rst stem por
`tion can be located at a 5' or 3' end of the RNA precursor.
`In these precursors, the loop portion can include at least 4,
`7, or 1 1, or more nucleotides, and the sequence of the mRNA
`is located from 100 to 300 nucleotides 3' of the start of
`translation of the mRNA. The sequence of the mRNA can be
`located in a 5' untranslated region (UTR) or a 3' UTR of the
`mRNA. The ?rst and second stem portions can each include
`about 18 to about 30 nucleotides, or about 22 to about 28
`nucleotides. The ?rst and second stem portions can each have
`the same number of nucleotides, or one of the ?rst and second
`stem portions can have 1 to 4 more nucleotides than the other
`stem portion. These overhanging nucleotides can all be
`uracils.
`In these nucleic acid molecules, the regulatory sequence
`can be a Pol III or Pol II promoter, and can be constitutive or
`inducible. In speci?c embodiments, the engineered RNA pre
`cursor can have the sequence set forth in SEQ ID NO: 1, 2, 3,
`4, 5, 8, or 9, and the nucleic acid molecule can have the
`sequence set forth in SEQ ID NO:10, 11, 17, 18, 20, or 21, or
`a complement thereof.
`In other embodiments, the invention also features vectors,
`e.g., plasmids or viral (e.g., retroviral) vectors, that include
`the neW nucleic acid molecules.
`In another aspect, the invention includes host cells, e.g.,
`mammalian cells, that contain the neW nucleic acid mol
`ecules. The invention also includes transgenes that include
`the neW nucleic acid molecules.
`In another aspect of the invention, the invention features
`transgenic, non-human animals, one or more of Whose cells
`include a trans gene containing one or more of the neW nucleic
`acid molecules, Wherein the transgene is expressed in one or
`more cells of the transgenic animal resulting in the animal
`exhibiting ribonucleic acid interference (RNAi) of the target
`gene by the engineered RNA precursor. For example, the
`transgene can be expressed selectively in one or more cardiac
`cells, lymphocytes, liver cells, vascular endothelial cells, or
`spleen cells. In these animals, the regulatory sequence can be
`constitutive or inducible, or the regulatory sequence can be
`tissue speci?c. In some embodiments, the regulatory
`sequence can a Pol III or Pol II promoter, and can be a an
`exogenous sequence. These transgenic animals can be non
`human primates or rodents, such as mice or rats, or other
`animals (e.g., othermammals, such as goats or coWs; orbirds)
`described herein.
`The invention also includes cells derived from the neW
`transgenic animals. For example, these cells can be a lym
`
`25
`
`30
`
`RNAi is the sequence-speci?c, post-transcriptional silenc
`ing of a gene’s expression by double-stranded RNA. RNAi is
`mediated by 21 to 25 nucleotide, double-stranded RNA mol
`ecules referred to as small interfering RNAs (siRNAs) that are
`derived by enZymatic cleavage of long, double-stranded RNA
`in cells. siRNAs can also be synthesized chemically or enZy
`matically outside of cells and then delivered to cells (e.g., by
`transfection) (see, e.g., Fire et al., 1998, “Potent and speci?c
`genetic interference by double-stranded RNA in Caenorhab
`ditis elegans,” Nature, 391:806-11; Tuschl et al., 1999, “Tar
`geted mRNA degradation by double-stranded RNA in vitro,”
`Genes Dev., 13:3191-7; Zamore et al., 2000, “RNAi: double
`stranded RNA directs the ATP-dependent cleavage of mRNA
`35
`at 21 to 23 nucleotide intervals,” Cell, 101 125-33.; Elbashir et
`al., 2001, “Duplexes of 21 -nucleotide RNAs mediate RNA
`interference in mammalian cell culture,” Nature, 41 1:494
`498; and Elbashir et al., 2001 , “RNA interference is mediated
`by 21- and 22-nucleotide RNAs,” Genes Dev., 15:188-200.
`Double-stranded siRNAs mediate gene silencing by target
`ing for disruption or cleavage messenger RNAs (mRNAs)
`that contain the sequence of one strand of the siRNA. siRNAs
`introduced into mammalian cells by transfection mediate
`sequence-speci?c gene silencing, Whereas long, double
`stranded RNA induces sequence non-speci?c responses.
`
`40
`
`45
`
`SUMMARY
`
`The invention is based on the discovery of neW arti?cial,
`engineered RNA precursors, that When expressed in a cell,
`e.g., in vivo, are processed by the cell to produce targeted
`siRNAs that selectively silence target genes (by targeting
`speci?c mRNAs for cleavage) using the cell’s oWn RNAi
`pathWay. By introducing nucleic acid molecules that encode
`these engineered RNA precursors into cells in vivo With
`appropriate regulatory sequences (e.g., a transgene in a vector
`such as a plasmid), expression of the engineered RNA pre
`cursors can be selectively controlled both temporally and
`spatially, i.e., at particular times and/or in particular tissues,
`organs, or cells.
