UNITED STATES PATENT AND TRADEMARK OFFICE
`
`
`
`UNITED STATES DEPARTMENT OF COMMERCE
`United States Patent and Trademark Office
`Address: COMMISSIONER FOR PATENTS
`PO. Box 1450
`Alexandria, Virginia 2231371450
`www.uspto.gov
`
`15/789,862
`
`10/20/2017
`
`Peter SAZANI
`
`414000100013
`
`6698
`
`STERNE, KESSLER, GOLDSTEIN & FOX P.L.L.C.
`1 100 NEW YORK AVENUE NHW
`WASHINGTON, DISTRICT OF COLUMBIA 20005
`UNITED STATES OF AMERICA
`
`MCDONALD. JENNIFER SUE PITRAK
`
`1674
`
`MAE DATE
`
`03/28/2018
`
`PAPER NUMBER
`
`DELIVERY MODE
`
`PAPER
`
`Please find below and/or attached an Office communication concerning this application or proceeding.
`
`The time period for reply, if any, is set in the attached communication.
`
`PTOL-90A (Rev. 04/07)
`
`

`

`Off/09 A0170” Summary
`
`Application No.
`15/789,862
`Examiner
`JENNIFER P MCDONALD
`
`Applicant(s)
`SAZANI et al.
`Art Unit
`1674
`
`AIA Status
`No
`
`- The MAILING DA TE of this communication appears on the cover sheet wit/7 the correspondence address -
`Period for Reply
`
`A SHORTENED STATUTORY PERIOD FOR REPLY IS SET TO EXPIRE g MONTHS FROM THE MAILING
`DATE OF THIS COMMUNICATION.
`Extensions of time may be available under the provisions of 37 CFR 1.136(a). In no event, however, may a reply be timely filed
`after SIX (6) MONTHS from the mailing date of this communication.
`|f NO period for reply is specified above, the maximum statutory period will apply and will expire SIX (6) MONTHS from the mailing date of this communication.
`-
`- Failure to reply within the set or extended period for reply will, by statute, cause the application to become ABANDONED (35 U.S.C. § 133).
`Any reply received by the Office later than three months after the mailing date of this communication, even if timely filed, may reduce any
`earned patent term adjustment. See 37 CFR 1.704(b).
`
`Status
`
`1). Responsive to communication(s) filed on 09 March 2018.
`[:1 A declaration(s)/affidavit(s) under 37 CFR 1.130(b) was/were filed on
`
`2a)D This action is FINAL.
`
`2b)
`
`This action is non-final.
`
`3)[:] An election was made by the applicant in response to a restriction requirement set forth during the interview on
`; the restriction requirement and election have been incorporated into this action.
`
`4)[:] Since this application is in condition for allowance except for formal matters, prosecution as to the merits is
`closed in accordance with the practice under Expat/7e Quay/e, 1935 CD. 11, 453 O.G. 213.
`
`Disposition of Claims*
`5)
`Claim(s)
`
`66—67 is/are pending in the application.
`
`5a) Of the above claim(s)
`
`is/are withdrawn from consideration.
`
`E] Claim(s)
`
`is/are allowed.
`
`Claim(s) 66—67 is/are rejected.
`
`[:1 Claim(s)
`
`is/are objected to.
`
`) ) ) )
`
`6 7
`
`8
`
`
`
`are subject to restriction and/or election requirement
`[j Claim(s)
`9
`* If any claims have been determined aflowabte. you may be eligible to benefit from the Patent Prosecution Highway program at a
`
`participating intellectual property office for the corresponding application. For more information, please see
`
`http://www.uspto.gov/patents/init events/pph/index.jsp or send an inquiry to PPeredback@uspto.gov.
`
`Application Papers
`10)[:] The specification is objected to by the Examiner.
`
`11). The drawing(s) filed on 20 October 2017 is/are: a)[:] accepted or b). objected to by the Examiner.
`
`Applicant may not request that any objection to the drawing(s) be held in abeyance. See 37 CFR 1.85(a).
`Replacement drawing sheet(s) including the correction is required if the drawing(s) is objected to. See 37 CFR 1.121 (d).
`
`Priority under 35 U.S.C. § 119
`12)[:] Acknowledgment is made of a claim for foreign priority under 35 U.S.C. § 119(a)-(d) or (f).
`Certified copies:
`
`a)I:I All
`
`b)D Some”
`
`C)D None of the:
`
`1.[:]
`
`Certified copies of the priority documents have been received.
`
`2.[:]
`
`Certified copies of the priority documents have been received in Application No.
`
`3:] Copies of the certified copies of the priority documents have been received in this National Stage
`application from the International Bureau (PCT Rule 17.2(a)).
`
`** See the attached detailed Office action for a list of the certified copies not received.
`
`Attachment(s)
`
`1) C] Notice of References Cited (PTO-892)
`
`2) E] Information Disclosure Statement(s) (PTO/SB/08a and/or PTO/SB/08b)
`Paper No(s)/Mail Date_
`U.S. Patent and Trademark Office
`
`3) C] Interview Summary (PTO-413)
`Paper No(s)/Mail Date
`4) CI Other-
`
`PTOL-326 (Rev. 11-13)
`
`Office Action Summary
`
`Part of Paper No./Mai| Date 20180326
`
`

