(12) INTERNATIONALAPPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT)
`
`(19) World Intellectual Property Organization
`International Bureau
`
`6 May 2010 (06.05.2010) (10) International Publication Number
`
`(43) International Publication Date
`
`WO 2010/050801 Al
`
`
`(51)
`
`(21)
`
`International Patent Classification:
`C12N 15/11 (2006.01)
`A61K 31/7105 (2006.01)
`
`International Application Number:
`PCT/NL2009/050006
`
`(74)
`
`(22)
`
`International Filing Date:
`
`13 January 2009 (13.01 .2009)
`
`(81)
`
`VAN OMMEN, Garrit-Jan Boudewijn [NL/NL]; West—
`erstraat 73, NL—101 5 LW Amsterdam (NL).
`
`Oc—
`Agent: KETELAARS, Maarten; Nederlandsch
`trooibureau, J.W. Frisolaan 13, NL—25 17 J S The Hague
`(NL).
`
`Designated States (unless otherwise indicated, for every
`kind 9‘ national protection available): AE, AG, AL, AM,
`AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ,
`CA, CH, CN, CO, CR, CU, CZ, DE, DK, DM, DO, DZ,
`EC, BE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN,
`HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, KR,
`KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME,
`MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO,
`NZ, OM, PG, PH, PL, PT, RO, RS, RU, SC, SD, SE, SG,
`SK, SL, SM, ST, SV, SY, TJ, TM, TN, TR, TT, TZ, UA,
`UG, US, UZ, VC, VN, ZA, ZM, ZW.
`
`Designated States (unless otherwise indicated, for every
`kind (f regional protection available): ARIPO (BW, GH,
`GM, KE, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, ZM,
`ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ,
`TM), European (AT, BE, BG, CH, CY, CZ, DE, DK, EE,
`ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV,
`MC, MK, MT, NL, NO, PL, PT, RO, SE, SI, SK, TR),
`OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, ML,
`MR, NE, SN, TD, TG).
`
`(84)
`
`Published:
`
`with international search report (Art. 21(3))
`
`with sequence listing part cf description (Rule 5.2(a))
`
`(25)
`
`(26)
`
`(30)
`
`(71)
`
`(72)
`(75)
`
`Filing Language:
`
`Publication Language:
`
`Priority Data:
`PCT/NL2008/050673
`27 October 2008 (27.10.2008)
`
`English
`
`English
`
`NL
`
`Applicants (for all designated States except US): PROS-
`ENSA TECHNOLOGIES
`B.V.
`[NITNL]; Wasse—
`naarseweg 72, NL72333 AL Leiden (NL). PROSENSA
`B.V. [NITNL]; Wassenaarseweg 72, NL—2333 AL Leiden
`(NL). PROSENSA HOLDING BV [NITNL]; Wassc—
`naarseweg
`72,
`NL—2333
`AL
`Leiden
`(NL).
`ACADEMISCH ZIEKENHUIS
`LEIDEN [NL/NL];A1—
`binusdreef 2, NL—2333 ZA Leiden (NL).
`
`Inventors; and
`Inventors/Applicants (for US only): DE KIMPE, Jose-
`phus
`Johannes
`[NL/NL]; Pieter Bernagiestraat
`27,
`NL—3532 DA Utrecht
`(NL). PLATENBURG, Gerard
`Johannes [NL/NLJ; Wijngaardenlaan 56, NL—2252 XR
`Voorschoten (NL). VAN DEUTEKOM, Judith Christi-u
`na Theodora [NL/NL]; Abcclstraat
`13, NL—3329 AA
`Dordrecht
`(NL).
`AARTSMA—RUS,
`Annemieke
`[NL/NL]; Navona 42, NL—2134 BE Hoofddorp (NL).
`
`(54) Title: METHODS AND MEANS FOR EFFICIENT SKIPPING OF EXON 45 IN DUCHENNE MUSCULAR DYSTRO-
`PHY PREAMRNA
`
`invention relates to a method for inducing or promoting skipping of exon 45 of DMD prermRNA in a
`(57) Abstract: The.
`Duchenne Muscular Dystrophy patient, preferably in an isolated (muscle) cell, the method comprising providing said cell with an
`antisense molecule that binds to a continuous stretch of at least 21 nucleotides within said exon. The invention further relates to
`such antisense molecule used in said method.
`
`
`
`
`
`W02010/050801A1||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
`
`

