US. 15/952,203
`Response to Sequence Listing Notice filed July 10, 2018
`
`AMENDMENTS TO THE SPECIFICATION
`
`Please amend the specification as shown:
`
`Please insert the following on page 1, after the priority paragraph:
`
`SEQUENCE LISTING
`
`[0001.1]
`
`The instant application contains a Sequence Listing which has been filed
`
`electronically in ASCII format and is hereby incorporated by reference in its entirety. Said
`
`ASCII copy, created on July 10, 2018, is named 47697_709_20l_SL.txt and is 2,751 bytes in
`
`size.
`
`Please delete paragraph [00329] and replace it with the following paragraph:
`
`[00329]
`
`Ligation of the first adapter. PEG-4000 (32 uL, 50%), single-stranded adapter
`
`oligo CL78 (l uL, 10 pM, 5’-[Phosphate]AGATCGGAAG[C3 Spacer] 10[TEG—biotin]-3’, (TEG
`
`= triethylene glycol spacer) [SEQ ID NO: 4]), and CircLigase II (4 uL, 100 U uL'l) were added
`
`to the reaction mixtures to obtain a final reaction volume of 80 [LL The contents of the tubes
`
`were mixed before adding CircLigase II. The tubes were spun briefly in a microcentrifuge. The
`
`reaction mixtures were incubated in a thermal cycler with a heated lid for 1 hr at 60 oC. Stop
`
`solution (2 uL) (98 [LL of 0.5 M EDTA (pH 8.0) and 2 [LL of Tween 20 were combined to make
`
`100 uL of stop solution) was added to each reaction mixture. The contents were mixed, and the
`
`tubes were spun in a microcentrifuge.
`
`Please delete paragraph [00332] and replace it with the following paragraph:
`
`[00332]
`
`Bst 2.0 polymerase. For the master mix comprising, Bst 2.0 polymerase, 40.5 uL
`
`water, 5 [LL 10>< isothermal amplification buffer (New England Biolabs), 0.5 uL dNTP mix (25
`
`mM each), and 1 [LL extension primer CL9 (5’-
`
`GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’ [SEQ ID NO: 1], 100 uM) were
`
`combined to make 47 [LL master mix. The beads were pelleted using a magnetic rack, and the
`
`wash buffer was discarded. The 47-uL reaction mixture was added to the pelleted beads, and the
`
`beads were resuspended by vortexing. The tubes were incubated in a thermal shaker for 2 min at
`
`1007 3345_1.doc
`
`-2-
`
`Attorney Docket No. 47697-709201
`
`

`

`US. 15/952,203
`Response to Sequence Listing Notice filed July 10, 2018
`
`65 oC. The tubes were placed in an ice-water bath for l min and then were immediately
`
`transferred to a thermal cycler precooled to 15 oC. While the tubes were placed on the thermal
`
`cycler, a polymerase (e.g., Bst 2.0 polymerase (3 uL, 24 U, New England Biolabs), DNA
`
`polymerase, or reverse transcriptase) was added to each reaction mixture. The tubes were mixed
`
`briefly by vortexing and returned to the thermal cycler. The reaction mixtures were incubated by
`
`increasing the temperature by l 0C per minute, ramping the temperature up from 15 0C to 37 oC.
`
`The reaction mixtures were incubated for 5 min at 37 oC. The tubes were spun briefly in a
`
`microcentrifuge. The beads were pelleted using a magnetic rack, and the supernatant was
`
`discarded.
`
`Please delete paragraph [00334] and replace it with the following paragraph:
`
`[00334]
`
`SMARTer RT. Clonetech SMARTer RT can be used in place of Bst 2.0
`
`polymerase, according to the manufacturer’s instructions with the following modifications: 1) in-
`
`house extension primer CL9 (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’
`
`[SEQ ID NO:1[) was used for the primer extension in step 4 of the protocol in place of the
`
`manufacturer’s 3’ SMART CDS Primer II A, and 2) SMART-Seq V4 oligonucleotide was not
`
`used in the Step 6 of the manufacturer’s protocol. The beads were pelleted on the magnet and
`
`reverse transcription products were collected in the supernatant, purified, amplified by PCR, and
`
`sequenced. Results were quantified also using TapeStation (Agilent).
`
`Please delete paragraph [00337] and replace it with the following paragraph:
`
`[00337]
`
`Ligation of second adapter and library elution. A master mix was prepared for
`
`the required number of reactions (98 [LL per reaction). 73.5 uL water, 10 [LL 10>< T4 DNA ligase
`
`buffer, 10 [LL PEG-4000 (50%), 2.5 uL Tween 20 (1%), and 2 [LL double-stranded adapter (100
`
`uM) were combined to make 98 [LL master mix. To make the double-stranded adapter stock
`
`solution, 9.5 uL of TE buffer, 0.5 pL of 5 M NaCl, 20 [LL of 500 uM oligonucleotide CL53 (5’-
`
`CGACGCTCTTC-ddC [SEQ ID NO: 2]) (ddC = dideoxycytidine), and 20 pL of 500 uM
`
`oligonucleotide CL73 (5’-[Phosphate]GGAAGAGCGTCGTGTAGGGAAAGAG*T*G*T*A-3’
`
`[SEQ ID NO: 3]) (* = phosphothioate linkage) were combined in a PCR tube, the reaction
`
`mixture was incubated in a thermal cycler for 10 s at 95 0C, the temperature was slowly
`
`decreased at the rate of 0.1 0C per second until reaching 14 oC, and 50 [LL of TE buffer was
`
`10073345_1.doc
`
`-3-
`
`Attorney Docket No. 47697-709201
`
`