`

`Application/Control Number: 15/789,862
`Art Unit: 1674
`
`Page 2
`
`DETAILED ACTION
`
`Notice ofPre-AIA 0r AIA Status
`
`The present application is being examined under the pre—AIA first to invent provisions.
`
`Remarks
`
`The amendments and remarks filed on 03/09/2018 have been entered and considered.
`
`The text of those sections of Title 35, U.S. Code not included in this action can be found in a
`
`prior Office action. The rejections and/or objections presented herein are the only rejections
`
`and/or objections currently outstanding. Any previously presented objections or rejections that
`
`are not presented in this Office Action are withdrawn.
`
`Claims 1—65 were originally filed in the instant application on 10/20/2017. The claims
`
`were amended on 10/23/2017 such that claims 1—65 were canceled and new claims 66—69 were
`
`added. Claims 68 and 69 were canceled in the 03/09/2018 amendment. Claims 66 and 67 are
`
`currently pending and are under examination.
`
`Notice to Comply with 37 CFR §§ 1.821—1.825
`
`This application contains sequence disclosures that are encompassed by the definitions
`
`for nucleotide and/or amino acid sequences set forth in 37 CFR. § 1.821(a)(1) and (a)(2).
`
`However, this application fails to comply with the requirements of 37 CFR. §§ 1821—1825 for
`
`the following reason(s): each of Figures 2D, 3B, and 4B depicts/recites nucleotide sequences that
`
`are not referenced by a corresponding sequence identifier ("SEQ ID NO:_").
`
`To be considered fully responsive, any reply to this action must address these
`
`

`

`Application/Control Number: 15/789,862
`Art Unit: 1674
`
`Page 3
`
`deficiencies, as this requirement will not be held in abeyance.
`
`Drawings
`
`The drawings are objected to because Figures 2D, 3B, and 4B depict nucleotide
`
`sequences without reference to such sequences with corresponding sequence identifiers. This
`
`objection may be obviated by amending the “Brief Description of the Drawings” section of the
`
`specification to recite the sequence identifiers for the sequences depicted. Alternatively,
`
`corrected drawing sheets may be submitted. Corrected drawing sheets should comply with 37
`
`CFR 1.121(d). Any amended replacement drawing sheet should include all of the figures
`
`appearing on the immediate prior version of the sheet, even if only one figure is being amended.
`
`The figure or figure number of an amended drawing should not be labeled as “amended.” If a
`
`drawing figure is to be canceled, the appropriate figure must be removed from the replacement
`
`sheet, and where necessary, the remaining figures must be renumbered and appropriate changes
`
`made to the brief description of the several views of the drawings for consistency. Additional
`
`replacement sheets may be necessary to show the renumbering of the remaining figures. Each
`
`drawing sheet submitted after the filing date of an application must be labeled in the top margin
`
`as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are
`
`not accepted by the examiner, the applicant will be notified and informed of any required
`
`corrective action in the next Office action. The objection to the drawings will not be held in
`
`abeyance.
`
`Applicant’s claim for the benefit of a prior—filed application under 35 U.S.C. ll9(e) or
`
`Priority
`
`