`

`WO 2010/050801
`
`' 1 '
`
`PCT/NL2009/050006
`
`Methods and means for efficient skipping of exon 45 in Duchenne
`
`Muscular Dystrophy pre—mRNA
`
`Field
`
`The invention relates to the field of genetics, more specifically human
`
`genetics. The invention in particular relates to the modulation of splicing
`
`of the human Duchenne Muscular Dystrophy pre—mRNA.
`
`Background of the invention
`
`Myopathies are disorders that result in functional impairment of muscles.
`
`Muscular dystrophy (MD) refers to genetic diseases that are characterized
`
`by progressive weakness and degeneration of skeletal muscles. Duchenne
`
`muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are
`
`the most common childhood forms of muscular dystrophy. They are
`
`recessive disorders and because the gene responsible for DMD and BMD
`
`resides on the X-chromosome, mutations mainly affect males with an
`
`incidence of about 1 in 3500 boys.
`
`DMD and BMD are caused by genetic defects in the DMD gene encoding
`
`dystrophin, a muscle protein that
`
`is required for interactions between the
`
`cytoskeleton and the extracellular matrix to maintain muscle fiber
`
`stability during contraction. DMD is a severe, lethal neuromuscular
`
`disorder resulting in a dependency on wheelchair support before the age of
`
`12 and DMD patients often die before the age of thirty due to respiratory —
`
`or heart failure. In contrast, BMD patients often remain ambulatory until
`
`later in life, and have near normal life expectancies. DMD mutations in
`
`the DMD gene are mainly characterized by frame shifting insertions or
`
`deletions or nonsense point mutations, resulting in the absence of
`
`10
`
`15
`
`20
`
`25
`
`functional dystrophin. BMD mutations in general keep the reading frame
`
`30
`
`intact, allowing synthesis of a partly functional dystrophin.
`
`During the last decade, specific modification of splicing in order to restore
`
`the disrupted reading frame of the DMD transcript has emerged as a
`
`

`

`WO 2010/050801
`
`' 2 '
`
`PCT/NL2009/050006
`
`promising therapy for Duchenne muscular dystrophy (DMD) (van Ommen,
`
`van Deutekom, Aartsma—Rus, Curr Opin MoI Ther. 2008;i6(2):i40—9,
`
`Yokota, Duddy, Partidge, Acta Myol. 2007;26(3):i 79- 84, van Deutekom et
`
`al., N Engl J Med. 2007;357(26):2677—86).
`
`Using antisense oligonucleotides (AONs) interfering with splicing signals
`
`the skipping of specific exons can be induced in the DMD pre—mRNA, thus
`
`restoring the open reading frame and converting the severe DMD into a
`
`milder BMD phenotype (van Deutekom et al. Hum Mol Genet. 2001; 10:
`
`1547-54; Aartsma—Rus et al., Hum Mol Genet 2003; 12(8):907-14.). In vivo
`
`proof—of—concept was first obtained in the mdx mouse model, which is
`
`dystrophin— deficient due to a nonsense mutation in exon 23.
`
`Intramuscular
`
`and intravenous injections of AONs targeting the mutated
`
`exon 23 restored dystrophin expression for at least three months (Lu et al.
`
`Nat Med. 2003; 8: 1009—14; Lu et al., Proc Natl Acad Sci U S A.
`
`2005;i02(l):i98—203). This was accompanied by restoration of dystrophin—
`
`associated proteins at the fiber membrane as well as functional
`
`improvement of the treated muscle. In ViVO skipping of human exons has
`
`also been achieved in the hDMD mouse model, which contains a complete
`
`copy of the human DMD gene integrated in chromosome 5 of the mouse
`
`(Bremmer—Bout et al. Molecular Therapy. 2004; 10: 232-40; 't Hoen et al. J
`
`Biol Chem. 2008; 283: 5899-907).
`
`As the majority of DMD patients have deletions that cluster in hotspot
`
`regions, the skipping of a small number of exons is applicable to relatively
`
`large numbers of patients. The actual applicability of exon skipping can be
`
`determined for deletions, duplications and point mutations reported in
`
`DMD mutation databases
`
`such as the Leiden DMD mutation database
`
`available at www.dmd.nl. Therapeutic skipping of exon 45 of the DMD
`
`pre—mRNA would restore the open reading frame of DMD patients having
`
`deletions including but not limited to exons 12—44, 18—44, 44, 46, 46—47,
`
`46—48, 46—49, 46—5], 46—53, 46—55, 46—59, 46-60 of the DMD pre—mRNA,
`
`10
`
`15
`
`2O
`
`25
`
`30
`
`

