`
`UNITED STATES PATENT AND TRADEMARK OFFICE
`UNITED STATES DEPARTMENT OF CONINJERCE
`United States Patent and Trademark Office
`Address: COMMISSIONER FOR PATENTS
`P.O. Box 1450
`Alexandria, Virginia 223 13-1450
`www.uspto.gov
`
`15/789,862
`
`10/20/2017
`
`Peter SAZANI
`
`AVN—009DVCN7
`
`6698
`
`Nelson Mullins Riley & Scarborough LLP/Sarepta
`One Post Office Square
`Boston, MA 02109
`
`MCDONALD, JENNIFER SUE PITRAK
`
`ART UNIT
`
`1 674
`
`PAPER NUMBER
`
`NOTIFICATION DATE
`
`DELIVERY MODE
`
`12/1 5/2017
`
`ELECTRONIC
`
`Please find below and/or attached an Office communication concerning this application or proceeding.
`
`The time period for reply, if any, is set in the attached communication.
`
`Notice of the Office communication was sent electronically on above-indicated "Notification Date" to the
`following e-mail address(es):
`
`ipboston.docketing@nelsonmullins.com
`Chris.schlauch@nelsonmullins.com
`ipqualityassurancebost0n@nelsonmullins.corn
`
`PTOL-QOA (Rev. 04/07)
`
`

`

`017709 A0110” Summary
`
`Application No.
`15/789,862
`
`Applicant(s)
`SAZANI et al.
`
`Examiner
`JENNIFER P MCDONALD
`
`Art Unit
`1674
`
`AIA Status
`NO
`
`- The MAILING DA TE ofthis communication appears on the cover sheet with the correspondence address -
`Period for Reply
`
`A SHORTENED STATUTORY PERIOD FOR REPLY IS SET TO EXPIRE 3 MONTHS FROM THE MAILING
`DATE OF THIS COMMUNICATION.
`- Extensions of time may be available under the provisions of 37 CFR 1.136(a). In no event, however, may a reply be timely filed
`after SIX (6) MONTHS from the mailing date of this communication.
`If NO period for reply is specified above, the maximum statutory period will apply and will expire SIX (6) MONTHS from the mailing date of this communication.
`-
`- Failure to reply within the set or extended period for reply will, by statute, cause the application to become ABANDONED (35 U.S.C. § 133).
`Any reply received by the Office later than three months after the mailing date of this communication, even if timely filed, may reduce any
`earned patent term adjustment. See 37 CFR 1.704(b).
`
`Status
`
`1). Responsive to communication(s) filed on 10/23/2017
`.
`D A declaration(s)laffidavit(s) under 37 CFR 1.130(b) was/were filed on
`2a)[:| This action is FINAL.
`2b)
`This action is non-final.
`
`3)|:| An election was made by the applicant in response to a restriction requirement set forth during the interview on
`; the restriction requirement and election have been incorporated into this action.
`
`4)I:| Since this application is in condition for allowance except for formal matters, prosecution as to the merits is
`closed in accordance with the practice under Exparfe Quay/e, 1935 CD. 11, 453 O.G. 213.
`
`
`
`Disposition of Claims"
`5)
`Claim(s)
`
`66-69 is/are pending in the application.
`
`5a) Of the above Claim(s)
`
`is/are withdrawn from consideration.
`
`6) El Claim(s)
`
`is/are allowed.
`
`7)
`
`8)
`
`Claim(s) 66-69 is/are rejected.
`
`I] Claim(s)
`
`is/are objected to.
`
`are subject to restriction and/or election requirement
`9) El Claim(s)
`* If any claims have been determined allowable, you may be eligible to benefit from the Patent Prosecution Highway program at a
`
`participating intellectual property office for the corresponding application. For more information, please see
`
`http:llwww.uspto.govlpatents/init_events/pphlindex.jsp or send an inquiry to PPeredback@uspto.gov.
`
`Application Papers
`
`10)l:| The specification is objected to by the Examiner.
`
`11). The drawing(s) filed on 20 October 2017 islare: a). accepted or b)[:| objected to by the Examiner.
`Applicant may not request that any objection to the drawing(s) be held in abeyance. See 37 CFR 1.85(a).
`Replacement drawing sheet(s) including the correction is required if the drawing(s) is objected to. See 37 CFR 1.121(d).
`
`Priority under 35 U.S.C. § 119
`12)|:| Acknowledgment is made of a claim for foreign priority under 35 U.S.C. § 119(a)—(d) or ( ).
`Certified copies:
`
`a)|:l All
`
`b)|:l Some**
`
`c)|:l None of the:
`
`1.[:|
`
`Certified copies of the priority documents have been received.
`
`2.|:|
`
`Certified copies of the priority documents have been received in Application No.
`
`3.|:| Copies of the certified copies of the priority documents have been received in this National Stage
`application from the International Bureau (PCT Rule 17.2(a)).
`
`** See the attached detailed Office action for a list of the certified copies not received.
`
`Attachment(s)
`
`1) [3 Notice of References Cited (PTO-892)
`
`Information Disclosure Statement(s) (PTOISBIOSa andfor PTOISBIOBb)
`2)
`Paper No(s)lMail Date
`US. Patent and Trademark Office
`
`3) |:| Interview Summary (PTO—413)
`Paper No(s)/Mail Date
`4) D Other'
`
`PTOL—325 (Rev. 11-13)
`
`Office Action Summary
`
`Part of Paper NoJMail Date 20171212
`
`

