`
`
`
`UNITED STATES DEPARTMENT OF COMMERCE
`United States Patent and Trademark Office
`Address: COMMISSIONER FOR PATENTS
`PO. Box 1450
`Alexandria, Virginia 2231371450
`www.uspto.gov
`
`15/789,862
`
`10/20/2017
`
`Peter SAZANI
`
`414000100013
`
`6698
`
`STERNE, KESSLER, GOLDSTEIN & FOX P.L.L.C.
`1 100 NEW YORK AVENUE NHW
`WASHINGTON, DISTRICT OF COLUMBIA 20005
`UNITED STATES OF AMERICA
`
`MCDONALD. JENNIFER SUE PITRAK
`
`1674
`
`MAE DATE
`
`03/28/2018
`
`PAPER NUMBER
`
`DELIVERY MODE
`
`PAPER
`
`Please find below and/or attached an Office communication concerning this application or proceeding.
`
`The time period for reply, if any, is set in the attached communication.
`
`PTOL-90A (Rev. 04/07)
`
`
`
`Off/09 A0170” Summary
`
`Application No.
`15/789,862
`Examiner
`JENNIFER P MCDONALD
`
`Applicant(s)
`SAZANI et al.
`Art Unit
`1674
`
`AIA Status
`No
`
`- The MAILING DA TE of this communication appears on the cover sheet wit/7 the correspondence address -
`Period for Reply
`
`A SHORTENED STATUTORY PERIOD FOR REPLY IS SET TO EXPIRE g MONTHS FROM THE MAILING
`DATE OF THIS COMMUNICATION.
`Extensions of time may be available under the provisions of 37 CFR 1.136(a). In no event, however, may a reply be timely filed
`after SIX (6) MONTHS from the mailing date of this communication.
`|f NO period for reply is specified above, the maximum statutory period will apply and will expire SIX (6) MONTHS from the mailing date of this communication.
`-
`- Failure to reply within the set or extended period for reply will, by statute, cause the application to become ABANDONED (35 U.S.C. § 133).
`Any reply received by the Office later than three months after the mailing date of this communication, even if timely filed, may reduce any
`earned patent term adjustment. See 37 CFR 1.704(b).
`
`Status
`
`1). Responsive to communication(s) filed on 09 March 2018.
`[:1 A declaration(s)/affidavit(s) under 37 CFR 1.130(b) was/were filed on
`
`2a)D This action is FINAL.
`
`2b)
`
`This action is non-final.
`
`3)[:] An election was made by the applicant in response to a restriction requirement set forth during the interview on
`; the restriction requirement and election have been incorporated into this action.
`
`4)[:] Since this application is in condition for allowance except for formal matters, prosecution as to the merits is
`closed in accordance with the practice under Expat/7e Quay/e, 1935 CD. 11, 453 O.G. 213.
`
`Disposition of Claims*
`5)
`Claim(s)
`
`66—67 is/are pending in the application.
`
`5a) Of the above claim(s)
`
`is/are withdrawn from consideration.
`
`E] Claim(s)
`
`is/are allowed.
`
`Claim(s) 66—67 is/are rejected.
`
`[:1 Claim(s)
`
`is/are objected to.
`
`) ) ) )
`
`6 7
`
`8
`
`
`
`are subject to restriction and/or election requirement
`[j Claim(s)
`9
`* If any claims have been determined aflowabte. you may be eligible to benefit from the Patent Prosecution Highway program at a
`
`participating intellectual property office for the corresponding application. For more information, please see
`
`http://www.uspto.gov/patents/init events/pph/index.jsp or send an inquiry to PPeredback@uspto.gov.
`
`Application Papers
`10)[:] The specification is objected to by the Examiner.
`
`11). The drawing(s) filed on 20 October 2017 is/are: a)[:] accepted or b). objected to by the Examiner.
`
`Applicant may not request that any objection to the drawing(s) be held in abeyance. See 37 CFR 1.85(a).
`Replacement drawing sheet(s) including the correction is required if the drawing(s) is objected to. See 37 CFR 1.121 (d).
`
`Priority under 35 U.S.C. § 119
`12)[:] Acknowledgment is made of a claim for foreign priority under 35 U.S.C. § 119(a)-(d) or (f).