`

`WO 2010/050801
`
`' 3 '
`
`PCT/NL2009/050006
`
`occurring in a total of 16 % of all DMD patients with a deletion (Aartsma—
`
`Rus and van Deutekom, 2007, Antisense Elements (Genetics) Research
`
`Focus, 2007 Nova Science Publishers, Inc). Furthermore,
`
`for some DMD
`
`patients the simultaneous skipping of one of more exons in addition to
`
`exon 45, such as exons 51 or 53 is required to restore the correct reading
`
`frame. None—limiting examples include patients with a deletion of exons
`
`46-50 requiring the co—skipping of exons 45 and 51, or with a deletion of
`
`exons 46—52 requiring the co—skipping of exons 45 and 53.
`
`10
`
`Recently, a first—in—man study was successfully completed where an AON
`
`inducing the skipping of exon 51 was injected into a small area of the
`
`tibialis anterior muscle of four DMD patients. Novel dystrophin expression
`
`was observed in the majority of muscle fibers in all four patients treated,
`
`and the AON was safe and well tolerated (van Deutekom et al. N Engl J
`
`15
`
`Med. 2007; 357: 2677-86).
`
`Most AONs studied contain up to 20 nucleotides, and it has been argued
`
`that this relatively short size improves the tissue distribution and/0r cell
`
`penetration of an AON. However, such short AONs will result in a limited
`
`specificity due to an increased risk for the presence of identical sequences
`
`elsewhere in the genome, and a limited target binding or target affinity
`
`due to a low free energy of the AON-target complex. Therefore the
`
`inventors decided to design new and optionally improved oligonucleotides
`
`that would not exhibit all of these drawbacks.
`
`Description of the invention
`
`Method
`
`In a first aspect, the invention provides a method for inducing and/or
`
`promoting skipping of exon 45 of DMD pre—mRNA in a patient, preferably
`
`in an isolated cell of said patient,
`
`the method comprising providing said
`
`20
`
`25
`
`30
`
`

`

`WO 2010/050801
`
`' 4 '
`
`PCT/NL2009/050006
`
`cell and/or said patient with a molecule that binds to a continuous stretch
`
`of at least 21 nucleotides within said exon.
`
`Accordingly, a method is herewith provided for inducing and/or promoting
`
`skipping of exon 45 of DMD pre—mRNA, preferably in an isolated cell of a
`
`patient,
`
`the method comprising providing said cell and/or said patient with
`
`a molecule that binds to a continuous stretch of at least 21 nucleotides
`
`within said exon.
`
`It is to be understood that said method encompasses an in vitro,
`
`in vivo or
`
`ex vivo method.
`
`As defined herein a DMD pre—mRNA preferably means the pre—mRNA of a
`
`DMD gene of a DMD or BMD patient. The DMD gene or protein
`
`corresponds to the dystrophin gene or protein.
`
`Apatient is preferably intended to mean a patient having DMD or BMD
`
`as later defined herein or a patient susceptible to develop DMD or BMD
`
`due to his or her genetic background.
`
`Exon skipping refers to the induction in a cell of a mature mRNA that
`
`does not contain a particular exon that is normally present therein. Exon
`
`skipping is achieved by providing a cell expressing the pre—mRNA of said
`
`mRNA with a molecule capable of interfering with sequences such as, for
`
`example, the splice donor or splice acceptor sequence that are both
`
`required for allowing the enzymatic process of splicing, or a molecule that
`
`is capable of interfering with an exon inclusion signal required for
`
`recognition of a stretch of nucleotides as an exon to be included in the
`
`mRNA. The term pre—mRNA refers to a non—processed or partly processed
`
`precursor mRNA that is synthesized from a DNA template in the cell
`
`nucleus by transcription.
`
`Within the context of the invention inducing and/or promoting skipping of
`
`an exon as indicated herein means that at least 1%, 10%, 20%, 30%,
`
`40%,50%, 60%, 70%, 80%, 90% or more of the DMD mRNA in one or more
`
`10
`
`15
`
`2O
`
`25
`
`30
`
`