`

`Application/Control Number: 15/789,862
`Art Unit: 1674
`
`Page 2
`
`DETAILED ACTION
`
`Notice ofPre-AIA 0r AIA Status
`
`The present application is being examined under the pre-AIA first to invent provisions.
`
`Remarks
`
`Claims 66-29, filed 10/23/2017 are currently pending and are under examination.
`
`Priority
`
`Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or
`
`under 35 U.S.C. 120, 121, 365(0), or 386(c) is acknowledged. Applicant has not complied With
`
`one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e)
`
`or under 35 U.S.C. 120, 121, 365(c), or 386(c) as follows:
`
`The later-filed application must be an application for a patent for an invention Which is
`
`also disclosed in the prior application (the parent or original nonprovisional application or
`
`provisional application). The disclosure of the invention in the parent application and in the later-
`
`filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the
`
`first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco
`
`Products, Inc. V. Performance Contracting, Inc, 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994)
`
`The disclosure of the prior-filed application, Application No. 61/108416, fails to provide
`
`adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35
`
`U.S.C. 112, first paragraph for one or more claims of this application. Application 61/108416
`
`

`

`Application/Control Number: 15/789,862
`Art Unit: 1674
`
`Page 3
`
`does not support the instantly claimed SEQ ID NO:631. Therefore, the instant claims are
`
`granted priority to Application No. 12/605275, filed 10/23/2009.
`
`Claim Rejections - 35 USC § 102
`
`In the event the determination of the status of the application as subject to AIA 35 U.S.C.
`
`102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the
`
`statutory basis for the rejection will not be considered a new ground of rej ection if the prior art
`
`relied upon, and the rationale supporting the rejection, would be the same under either status.
`
`The following is a quotation of the appropriate paragraphs of pre-AIA 35 U.S.C. 102 that
`
`form the basis for the rejections under this section made in this Office action:
`
`A person shall be entitled to a patent unless —
`
`(e) the invention was described in (1) an application for patent, published under section 122(b), by
`another filed in the United States before the invention by the applicant for patent or (2) a patent granted
`on an application for patent by another filed in the United States before the invention by the applicant
`for patent, except that an international application filed under the treaty defined in section 351(3) shall
`have the effects for purposes of this subsection of an application filed in the United States only if the
`international application designated the United States and was published under Article 21(2) of such
`treaty in the English language.
`
`Claim(s) 66-69 are rejected under pre-AIA 35 U.S.C. 102(e) as being anticipated by
`
`Popplewell, et al. (US. Patent 8084601, of record, cited on IDS).
`
`Popplewell teaches a phosphorodiamidate morpholino oligonucleotide (PMO) having
`
`SEQ ID N0222, which comprises 29 consecutive nucleotides (underlined) of the instantly
`
`claimed SEQ ID N0:631 as shown:
`
`SEQ ID NO:22
`
`SEQ ID NO: 631
`
`
`5'-CTGTTGCCTCCGGTTCTGAAGGTGTTCTTG-3’
`
`
`
`
`
`5’ —TGTTGCCTCCGGTTCTGAAGGTGTTCTTGT—3'
`
`