`In general, the invention features an isolated nucleic acid
`molecule including a regulatory sequence operably linked to
`a nucleic acid sequence that encodes an engineered ribo
`nucleic acid (RNA) precursor, Wherein the precursor
`includes: (i) a ?rst stem portion comprising a sequence of at
`least 18 nucleotides that is complementary to a sequence of a
`
`50
`
`55
`
`60
`
`65
`
`Benitec - Exhibit 1003 - page 10
`
`
`
`US 7,691 ,995 B2
`
`3
`phocyte, a hematopoietic cell, a liver cell, a cardiac cell, a
`vascular endothelial cell, or a spleen cell.
`In another aspect, the invention includes methods of induc
`ing ribonucleic acid interference (RNAi) of a target gene in a
`cell, e.g., in an animal or in culture. The neW methods include
`obtaining a transgenic animal comprising a transgene includ
`ing a nucleic acid molecule encoding an engineered RNA
`precursor and an inducible promoter; and inducing the cell to
`express the precursor to form a small interfering ribonucleic
`acid (siRNA) Within the cell, thereby inducing RNAi of the
`target gene in the animal.
`Alternatively, the methods include obtaining a host cell;
`culturing the cell; and enabling the cell to express the RNA
`precursor to form a small interfering ribonucleic acid
`(siRNA) Within the cell, thereby inducing RNAi of the target
`gene in the cell.
`A “transgene” is any nucleic acid molecule, Which is
`inserted by arti?ce into a cell, andbecomes part of the genome
`of the organism that develops from the cell. Such a transgene
`may include a gene that is partly or entirely heterologous (i.e.,
`foreign) to the transgenic organism, or may represent a gene
`homologous to an endogenous gene of the organism. The
`term “transgene” also means a nucleic acid molecule that
`includes one or more selected nucleic acid sequences, e.g.,
`DNAs, that encode one or more engineered RNA precursors,
`to be expressed in a transgenic organism, e.g., animal, Which
`is partly or entirely heterologous, i.e., foreign, to the trans
`genic animal, or homologous to an endogenous gene of the
`transgenic animal, but Which is designed to be inserted into
`the animal’s genome at a location Which differs from that of
`the natural gene. A trans gene includes one or more promoters
`and any other DNA, such as introns, necessary for expression
`of the selected nucleic acid sequence, all operably linked to
`the selected sequence, and may include an enhancer
`sequence.
`A “transformed cell” is a cell into Which (or into an ances
`tor of Which) has been introduced, by means of recombinant
`DNA techniques, a nucleic acid molecule or transgene encod
`ing an engineered RNA precursor.
`As used herein, the term “operably linked” means that a
`selected nucleic acid sequence, e.g., encoding an engineered
`RNA precursor, is in proximity With a promoter, e. g., a tissue
`speci?c promoter, to alloW the promoter to regulate expres
`sion of the selected nucleic acid sequence. In addition, the
`promoter is located upstream of the selected nucleic acid
`sequence in terms of the direction of transcription and trans
`lation.
`By “promoter” is meant a nucleic acid sequence that is
`suf?cient to direct transcription. A tissue-speci?c promoter
`affects expression of the selected nucleic acid sequence in
`speci?c cells, e.g., hematopoietic cells, or cells of a speci?c
`tissue Within an animal, e.g., cardiac, muscle, or vascular
`endothelium. The term also covers so-called “leaky” promot
`ers, Which regulate expression of a selected nucleic acid
`sequence primarily in one tissue, but cause expression in
`other tissues as Well. Such promoters also may include addi
`tional DNA sequences that are necessary for expression, such
`as introns and enhancer sequences.
`By “transgenic” is meant any cell that includes a nucleic
`acid, e.g., DNA sequence, that is inserted by arti?ce into a cell
`and becomes part of the genome of an organism that develops
`from that cell. A “transgenic animal” means an animal that
`includes a transgene that is inserted into an embryonal cell
`and becomes a part of the genome of the animal Which devel
`ops from that cell, or an offspring of such an animal. In the
`transgenic animals described herein, the transgene causes
`speci?c tissue cells to express an engineered RNA precursor.
`
`50
`
`55
`
`60
`
`65
`
`20
`
`25
`
`30
`
`35
`
`40
`
`45
`
`4
`Any animal that can be produced by transgenic technology is
`included in the invention, although mammals are preferred.
`Preferred mammals include non-human primates, sheep,
`goats, horses, cattle, pigs, rabbits, and rodents such as guinea
`pigs, hamsters, rats, gerbils, and, preferably, mice.