`

`WO 2010/050801
`
`' 5 '
`
`PCT/NL2009/050006
`
`(muscle) cells of a treated patient will not contain said exon. This is
`
`preferably
`
`assessed by PCR as described in the examples.
`
`Preferably, a method of the invention by inducing or promoting
`
`skipping of
`
`exon 45 of the DMD pre—mRNA in one or more cells of a patient provides
`
`said patient with a functional dystrophin protein and/or decreases the production of an
`
`aberrant dystrophin protein in said patient. Therefore
`
`a preferred method is a
`
`method, wherein a patient or a cell of said patient
`
`is provided with a
`
`functional dystrophin protein and/or wherein the production of an aberrant dystrophin
`
`protein in said patient or in a cell of said patient is decreased
`
`Decreasing the production of an aberrant dystrophin may be assessed at the mRNA
`
`level and preferably means that 99%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%,
`
`10%, 5% or less of the initial amount of aberrant dystrophin mRNA, is still detectable
`
`by RT PCR. An aberrant dystrophin mRNA or protein is also referred to herein as a
`
`non—functional dystrophin mRNA or protein. A non functional dystrophin protein is
`
`preferably a dystrophin protein which is not able to bind actin and/or members of the
`
`DGC protein complex. A non- functional dystrophin protein or dystrophin mRNA
`
`does typically not have, or does not encode a dystrophin protein with an intact C—
`
`terminus of the protein.
`
`Increasing the production of a functional dystrophin in said patient or in a cell of said
`
`patient may be assessed at the mRNA level (by RT—PCR analysis) and preferably
`
`means that a detectable amount of a functional dystrophin mRNA is detectable by RT
`
`PCR. In another embodiment, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%,
`
`90% or more of the detectable dystrophin mRNA is a functional dystrophin mRNA.
`
`Increasing the production of a functional dystrophin in said patient or in a cell of said
`
`patient may be assessed at the protein level (by immunofluorescence and western blot
`
`analyses) and preferably means that a detectable amount of a functional dystrophin
`
`protein is detectable by immunofluorescence or western blot analysis. In another
`
`embodiment, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of
`
`the detectable dystrophin protein is a functional dystrophin protein.
`
`10
`
`15
`
`2O
`
`25
`
`30
`
`As defined herein, a functional dystrophin is preferably a wild type dystrophin
`
`corresponding to a protein having the amino acid sequence as identified in SEQ ID
`
`

`

`WO 2010/050801
`
`' 6 '
`
`PCT/NL2009/050006
`
`NO: 1. A functional dystrophin is preferably a dystrophin, which has an actin binding
`
`domain in its N terminal part (first 240 amino acids at the N terminus), a cystein—rich
`
`domain (amino acid 3361 till 3685) and a C terminal domain (last 325 amino acids at
`
`the C terminus) each of these domains being present in a wild type dystrophin as
`
`known to the skilled person. The amino acids indicated herein correspond to amino
`
`acids of the wild type dystrophin being represented by SEQ ID NO: 1. In other words,
`
`a functional dystrophin is a dystrophin which exhibits at least to some extent an
`
`activity of a wild type dystrophin. ”At least to some extent" preferably means at least
`
`10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% ofa corresponding
`
`activity ofa wild type functional dystrophin. In this context, an activity of a functional
`
`dystrophin is preferably binding to actin and t0 the dystrophin—associated glycoprotein
`
`complex (DGC) (Aartsma—Rus A et a1, (2006), Entries in the leiden Duchenne
`
`Muscular Dystrophy mutation database: an overview of mutation types and
`
`paradoxical cases that confirm the reading—frame rule, Muscle Nerve, 34: 135—144).
`
`Binding of dystrophin to actin and to the DGC complex may be visualized by either
`
`co—immunoprecipitation using total protein extracts or immunofluorescence analysis
`
`of cross—sections, from a muscle biopsy, as known to the skilled person.
`
`Individuals or patients suffering from Duchenne muscular dystrophy typically
`
`have a mutation in the DMD gene that prevent synthesis of the complete dystrophin
`
`protein, LC of a premature stop prevents the synthesis of the C—terminus. In Becker
`
`muscular dystrophy the DMD gene also comprises a mutation compared to the wild
`
`type gene but the mutation does typically not induce a premature stop and the C-
`
`terminus is typically synthesized. As a result a functional dystrophin protein is
`
`synthesized that has at least the same activity in kind as the wild type protein, not
`
`although not necessarily the same amount of activity. The genome of a BMD
`
`individual typically encodes a dystrophin protein comprising the N terminal part (first
`
`240 amino acids at the N terminus), a cystein—rich domain (amino acid 3361 till 3685)
`
`and a C terminal domain (last 325 amino acids at the C terminus) but its central rod
`
`shaped domain may be shorter than the one of a wild type dystrophin (Aartsma—Rus A
`
`et a1, (2006), Entries in the leiden Duchenne Muscular Dystrophy mutation database:
`
`an overview of mutation types and paradoxical cases that confirm the reading—frame
`
`rule, Muscle Nerve, 34: 135—144). Exon —skipping for the treatment of DMD is
`
`typically directed to overcome a premature stop in the pre—mRNA by skipping an
`
`exon in the rod—shaped domain to correct the reading frame and allow synthesis of the
`
`10
`
`15
`
`20
`
`25
`
`30
`
`