`

`Application/Control Number: 15/789,862
`Art Unit: 1674
`
`Page 4
`
`Popplewell teaches such PMOs formulated in pharmaceutical compositions for treating DMD by
`
`inducing skipping of exon 53 of the dystrophin gene. See at least column 7, lines 35-40 and
`
`columns 10—1 1. Therefore, the instant claims 66-69 are anticipated by Popplewell, et al.
`
`Claim Rejections - 35 USC § 103
`
`In the event the determination of the status of the application as subject to AIA 35 U.S.C.
`
`102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the
`
`statutory basis for the rejection will not be considered a new ground of rej ection if the prior art
`
`relied upon, and the rationale supporting the rejection, would be the same under either status.
`
`The following is a quotation of pre-AIA 35 U.S.C. 103(a) which forms the basis for all
`
`obviousness rejections set forth in this Office action:
`
`(a) A patent may not be obtained though the invention is not identically disclosed or described as set
`forth in section 102, if the differences between the subject matter sought to be patented and the prior art
`are such that the subject matter as a whole would have been obvious at the time the invention was made
`to a person having ordinary skill in the art to which said subject matter pertains. Patentability shall not
`be negatived by the manner in which the invention was made.
`
`This application currently names joint inventors. In considering patentability of the
`
`claims under pre-AIA 35 U.S.C. 103(a), the examiner presumes that the subject matter of the
`
`various claims was commonly owned at the time any inventions covered therein were made
`
`absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to
`
`point out the inventor and invention dates of each claim that was not commonly owned at the
`
`time a later invention was made in order for the examiner to consider the applicability of pre-
`
`AIA 35 U.S.C. 103(c) and potential pre-AIA 35 U.S.C. 102(6), (f) or (g) prior art under pre-AIA
`
`35 U.S.C. 103(a).
`
`Claim 66-69 is/are rejected under pre-AIA 35 U.S.C. 103(a) as being unpatentable over
`
`Popplewell, et al. (U.S. Patent 8084601, of record, cited on IDS).
`
`

`

`Application/Control Number: 15/789,862
`Art Unit: 1674
`
`Page 5
`
`Popplewell teaches a phosphorodiamidate morpholino oligonucleotide (PMO) having
`
`SEQ ID N0222, which comprises 29 consecutive nucleotides (underlined) of the instantly
`
`claimed SEQ ID NO:631 as shown:
`
`SEQ ID NO:22
`
`SEQ ID NO: 631
`
`
`
`
`
`5'—C'..'GT'..'GCCTCCGGT'..'CL'GAAGGTGTTCTTG—3’
`
`
`
`
`
`
`5’ —'..'GT'..'GCCTCCGGT'..'CL'GAAGGTGTTCTTGT—3’
`
`Popplewell teaches such PMOs formulated in pharmaceutical compositions for treating DMD by
`
`inducing skipping of exon 53 of the dystrophin gene. See at least column 7, lines 35-40 and
`
`columns 10-11. Therefore, the instant claims 66-69 are unpatentable over Popplewell, et al.
`
`Conclusion
`
`Any inquiry concerning this communication or earlier communications from the
`
`examiner should be directed to JENNIFER PITRAK MCDONALD whose telephone number is
`
`(571)270-3061. The examiner can normally be reached on M-F, 8:30-5:00.
`
`Examiner interviews are available via telephone, in-person, and video conferencing using
`
`a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is
`
`encouraged to use the USPTO Automated Interview Request (AIR) at
`
`http://www.uspto.gov/interviewpractice.
`
`If attempts to reach the examiner by telephone are unsuccessful, the examiner’s
`
`supervisor, Ram Shukla can be reached on 571-2 72-0735. The fax phone number for the
`
`organization where this application or proceeding is assigned is 571-273-8300.
`
`Information regarding the status of an application may be obtained from the Patent
`
`Application Information Retrieval (PAIR) system. Status information for published applications
`
`may be obtained from either Private PAIR or Public PAIR. Status information for unpublished
`
`

`

`Application/Control Number: 15/789,862
`Art Unit: 1674
`
`Page 6
`
`applications is available through Private PAIR only. For more information about the PAIR
`
`system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR
`
`system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would
`
`like assistance from a USPTO Customer Service Representative or access to the automated
`
`information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
`
`JENNIFER PITRAK MCDONALD
`
`Primary Examiner
`Art Unit 1674
`
`/Jennifer Pitrak McDonald/
`
`Primary Examiner, Art Unit 1674
`
`