`Certified copies:
`
`a)I:I All
`
`b)D Some”
`
`C)D None of the:
`
`1.[:]
`
`Certified copies of the priority documents have been received.
`
`2.[:]
`
`Certified copies of the priority documents have been received in Application No.
`
`3:] Copies of the certified copies of the priority documents have been received in this National Stage
`application from the International Bureau (PCT Rule 17.2(a)).
`
`** See the attached detailed Office action for a list of the certified copies not received.
`
`Attachment(s)
`
`1) C] Notice of References Cited (PTO-892)
`
`2) E] Information Disclosure Statement(s) (PTO/SB/08a and/or PTO/SB/08b)
`Paper No(s)/Mail Date_
`U.S. Patent and Trademark Office
`
`3) C] Interview Summary (PTO-413)
`Paper No(s)/Mail Date
`4) CI Other-
`
`PTOL-326 (Rev. 11-13)
`
`Office Action Summary
`
`Part of Paper No./Mai| Date 20180326
`
`
`
`Application/Control Number: 15/789,862
`Art Unit: 1674
`
`Page 2
`
`DETAILED ACTION
`
`Notice ofPre-AIA 0r AIA Status
`
`The present application is being examined under the pre—AIA first to invent provisions.
`
`Remarks
`
`The amendments and remarks filed on 03/09/2018 have been entered and considered.
`
`The text of those sections of Title 35, U.S. Code not included in this action can be found in a
`
`prior Office action. The rejections and/or objections presented herein are the only rejections
`
`and/or objections currently outstanding. Any previously presented objections or rejections that
`
`are not presented in this Office Action are withdrawn.
`
`Claims 1—65 were originally filed in the instant application on 10/20/2017. The claims
`
`were amended on 10/23/2017 such that claims 1—65 were canceled and new claims 66—69 were
`
`added. Claims 68 and 69 were canceled in the 03/09/2018 amendment. Claims 66 and 67 are
`
`currently pending and are under examination.
`
`Notice to Comply with 37 CFR §§ 1.821—1.825
`
`This application contains sequence disclosures that are encompassed by the definitions
`
`for nucleotide and/or amino acid sequences set forth in 37 CFR. § 1.821(a)(1) and (a)(2).
`
`However, this application fails to comply with the requirements of 37 CFR. §§ 1821—1825 for
`
`the following reason(s): each of Figures 2D, 3B, and 4B depicts/recites nucleotide sequences that
`
`are not referenced by a corresponding sequence identifier ("SEQ ID NO:_").
`
`To be considered fully responsive, any reply to this action must address these
`
`
`
`Application/Control Number: 15/789,862
`Art Unit: 1674
`
`Page 3
`
`deficiencies, as this requirement will not be held in abeyance.
`
`Drawings
`
`The drawings are objected to because Figures 2D, 3B, and 4B depict nucleotide
`
`sequences without reference to such sequences with corresponding sequence identifiers. This
`
`objection may be obviated by amending the “Brief Description of the Drawings” section of the
`
`specification to recite the sequence identifiers for the sequences depicted. Alternatively,
`
`corrected drawing sheets may be submitted. Corrected drawing sheets should comply with 37
`
`CFR 1.121(d). Any amended replacement drawing sheet should include all of the figures
`
`appearing on the immediate prior version of the sheet, even if only one figure is being amended.
`
`The figure or figure number of an amended drawing should not be labeled as “amended.” If a
`
`drawing figure is to be canceled, the appropriate figure must be removed from the replacement
`
`sheet, and where necessary, the remaining figures must be renumbered and appropriate changes
`
`made to the brief description of the several views of the drawings for consistency. Additional
`
`replacement sheets may be necessary to show the renumbering of the remaining figures. Each
`
`drawing sheet submitted after the filing date of an application must be labeled in the top margin
`
`as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are
`
`not accepted by the examiner, the applicant will be notified and informed of any required
`
`corrective action in the next Office action. The objection to the drawings will not be held in
`
`abeyance.