`

`WO 2010/050801
`
`' 7 '
`
`PCT/NL2009/050006
`
`remainder of the dystrophin protein including the C—terminus, albeit that the protein is
`
`somewhat smaller as a result of a smaller rod domain. In a preferred embodiment, an
`
`individual having DMD and being treated by a method as defined herein will be
`
`provided a dystrophin which exhibits at least to some extent an activity of a wild type
`
`dystrophin. More preferably, if said individual is a Duchenne patient or is suspected to
`
`be a Duchenne patient, a functional dystrophin is a dystrophin of an individual having
`
`BMD: typically said dystrophin is able to interact with both actin and the DGC, but its
`
`central rod shaped domain may be shorter than the one of a wild type dystrophin
`
`(Aartsma—Rus A et al, (2006), Entries in the leiden Duchenne Muscular Dystrophy
`
`mutation database: an overview of mutation types and paradoxical cases that confirm
`
`the reading—frame rule, Muscle Nerve, 34: 135 —144). The central rod—shaped domain
`
`of wild type dystrophin comprises 24 spectrin—like repeats (Aartsma—Rus A et a1,
`
`(2006), Entries in the leiden Duchenne Muscular Dystrophy mutation database: an
`
`overview of mutation types and paradoxical cases that confirm the reading—frame rule,
`
`Muscle Nerve, 34: 135—144). For example, a central rod—shaped domain of a
`
`dystrophin as provided herein may comprise 5 to 23, 10 to 22 or 12 to 18 spectrin—like
`
`repeats as long as it can bind to actin and to DGC.
`
`A method of the invention may alleviate one or more characteristics
`
`of a
`
`muscle cell from a DMD patient comprising deletions
`
`including but not
`
`limited to exons 12—44,
`
`18—44, 44, 46, 46—47,
`
`46—48,
`
`46—49,
`
`46—51,
`
`46—53,
`
`46—55,
`
`46—59, 46—60 of the DMD pre—mRNA of said patient
`
`(Aartsma—Rus
`
`and van Deutekom,
`
`2007, Antisense Elements
`
`(Genetics) Research Focus,
`
`2007 Nova Science Publishers,
`
`Inc) as well as from DMD patients
`
`requiring the simultaneous
`
`skipping of one of more exons in addition to
`
`exon 45 including but not limited to patients with a deletion of exons 46—50
`
`requiring the co—skipping of exons 45 and 51, or with a deletion of exons
`
`46—52 requiring the co—skipping of exons 45 and 53.
`
`In a preferred method, one or more symptom(s) or characteristic(s) of a myogenic cell
`
`or muscle cell from a DMD patient
`
`is/are alleviated. Such symptoms or
`
`characteristics may be assessed at the cellular, tissue level or on the patient self.
`
`10
`
`15
`
`20
`
`25
`
`30
`
`