`An “isolated nucleic acid molecule or sequence” is a
`nucleic acid molecule or sequence that is not immediately
`contiguous With both of the coding sequences With Which it is
`immediately contiguous (one on the 5' end and one on the 3'
`end) in the naturally occurring genome of the organism from
`Which it is derived. The term therefore includes, for example,
`a recombinant DNA or RNA that is incorporated into a vector;
`into an autonomously replicating plasmid or virus; or into the
`genomic DNA of a prokaryote or eukaryote, or Which exists
`as a separate molecule (e.g., a cDNA or a genomic DNA
`fragment produced by PCR or restriction endonuclease treat
`ment) independent of other sequences. It also includes a
`recombinant DNA that is part of a hybrid gene encoding an
`additional polypeptide sequence.
`A “target gene” is a gene Whose expression is to be selec
`tively inhibited or “silenced.” This silencing is achieved by
`cleaving the mRNA of the target gene by an siRNA that is
`created from an engineered RNA precursor by a cell’s RNAi
`system. One portion or segment of a duplex stem of the RNA
`precursor is an anti-sense strand that is complementary, e. g.,
`fully complementary, to a section of about 18 to about 40 or
`more nucleotides of the mRNA of the target gene.
`The term “engineered,” as in an engineered RNA precur
`sor, or an engineered nucleic acid molecule, indicates that the
`precursor or molecule is not found in nature, in that all or a
`portion of the nucleic acid sequence of the precursor or mol
`ecule is created or selected by man. Once created or selected,
`the sequence can be replicated, translated, transcribed, or
`otherWise processed by mechanisms Within a cell. Thus, an
`RNA precursor produced Within a cell from a transgene that
`includes an engineered nucleic acid molecule is an engi
`neered RNA precursor.
`Unless otherWise de?ned, all technical and scienti?c terms
`used herein have the same meaning as commonly understood
`by one of ordinary skill in the art to Which this invention
`belongs. Although methods and materials similar or equiva
`lent to those described herein can be used in the practice or
`testing of the present invention, suitable methods and mate
`rials are described beloW. All publications, patent applica
`tions, patents, and other references mentioned herein are
`incorporated by reference in their entirety. In case of con?ict,
`the present speci?cation, including de?nitions, Will control.
`In addition, the materials, methods, and examples are illus
`trative only and not intended to be limiting.
`The invention provides several advantages. For example,
`the invention improves on and overcomes a signi?cant de?
`ciency in the prior art. Prior methods for inducing RNAi in
`mammalian cells using siRNAs Were restricted to cell cul
`tures. The neW methods extend RNAi to Whole animals, e. g.,
`mammals, and thus alloW RNAi to be targeted to speci?c cell
`types, organs, or tissues, and/or to speci?c developmental
`stages.
`In addition, this technology simpli?es and loWers the cost
`of siRNA construction, because DNA molecules are rela
`tively inexpensive to make. Thus, large populations of plas
`mids or other vectors can be prepared, each containing a
`nucleic acid molecule that encodes an engineered RNA pre
`cursor that targets a particular gene, can be easily prepared,
`e.g., in an array format. In addition, the neW nucleic acid
`molecules can be introduced into a variety of cells, Which can
`be cultured in vitro using knoWn techniques. Furthermore, the
`neW methods enable the long-term, e.g., permanent, reduc
`
`Benitec - Exhibit 1003 - page 11
`
`
`
`US 7,691,995 B2
`
`5
`tion of targeted gene expression in cell lines, because siRNAs
`are transient, but a transgenic hairpin provides a long-lasting
`supply of siRNAs.
`The details of one or more embodiments of the invention
`are set forth in the accompanying draWings and the descrip
`tion beloW. Other features, objects, and advantages of the
`invention Will be apparent from the description and draWings,
`and from the claims.
`
`BRIEF DESCRIPTION OF THE DRAWINGS
`
`FIG. 1 is a schematic diagram of the dual nature of the
`stRNA and siRNA pathWays.
`FIG. 2A is a schematic representation of a Wild-type,
`stRNA precursor (SEQ ID NO:1).
`FIGS. 2B to 2E are schematic representations of synthetic,
`engineered RNA precursors (SEQ ID NOS:2, 3, 4, and 5).
`FIG. 3 is an autoradiograph shoWing the results of an assay
`for determining Whether an engineered RNA precursor can
`promote cleavage of the target mRNA in vitro in a standard
`RNAi reaction.
`FIGS. 4A to 4C are schematic representations of synthetic
`luciferase siRNA (4A; SEQ ID NOS:6 and 7), and 5' and 3'
`synthetic, engineered RNA precursors (4B; SEQ ID NO:8;
`and 4C; SEQ ID NO:9).
`FIG. 4D is a schematic representation of a chimeric target
`mRNA f