`
`Applicant’s claim for the benefit of a prior—filed application under 35 U.S.C. ll9(e) or
`
`Priority
`
`
`
`Application/Control Number: 15/789,862
`Art Unit: 1674
`
`Page 4
`
`under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with
`
`one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e)
`
`or under 35 U.S.C. 120, 121, 365(c), or 386(c) as follows:
`
`The later—filed application must be an application for a patent for an invention which is
`
`also disclosed in the prior application (the parent or original nonprovisional application or
`
`provisional application). The disclosure of the invention in the parent application and in the later—
`
`filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the
`
`first paragraph of pre—AIA 35 U.S.C. 112, except for the best mode requirement. See Transco
`
`Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994)
`
`The disclosure of the prior—filed application, Application Nos. 15/349778, 14/523610,
`
`12/605276, and 61/ 108416, fail to provide adequate support or enablement in the manner
`
`provided by 35 U.S.C. 112(a) or pre—AIA 35 U.S.C. 112, first paragraph for one or more claims
`
`of this application. The instant claims 66 and 67 are directed to a broader genus of antisense
`
`oligonucleotides than that for which support is provided in any of Application Nos. 15/349778,
`
`14/523610, 12/605276, and 61/108416.
`
`The instant claims 66 and 67 are afforded the benefit of priority only to the instant
`
`filing date, which is 10/20/2017.
`
`Claim Rejections - 35 US C § 112 — Written Description
`
`The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
`
`(a) IN GENERAL.7The specification shall contain a written description of the invention,
`and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to
`enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to
`make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor
`of carrying out the invention.
`
`The following is a quotation of the first paragraph of pre—AIA 35 U.S.C. 112:
`
`
`
`Application/Control Number: 15/789,862
`Art Unit: 1674
`
`Page 5
`
`The specification shall contain a written description of the invention, and of the manner and
`process of making and using it, in such full, clear, concise, and exact terms as to enable any person
`skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the
`same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
`
`Claims 66 and 67 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre—AIA), first
`
`paragraph, as failing to comply with the written description requirement. The claim(s) contains
`
`subject matter which was not described in the specification in such a way as to reasonably
`
`convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre—AIA the
`
`inventor(s), at the time the application was filed, had possession of the claimed invention. The
`
`claims are directed to new matter.
`
`The amendments to the claims filed on 10/23/2017 canceled all of claims 1—65 and added
`
`claims 66—69. Applicant indicated that no new matter has been added by said amendment (see
`
`remarks filed 10/23/2017). However, a thorough search of the instant specification, priority
`
`documents, and claims has not revealed support for claims 66—29, filed on 10/23/2017.
`
`Therefore, the instant claims 66 and 67 are deemed directed to new matter.
`
`Claim Rejections - 35 US C § 102
`
`In the event the determination of the status of the application as subject to AIA 35 U.S.C.
`
`102 and 103 (or as subject to pre—AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the
`
`statutory basis for the rejection will not be considered a new ground of rejection if the prior art
`
`relied upon, and the rationale supporting the rejection, would be the same under either status.
`
`The following is a quotation of the appropriate paragraphs of pre—AIA 35 U.S.C. 102 that
`
`form the basis for the rejections under this section made in this Office action:
`
`A person shall be entitled to a patent unless ,
`(a) the invention was known or used by others in this country, or patented or described in a printed
`publication in this or a foreign country, before the invention thereof by the applicant for a patent.
`
`
`
`Application/Control Number: 15/789,862
`Art Unit: 1674
`
`Page 6
`
`(b) the invention was patented or described in a printed publication in this or a foreign country or in
`public use or on sale in this country, more than one year prior to the date of application for patent in the
`United States.
`
`(e) the invention was described in (1) an application for patent, published under section 122(b), by
`another filed in the United States before the invention by the applicant for patent or (2) a patent granted
`on an application for patent by another filed in the United States before the invention by the applicant
`for patent, except that an international application filed under the treaty defined in section 351(a) shall
`have the effects for purposes of this subsection of an application filed in the United States only if the
`international application designated the United States and was published under Article 21(2) of such
`treaty in the English language.
`
`Watanabe= et al.
`
`Claim(s) 66 and 67 are rejected under pre-AIA 35 U.S.C. 102(a), (b), and (e) as
`
`being anticipated by Watanabe, et al. (US. Patent 9079934, issued 14 July 2015;
`
`U82013/0211062; W02012/029986) (cited 0n IDS) (“Watanabe”).