`

`Application/Control Number: 15/789,862
`Art Unit: 1674
`
`Page 4
`
`under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with
`
`one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e)
`
`or under 35 U.S.C. 120, 121, 365(c), or 386(c) as follows:
`
`The later—filed application must be an application for a patent for an invention which is
`
`also disclosed in the prior application (the parent or original nonprovisional application or
`
`provisional application). The disclosure of the invention in the parent application and in the later—
`
`filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the
`
`first paragraph of pre—AIA 35 U.S.C. 112, except for the best mode requirement. See Transco
`
`Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994)
`
`The disclosure of the prior—filed application, Application Nos. 15/349778, 14/523610,
`
`12/605276, and 61/ 108416, fail to provide adequate support or enablement in the manner
`
`provided by 35 U.S.C. 112(a) or pre—AIA 35 U.S.C. 112, first paragraph for one or more claims
`
`of this application. The instant claims 66 and 67 are directed to a broader genus of antisense
`
`oligonucleotides than that for which support is provided in any of Application Nos. 15/349778,
`
`14/523610, 12/605276, and 61/108416.
`
`The instant claims 66 and 67 are afforded the benefit of priority only to the instant
`
`filing date, which is 10/20/2017.
`
`Claim Rejections - 35 US C § 112 — Written Description
`
`The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
`
`(a) IN GENERAL.7The specification shall contain a written description of the invention,
`and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to
`enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to
`make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor
`of carrying out the invention.
`
`The following is a quotation of the first paragraph of pre—AIA 35 U.S.C. 112:
`
`

`

`Application/Control Number: 15/789,862
`Art Unit: 1674
`
`Page 5
`
`The specification shall contain a written description of the invention, and of the manner and
`process of making and using it, in such full, clear, concise, and exact terms as to enable any person
`skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the
`same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
`
`Claims 66 and 67 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre—AIA), first
`
`paragraph, as failing to comply with the written description requirement. The claim(s) contains
`
`subject matter which was not described in the specification in such a way as to reasonably
`
`convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre—AIA the
`
`inventor(s), at the time the application was filed, had possession of the claimed invention. The
`
`claims are directed to new matter.
`
`The amendments to the claims filed on 10/23/2017 canceled all of claims 1—65 and added
`
`claims 66—69. Applicant indicated that no new matter has been added by said amendment (see
`
`remarks filed 10/23/2017). However, a thorough search of the instant specification, priority
`
`documents, and claims has not revealed support for claims 66—29, filed on 10/23/2017.
`
`Therefore, the instant claims 66 and 67 are deemed directed to new matter.
`
`Claim Rejections - 35 US C § 102
`
`In the event the determination of the status of the application as subject to AIA 35 U.S.C.
`
`102 and 103 (or as subject to pre—AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the
`
`statutory basis for the rejection will not be considered a new ground of rejection if the prior art
`
`relied upon, and the rationale supporting the rejection, would be the same under either status.
`
`The following is a quotation of the appropriate paragraphs of pre—AIA 35 U.S.C. 102 that
`
`form the basis for the rejections under this section made in this Office action:
`
`A person shall be entitled to a patent unless ,
`(a) the invention was known or used by others in this country, or patented or described in a printed
`publication in this or a foreign country, before the invention thereof by the applicant for a patent.
`
`

