`
`Docket No: AVN-OO9DVCN7
`
`AMENDMENTS TO THE CLAIMS
`
`1-65. (Cancelled)
`
`66. (New)
`
`An antisense oligonucleotide of formula (I):
`
`Mfr
`
`0=P—N(CH3)2
`
`O
`
`N
`
`o=P—N(CH3)2
`
`or a pharrnaceutically acceptable salt thereof, wherein:
`
`Z is 19;
`
`R is H or 7C(O)CH3, and
`
`each B is adenine, guanine, thymine, or cytosine, which taken together form a base
`
`sequence that is 100% complementary to 21 consecutive bases of exon 53 of the human
`
`dystrophin pre-mRNA, wherein the base sequence comprises 21 consecutive bases of
`
`TGTTGCCTCCGGTTCTGAAGGTGTTCTTGT (SEQ ID NO: 631), and wherein the
`
`antisense oligonucleotide induces exon 53 skipping.
`
`
`
`Application No: 15/789,862
`
`Docket No: AVN—OO9DVCN7
`
`67. (New)
`
`A pharmaceutical composition comprising an anti sense oligonucleotide of
`
`formula (I):
`
`N
`
`O=P—N(CH3)2
`O
`
`(D
`
`0
`
`B
`
`TN
`
`O——P—N(CH3)2
`
`or a pharmaceutically acceptable salt thereof, wherein:
`
`Z is 19;
`
`R is H or —C(O)CH3, and
`
`each B is adenine, guanine, thymine, or cytosine, which taken together form a base
`
`sequence that is 100% complementary to 21 consecutive bases of exon 53 of the human
`
`dystrophin pre-mRNA, wherein the base sequence comprises 21 consecutive bases of
`
`TGTTGCCTCCGGTTCTGAAGGTGTTCTTGT (SEQ ID NO: 631), and wherein the
`
`antisense oligonucleotide induces exon 53 skipping.
`
`
`
`Application No: 15/789,862
`
`Docket No: AVN—OO9DVCN7
`
`68. (New)
`
`An antisense oligonucleotide of formula (I):
`
`“if
`
`0=P—N(CH3)2
`O
`
`B
`
`(I)
`
`N
`
`O—P—N(CH3)2
`
`or a pharrnaceutically acceptable salt thereof, wherein:
`
`Z is 23;
`
`R is H or —C(O)CH3, and
`
`each B is adenine, guanine, thymine, or cytosine, which taken together form a base
`
`sequence that is 100% complementary to 25 consecutive bases of exon 53 of the human
`
`dystrophin pre-mRNA, wherein the base sequence comprises 25 consecutive bases of
`
`TGTTGCCTCCGGTTCTGAAGGTGTTCTTGT (SEQ ID NO: 631), and wherein the
`
`antisense oligonucleotide induces exon 53 skipping.
`
`
`
`Application No: 15/789,862
`
`Docket No: AVN—OO9DVCN7
`
`69. (New)
`
`A pharmaceutical composition comprising an anti sense oligonucleotide of
`
`formula (I):
`
`N
`
`0=P—N(CH3)2
`
`0
`
`B
`
`(I)
`
`N
`
`0—P—N(CH3)2
`
`or a pharm aceutically acceptable salt thereof, wherein:
`
`Z is 23;
`
`R is H or —C(O)CH3, and
`
`each B is adenine, guanine, thymine, or cytosine, which taken together form a base
`
`sequence that is 100% complementary to 25 consecutive bases of exon 53 of the human
`
`dystrophin pre-mRNA, wherein the base sequence comprises 25 consecutive bases of
`
`TGTTGCCTCCGGTTCTGAAGGTGTTCTTGT (SEQ ID NO: 631), and wherein the
`
`antisense oligonucleotide induces exon 53 skipping.
`
`U1
`
`

Accessing this document will incur an additional charge of $.
After purchase, you can access this document again without charge.
Accept $ ChargeStill Working On It
This document is taking longer than usual to download. This can happen if we need to contact the court directly to obtain the document and their servers are running slowly.
Give it another minute or two to complete, and then try the refresh button.
A few More Minutes ... Still Working
It can take up to 5 minutes for us to download a document if the court servers are running slowly.
Thank you for your continued patience.

This document could not be displayed.
We could not find this document within its docket. Please go back to the docket page and check the link. If that does not work, go back to the docket and refresh it to pull the newest information.

Your account does not support viewing this document.
You need a Paid Account to view this document. Click here to change your account type.

Your account does not support viewing this document.
Set your membership
status to view this document.
With a Docket Alarm membership, you'll
get a whole lot more, including:
- Up-to-date information for this case.
- Email alerts whenever there is an update.
- Full text search for other cases.
- Get email alerts whenever a new case matches your search.

One Moment Please
The filing “” is large (MB) and is being downloaded.
Please refresh this page in a few minutes to see if the filing has been downloaded. The filing will also be emailed to you when the download completes.

Your document is on its way!
If you do not receive the document in five minutes, contact support at support@docketalarm.com.

Sealed Document
We are unable to display this document, it may be under a court ordered seal.
If you have proper credentials to access the file, you may proceed directly to the court's system using your government issued username and password.
Access Government Site