`

`WO 2010/050801
`
`' 8 '
`
`PCT/NL2009/050006
`
`An alleviation of one or more symptoms or characteristics may be assessed by
`
`any of the following assays on a myogenic cell or muscle cell from a patient:
`
`reduced calcium uptake by muscle cells, decreased collagen synthesis,
`
`altered morphology,
`
`altered lipid biosynthesis,
`
`decreased oxidative stress,
`
`5
`
`and/or
`
`improved muscle fiber function,
`
`integrity,
`
`and/or
`
`survival. These
`
`parameters
`
`are usually assessed using immunofluorescence
`
`and/or
`
`histochemical
`
`analyses of cross sections of muscle biopsies.
`
`The improvement of muscle fiber function, integrity and/or survival may also be
`
`assessed using at least one of the following assays: a detectable decrease of creatine
`
`10
`
`kinase in blood, a detectable decrease of necrosis of muscle fibers in abiopsy cross—
`
`section of a muscle suspected to be dystrophic, and/or a detectable increase of the
`
`homogeneity of the diameter of muscle fibers in a biopsy cross-section of a muscle
`
`suspected to be dystrophic. Each of these assays is known to the skilled person.
`
`Creatine kinase may be detected in blood as described in Hodgetts et a1
`
`15
`
`(Hodgetts S., et a1, (2006), Neuromuscular Disorders, 16: 591—6022006). A detectable
`
`decrease in creatine kinase may mean a decrease of 5%, 10%, 20%, 30%, 40%, 50%,
`
`60%, 70%, 80%, 90% or more compared to the concentration of creatine kinase in a
`
`same DMD patient before treatment.
`
`A detectable decrease of necrosis of muscle fibers is preferably assessed in a
`
`20
`
`muscle biopsy, more preferably as described in Hodgetts et a1 (Hodgetts S., et a1,
`
`(2006), Neuromuscular Disorders, 16: 591—6022006) using biopsy cross—sections. A
`
`detectable decrease of necrosis may be a decrease of 5%, 10%, 20%, 30%, 40%, 50%,
`
`60%, 70%, 80%, 90% or more of the area wherein necrosis has been identified using
`
`biopsy cross—sections. The decrease is measured by comparison to the necrosis as
`
`25
`
`assessed in a same DMD patient before treatment.
`
`A detectable increase of the homogeneity of the diameter of muscle fibers is
`
`preferably assessed in a muscle biopsy cross—section, more preferably as described in
`
`Hodgetts et a1 (Hodgetts S., et a1, (2006), Neuromuscular Disorders, 16: 591—
`
`602.2006). The increase is measured by comparison to the homogeneity of the
`
`30
`
`diameter of muscle fibers in a muscle biopsy cross-section of a same DMD patient
`
`before treatment.
`
`

`

`WO 2010/050801
`
`' 9 '
`
`PCT/NL2009/050006
`
`An alleviation of one or more symptoms or characteristics may be assessed by any of
`
`the following assays on the patient self: prolongation of time to loss of walking,
`
`improvement of muscle strength, improvement of the ability to lift weight,
`
`improvement of the time taken to rise from the floor, improvement in the nine—meter
`
`walking time, improvement in the time taken for four—stairs climbing, improvement of
`
`the leg function grade, improvement of the pulmonary function, improvement of
`
`cardiac function, improvement of the quality of life. Each of these assays is known to
`
`the skilled person. As an example, the publication of Manzur at al (Manzur AY et a1,
`
`(2008), Glucocorticoid corticosteroids for Duchenne muscular dystrophy (review),
`
`Wiley publishers, The Cochrane collaboration.) gives an extensive explanation of
`
`each of these assays. For each of these assays, as soon as a detectable improvement or
`
`prolongation of a parameter measured in an assay has been found, it will preferably
`
`mean that one or more symptoms of Duchenne Muscular Dystrophy has been
`
`alleviated in an individual using a method of the invention. Detectable improvement
`
`or prolongation is preferably a statistically significant improvement or prolongation as
`
`described in Hodgetts et a1 (Hodgetts S., et a1, (2006), Neuromuscular Disorders, 16:
`
`591—6022006). Alternatively, the alleviation of one or more symptom(s) of Duchenne
`
`Muscular Dystrophy may be assessed by measuring an improvement of a muscle fiber
`
`function, integrity and/or survival as later defined herein.
`
`A treatment in a method according to the invention may have a duration of at least
`
`one week, at least one month, at least several months, at least one year, at least 2, 3, 4,
`
`5, 6 years or more. The frequency of administration of an oligonucleotide,
`
`composition, compound of the invention may depend on several parameters such as
`
`the age of the patient, the type of mutation, the number of molecules (dose), the
`
`formulation of said molecule. The frequency may be ranged between at least once in a
`
`two weeks, or three weeks or four weeks or five weeks or a longer time period.
`
`Each molecule or oligonucleotide or equivalent thereof as defined herein for use
`
`according to the invention may be suitable for direct administration to a cell, tissue
`
`and/or an organ in vivo of individuals affected by or at risk of developing DMD and
`
`may be administered directly in vivo, ex vivo or in vitro. An oligonucleotide as used
`
`herein may be suitable for administration to a cell, tissue and/or an organ in vivo of
`
`individuals affected by or at risk of developing DMD, and may be administered in
`
`vivo, ex vivo or in vitro. Said oligonucleotide may be directly or indirectly
`
`10
`
`15
`
`20
`
`25
`
`30
`
`