`

`Application/Control Number: 15/789,862
`Art Unit: 1674
`
`Page 6
`
`(b) the invention was patented or described in a printed publication in this or a foreign country or in
`public use or on sale in this country, more than one year prior to the date of application for patent in the
`United States.
`
`(e) the invention was described in (1) an application for patent, published under section 122(b), by
`another filed in the United States before the invention by the applicant for patent or (2) a patent granted
`on an application for patent by another filed in the United States before the invention by the applicant
`for patent, except that an international application filed under the treaty defined in section 351(a) shall
`have the effects for purposes of this subsection of an application filed in the United States only if the
`international application designated the United States and was published under Article 21(2) of such
`treaty in the English language.
`
`Watanabe= et al.
`
`Claim(s) 66 and 67 are rejected under pre-AIA 35 U.S.C. 102(a), (b), and (e) as
`
`being anticipated by Watanabe, et al. (US. Patent 9079934, issued 14 July 2015;
`
`U82013/0211062; W02012/029986) (cited 0n IDS) (“Watanabe”).
`
`The instant claim 66 is directed to a phosphorodiamidate morpholino oligomer (PMO)
`
`that is exactly 21 nucleotides in length and comprises 21 consecutive bases of the instant SEQ ID
`
`NO:631. The instant claim 67 is directed to a pharmaceutical composition comprising the PMO
`
`of claim 66.
`
`Citing to US. Patent 9079934, Watanabe claims and describes a PMO consisting of SEQ
`
`ID NO:35 and pharmaceutical compositions thereof (claims; column 4, lines 33—48). Watanabe’s
`
`SEQ ID NO:35 consists of 21 consecutive nucleotides of the instant SEQ ID NO:631 as shown:
`
`
`
`
`
`Watanabe SfiQ
`
`
`
`
`Instant SfiQ
`
`5’-CCTCCGGTTCTGAAGGTGTTC-3’
`5’ -TGTTGCCTCCGGTTCTGAAGGTGTTCTTGT-3’
`
`
`D NO:35
`
`3 NO: 631
`
`Therefore, Watanabe anticipates the instant claims 66 and 67.
`
`Bestwick= et al.
`
`Claim(s) 66 and 67 are rejected under pre-AIA 35 U.S.C. 102(a), (b), and (e) as
`
`being anticipated by Bestwick, et al. (US 2016/0040162; WO/2014/153240) (cited 0n IDS)
`
`(“Bestwick”).
`
`

`

`Application/Control Number: 15/789,862
`Art Unit: 1674
`
`Page 7
`
`Citing to US. 2016/0040162, Bestwick teaches a PMO having SEQ ID NO:15, which is
`
`5’—CCTCCGGTTCTGAAGGTGTTC—3’, and pharmaceutical compositions thereof (see at least
`
`paragraphs [0017], [0283]; figure 1). Therefore, Bestwick anticipates the instant claims 66 and
`
`67.
`
`Nonstatutory Double Patenting
`
`The nonstatutory double patenting rejection is based on a judicially created doctrine
`
`grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or
`
`improper timewise extension of the “right to exclude” granted by a patent and to prevent possible
`
`harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where
`
`the conflicting claims are not identical, but at least one examined application claim is not
`
`patentably distinct from the reference claim(s) because the examined application claim is either
`
`anticipated by, or would have been obvious over, the reference claim(s). See, e. g., In re Berg,
`
`140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d
`
`2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van
`
`Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619
`
`(CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
`
`A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may
`
`be used to overcome an actual or provisional rejection based on nonstatutory double patenting
`
`provided the reference application or patent either is shown to be commonly owned with the
`
`examined application, or claims an invention made as a result of activities undertaken within the
`
`scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination
`
`under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP
`
`