`

`US. 15/952,203
`Response to Sequence Listing Notice filed July 10, 2018
`
`added to the hybridized adapter to obtain a concentration of 100 uM in a total volume of 100 uL.
`
`49.4 mL of water, 500 uL of l M Tris-HCl (pH 8.0), and 100 uL of 0.5 M EDTA (pH 8.0) were
`
`combined to make 50 mL of TE buffer. The beads were pelleted using a magnetic rack, and the
`
`wash buffer was discarded. The reaction mixture (98 uL) was added to the pelleted beads, and
`
`the beads were resuspended by vortexing. T4 DNA ligase (2 uL, 10 U, Thermo Scientific) was
`
`added. The contents were mixed briefly by vortexing. The reaction mixtures were incubated for 1
`
`hr at room temperature. The beads were kept suspended during incubation. The beads were
`
`pelleted using a magnetic rack, and the supernatant was discarded. The beads were washed once
`
`with 200 pl of wash buffer A. The beads were resuspended in 100 uL of stringency wash buffer,
`
`and the bead suspensions were incubated for 3 min at 45 0C in a thermal shaker. The beads were
`
`pelleted using a magnetic rack, and the supernatant was discarded. The beads were washed once
`
`with 200 uL of wash buffer B. The beads were pelleted using a magnetic rack, and the
`
`supernatant was discarded. TET buffer (25 uL) (49.375 mL of water, 500 uL of l M Tris-HCl,
`
`100 uL of 0.5 M EDTA, and 25 [LL of Tween 20 were combined to make 50 mL of TET buffer)
`
`was added to the pelleted beads, and the beads were resuspended by vortexing. The bead
`
`suspension was transfer to 0.2-mL PCR strip tubes. The tubes were spun briefly in a
`
`microcentrifuge. The bead suspensions were incubated for l min at 95 0C in a thermal cycler
`
`with a heated lid. The PCR strip tubes were immediately transferred to a 96-well magnetic rack.
`
`The supernatant was transferred, which contains the library molecules, to a fresh 0.5-mL tube.
`
`Please delete paragraph [00339] and replace it with the following paragraph:
`
`[00339]
`
`Sequencing. For sequencing, the protocols and instructions for multiplex
`
`sequencing provided by Illumina were followed. The sequencing primer of the first read was
`
`replaced by the custom primer CL72 (5’-ACACTCTTTCCCTACACGACGCTCTTCC-3’m
`
`ID NO: 16]). A ready-to-use dilution of CL72 was freshly prepared before sequencing by
`
`mixing 10 [LL from the 100 uM stock solution with 1,990 uL of hybridization buffer (provided
`
`with the sequencing reagents).
`
`Please delete paragraph [00346] and replace it with the following paragraph:
`
`[00346]
`
`The adapter used in the CircLigase II and T4 RNA Ligase 1 ligation: The
`
`adapter used was
`
`1007 3345_1.doc
`
`-4-
`
`Attorney Docket No. 47697-709201
`
`

`

`US. 15/952,203
`Response to Sequence Listing Notice filed July 10, 2018
`
`/5Phos/AGATCGGAAG/iSpC3/iSpC3/iSpC3/iSpC3/iSpC3/iSpC3/iSpC3/iSpC3/iSpC3/iSpC3/3
`
`BioTEG/ (SEQ ID NO: 41 and contains 5’-phosphy1ation, 3’-biotiny1ation, and non-nucleotide
`
`polymer extension. The Thermostable App ligase requires an App modification (eg, pre-
`
`adenylation) at the 5’-end.
`
`Please delete paragraph [00350] and replace it with the following paragraph:
`
`[00350]
`
`Post-ligation reverse transcription was performed with Clonetech SMARTer
`
`E: The reverse transcription reaction was carried out according to the manufacturer’s
`
`instructions with the following modifications: 1) in-house extension primer CL9 (5’-
`
`GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’ (SEQ ID NO: 1 1) was used for the
`
`primer extension reaction in step 4 of the protocol in place of the manufacturer’s 3’ SMART
`
`CDS Primer II A, and 2) SMART-Seq V4 oligonucleotide was not used in the step 6 of the
`
`manufacturer’s protocol. Reverse transcription products were amplified by PCR. The amplified
`
`products were quantified using TapeStation (Agilent).
`
`10073345_1.doc
`
`-5-
`
`Attorney Docket No. 47697-709201
`
`