`

`W0 2010/050801
`
`- 10 -
`
`PCT/NL2009/050006
`
`administrated to a cell, tissue and/or an organ in, vivo of an individual affected by or at
`
`risk of developing DMD, and may be administered directly or indirectly in, viva, ex
`
`vivo or in vitro. As Duchenne muscular dystrophy has a pronounced phenotype in
`
`muscle cells, it is preferred that said cells are muscle cells,
`
`it is further preferred that
`
`said tissue is a muscular tissue and/or it is further preferred that said organ comprises
`
`or consists of a muscular tissue. A preferred organ is the heart. Preferably said cells
`
`comprise a gene encoding a mutant dystrophin protein. Preferably said cells are cells
`
`of an individual suffering from DMD.
`
`10
`
`15
`
`20
`
`25
`
`30
`
`A molecule or oligonucleotide or equivalent thereof can be delivered as is to a cell.
`
`When administering said molecule, oligonucleotide or equivalent thereof to an
`
`individual, it is preferred that it is dissolved in a solution that is compatible with the
`
`delivery method. For intravenous, subcutaneous, intramuscular, intrathecal and/or
`
`intraventricular administration it is preferred that the solution is a physiological salt
`
`solution. Particularly preferred for a method of the invention is the use of an eXCipient
`
`that will further enhance delivery of said molecule, oligonucleotide or functional
`
`equivalent thereof as defined herein, to a cell and into a cell, preferably a muscle cell.
`
`Preferred excipient are defined in the section entitled ”pharmaceutical composition".
`
`In vitro, we obtained very good results using polyethylenimine (PEI, ExGenSOO, MBI
`
`Fermentas) as shown in the example.
`
`In a preferred method of the invention,
`
`an additional molecule is used Which is
`
`able to induce and/or promote skipping of a distinct exon of the DMD pre—mRNA of a
`
`patient. Preferably, the second exon is selected from: exon 7, 44, 46, 51, 53, 59, 67 of
`
`the dystrophin pre—mRNA of a patient. Molecules which can be used are depicted in
`
`table 2. Preferred molecules comprise or consist of any of the oligonucleotides as
`
`disclosed in table 2. Several oligonucleotides may also be used in combination.This
`
`way, inclusion of two or more exons of a DMD pre—mRNA in mRNA produced from
`
`this pre—mRNA is prevented. This embodiment is further referred to as double— or
`
`multi—exon skipping (Aartsma—Rus A, Janson AA, Kaman WE, et a1. Antisense—
`
`induced multiexon skipping for Duchenne muscular dystrophy makes more sense. Am
`
`J Hum Genet 2004;74(l):83—92, Aartsma—Rus A, Kaman WE, Weij R, den Dunnen
`
`

`

`W0 2010/050801
`
`- 11 -
`
`PCT/NL2009/050006
`
`JT, van Ommen G], van Deutekom JC. Exploring the frontiers of therapeutic exon
`
`skipping for Duchenne muscular dystrophy by double targeting within one or multiple
`
`exons. MoI Ther 2006;l4(3):401—7). In most cases double—exon skipping results in the
`
`exclusion of only the two targeted exons from the dystrophin pre-mRNA. However, in
`
`other cases it was found that the targeted exons and the entire region in between said
`
`exons in said pre—mRNA were not present in the produced mRNA even when other
`
`exons (intervening exons) were present in such region. This multi—skipping was
`
`notably so for the combination of oligonucleotides derived from the DMD gene,
`
`wherein one oligonucleotide for exon 45 and one oligonucleotide for exon 5 l was
`
`added to a cell transcribing the DMD gene. Such a set—up resulted in mRNA being
`
`produced that did not contain exons 45 to 51. Apparently, the structure of the pre—
`
`mRNA in the presence of the mentioned oligonucleotides was such that the splicing
`
`machinery was stimulated to connect exons 44 and 52 to each other.
`
`It is possible to specifically promote the skipping of also the intervening exons by
`
`providing a linkage between the two complementary oligonucleotides. Hence, in one
`
`embodiment stretches of nucleotides complementary to at least two dystrophin exons
`
`are separated by a linking moiety. The at least two stretches of nucleotides are thus
`
`linked in this embodiment so as to form a single molecule.
`
`In case, more than one compounds are used in a method of the invention, said
`
`compounds can be administered to an individual in any order. In one embodiment,
`
`said compounds are administered simultaneously (meaning that said compounds are
`
`administered within 10 hours, preferably within one hour). This is however not
`
`necessary. In another embodiment, said compounds are administered sequentially.
`
`Molecule
`
`In a second aspect,
`
`there is provided a molecule for use in a method as
`
`described in the previous
`
`section entitled ”Method". This molecule
`
`preferably comprises or consists of an oligonucleotide,
`
`Said oligonucleotide
`
`is preferably
`
`an antisense
`
`oligonucleotide
`
`(AON) or antisense
`
`oligoribonucleotide.
`
`It was found by the present
`
`investigators
`
`that especially exon 45 is
`
`specifically skipped at a high frequency using a molecule that binds to a
`
`10
`
`15
`
`20
`
`25
`
`30
`
`