`

`Application/Control Number: 15/789,862
`Art Unit: 1674
`
`Page 8
`
`§§ 706.02(l)(l) — 706.02(l)(3) for applications not subject to examination under the first inventor
`
`to file provisions of the AIA. A terminal disclaimer must be signed in compliance with 37 CFR
`
`l.32l(b).
`
`The USPTO Internet website contains terminal disclaimer forms which may be used.
`
`Please visit www.uspto.gov/patent/patents—forms. The filing date of the application in which the
`
`form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA/25, or
`
`PTO/AIA/26) should be used. A web—based eTerminal Disclaimer may be filled out completely
`
`online using web—screens. An eTerminal Disclaimer that meets all requirements is auto—
`
`processed and approved immediately upon submission. For more information about eTerminal
`
`Disclaimers, refer to new
`
`15/420823
`
`Claims 66 and 67 are provisionally rejected on the ground of nonstatutory double
`
`patenting as being unpatentable over claims l—8, 10, ll, and 24 of copending Application No.
`
`15/420,823. Although the conflicting claims are not identical they are not patentably distinct
`
`from each other because the instant claims are encompassed and rendered obvious by the ‘823
`
`claims that read on a PMO antisense oligonucleotide of the 2l—mer sequence that is identical to
`
`the instantly claimed PMO nucleotide sequence as evidenced by the fact that the
`
`oligonucleotides of 20—50 nucleotides in length comprising at least 20 nucleotides of SEQ ID
`
`NO:1 encompass the instantly claimed 2l—mer sequence. Note that SEQ ID NO:1 of the '823
`
`claims comprise the entire 2l—mer claimed in the instant case.
`
`15/417401
`
`Claims 66 and 67 are provisionally rejected on the ground of nonstatutory double
`
`patenting as being unpatentable over claims 1, 7, 8, 10, ll, l2, 19, 24, 25, 28, 29, and 39 of
`
`

`

`Application/Control Number: 15/789,862
`Art Unit: 1674
`
`Page 9
`
`copending Application No. 15/417401. Although the conflicting claims are not identical they are
`
`not patentably distinct from each other because the instant claims are encompassed and rendered
`
`obvious by the ‘401 claims that read on a PMO antisense oligonucleotide of the 21—mer sequence
`
`that is identical to the instantly claimed PMO nucleotide sequence as evidenced by the fact that
`
`the oligonucleotides of 20—50 nucleotides in length comprising at least 20 nucleotides of SEQ ID
`
`NO:1 encompass the instantly claimed 21—mer sequence. Note that SEQ ID NO:1 of the '401
`
`claims comprise the entire 21—mer claimed in the instant case.
`
`Conclusion
`
`Any inquiry concerning this communication or earlier communications from the
`examiner should be directed to JENNIFER PITRAK MCDONALD whose telephone number is
`(571)270—3061. The examiner can normally be reached on M—F, 8:30—5:00.
`Examiner interviews are available via telephone, in—person, and video conferencing using
`a USPTO supplied web—based collaboration tool. To schedule an interview, applicant is
`encouraged to use the USPTO Automated Interview Request (AIR) at
`http://www.uspto.gov/interviewpractice.
`If attempts to reach the examiner by telephone are unsuccessful, the examiner’s
`supervisor, Ram Shukla can be reached on 571—272—0735. The fax phone number for the
`organization where this application or proceeding is assigned is 571—273—8300.
`Information regarding the status of an application may be obtained from the Patent
`Application Information Retrieval (PAIR) system. Status information for published applications
`may be obtained from either Private PAIR or Public PAIR. Status information for unpublished
`applications is available through Private PAIR only. For more information about the PAIR
`system, see http://pair—direct.uspto.gov. Should you have questions on access to the Private PAIR
`system, contact the Electronic Business Center (EBC) at 866—217—9197 (toll—free). If you would
`like assistance from a USPTO Customer Service Representative or access to the automated
`information system, call 800—786—9199 (IN USA OR CANADA) or 571—272—1000.
`
`JENNIFER PITRAK MCDONALD
`
`Primary Examiner
`Art Unit 1674
`
`/Jennifer Pitrak McDonald/
`
`Primary Examiner, Art Unit 1674
`
`