`

`W0 2010/050801
`
`- 12 -
`
`PCT/NL2009/050006
`
`continuous
`
`stretch of at least 21 nucleotides within said exon. Although
`
`this effect can be associated with a higher binding affinity of said
`
`molecule, compared to a molecule that binds to a continuous
`
`stretch of less
`
`than 21 nucleotides,
`
`there could be other intracellular
`
`parameters
`
`involved that
`
`favor thermodynamic,
`
`kinetic, or structural
`
`characteristics
`
`of
`
`the hybrid duplex.
`
`In a preferred embodiment,
`
`a molecule that binds to a
`
`continuous
`
`stretch of at least 21, 25, 30, 35, 40, 45, 50 nucleotides within
`
`said exon is used.
`
`In a preferred embodiment, a molecule or an oligonucleotide of the invention
`
`which comprises a sequence that is complementary to a part of exon 45 of DMD pre—
`
`mRNA is such that the complementary part is at least 50% of the length of the
`
`oligonucleotide of the invention, more preferably at least 60%, even more preferably
`
`at least 70%, even more preferably at least 80%, even more preferably at least 90% or
`
`even more preferably at least 95%, or even more preferably 98% and most preferably
`
`up to 100%. "A part of exon 45 " preferably means a stretch of at least 2 1 nucleotides.
`
`In a most preferred embodiment, an oligonucleotide of the invention consists of a
`
`sequence that is complementary to part of exon 45 dystrophin pre—mRNA as defined
`
`herein. Alternatively, an oligonucleotide may comprise a sequence that is
`
`complementary to part of exon 45 dystrophin pre—mRN A as defined herein and
`
`additional flanking sequences. In a more preferred embodiment, the length of said
`
`complementary part of said oligonucleotide is of at least 21, 22, 23, 24, 25, 26, 27 , 28
`
`, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50
`
`nucleotides. Several types of flanking sequences may be used. Preferably, additional
`
`flanking sequences are used to modify the binding of a protein to said molecule or
`
`oligonucleotide, or to modify a thermodynamic property of the oligonucleotide, more
`
`preferably to modify target RNA binding affinity. In another preferred embodiment,
`
`additional flanking sequences are complementary to sequences of the DMD pre—
`
`mRN A which are not present in exon 45. Such flanking sequences are preferably
`
`complementary to sequences comprising or consisting of the splice site acceptor or
`
`donor consensus sequences of exon 45. In a preferred embodiment, such flanking
`
`sequences are complementary to sequences comprising or consisting of sequences of
`
`an intron of the DMD pre—mRNA which is adjacent to exon 45; Le. intron 44 or 45.
`
`10
`
`15
`
`20
`
`25
`
`30
`
`

`

`W0 2010/050801
`
`- 13 -
`
`PCT/NL2009/050006
`
`Acontinuous stretch of at least 21, 25, 30, 35, 40, 45, 50 nucleotides within
`
`exon 45 is preferably selected from the sequence:
`
`5'- CCAGGAUGGCAUUGGGCAGCGGCAAACUGUUGUCAGA
`
`ACAUUGAAUGCAACUGGGGAAGAAAUAAUUCAGCAAUC—3'
`
`(SEQ ID NO 2).
`
`It was found that a molecule that binds to a nucleotide sequence
`
`comprising or consisting ofa continuous stretch of at least 21, 25, 30, 35,
`
`40, 45, 50 nucleotides of SEQ ID NO. 2 results in highly efficient skipping
`
`of exon 45 in a cell provided with this molecule. Molecules that bind to a
`
`nucleotide sequence comprising a continuous stretch of less than 21
`
`nucleotides of SEQ ID N022 were found to induce exon skipping in a less
`
`efficient way than the molecules of the invention. Therefore, in a preferred
`
`embodiment, a method is provided wherein a molecule binds to a
`
`continuous stretch of at least 21, 25, 30, 35 nucleotides within SEQ ID
`
`NO:2. Contrary to what was generally thought, the inventors surprisingly
`
`found