`
`The instant claim 66 is directed to a phosphorodiamidate morpholino oligomer (PMO)
`
`that is exactly 21 nucleotides in length and comprises 21 consecutive bases of the instant SEQ ID
`
`NO:631. The instant claim 67 is directed to a pharmaceutical composition comprising the PMO
`
`of claim 66.
`
`Citing to US. Patent 9079934, Watanabe claims and describes a PMO consisting of SEQ
`
`ID NO:35 and pharmaceutical compositions thereof (claims; column 4, lines 33—48). Watanabe’s
`
`SEQ ID NO:35 consists of 21 consecutive nucleotides of the instant SEQ ID NO:631 as shown:
`
`
`
`
`
`Watanabe SfiQ
`
`
`
`
`Instant SfiQ
`
`5’-CCTCCGGTTCTGAAGGTGTTC-3’
`5’ -TGTTGCCTCCGGTTCTGAAGGTGTTCTTGT-3’
`
`
`D NO:35
`
`3 NO: 631
`
`Therefore, Watanabe anticipates the instant claims 66 and 67.
`
`Bestwick= et al.
`
`Claim(s) 66 and 67 are rejected under pre-AIA 35 U.S.C. 102(a), (b), and (e) as
`
`being anticipated by Bestwick, et al. (US 2016/0040162; WO/2014/153240) (cited 0n IDS)
`
`(“Bestwick”).
`
`
`
`Application/Control Number: 15/789,862
`Art Unit: 1674
`
`Page 7
`
`Citing to US. 2016/0040162, Bestwick teaches a PMO having SEQ ID NO:15, which is
`
`5’—CCTCCGGTTCTGAAGGTGTTC—3’, and pharmaceutical compositions thereof (see at least
`
`paragraphs [0017], [0283]; figure 1). Therefore, Bestwick anticipates the instant claims 66 and
`
`67.
`
`Nonstatutory Double Patenting
`
`The nonstatutory double patenting rejection is based on a judicially created doctrine
`
`grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or
`
`improper timewise extension of the “right to exclude” granted by a patent and to prevent possible
`
`harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where
`
`the conflicting claims are not identical, but at least one examined application claim is not
`
`patentably distinct from the reference claim(s) because the examined application claim is either
`
`anticipated by, or would have been obvious over, the reference claim(s). See, e. g., In re Berg,
`
`140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d
`
`2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van
`
`Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619
`
`(CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
`
`A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may
`
`be used to overcome an actual or provisional rejection based on nonstatutory double patenting
`
`provided the reference application or patent either is shown to be commonly owned with the
`
`examined application, or claims an invention made as a result of activities undertaken within the
`
`scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination
`
`under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP
`
`
`
`Application/Control Number: 15/789,862
`Art Unit: 1674
`
`Page 8
`
`§§ 706.02(l)(l) — 706.02(l)(3) for applications not subject to examination under the first inventor
`
`to file provisions of the AIA. A terminal disclaimer must be signed in compliance with 37 CFR
`
`l.32l(b).
`
`The USPTO Internet website contains terminal disclaimer forms which may be used.
`
`Please visit www.uspto.gov/patent/patents—forms. The filing date of the application in which the
`
`form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA/25, or
`
`PTO/AIA/26) should be used. A web—based eTerminal Disclaimer may be filled out completely
`
`online using web—screens. An eTerminal Disclaimer that meets all requirements is auto—
`
`processed and approved immediately upon submission. For more information about eTerminal
`
`Disclaimers, refer to new
`
`15/420823
`
`Claims 66 and 67 are provisionally rejected on the ground of nonstatutory double
`
`patenting as being unpatentable over claims l—8, 10, ll, and 24 of copending Application No.
`
`15/420,823. Although the conflicting claims are not identical they are not patentably distinct
`
`from each other because the instant claims are encompassed and rendered obvious by the ‘823
`
`claims that read on a PMO antisense oligonucleotide of the 2l—mer sequence that is identical to
`
`the instantly claimed PMO nucleotide sequence as evidenced by the fact that the
`
`oligonucleotides of 20—50 nucleotides in length comprising at least 20 nucleotides of SEQ ID
`
`NO:1 encompass the instantly claimed 2l—mer sequence. Note that SEQ ID NO:1 of the '823
`
`claims comprise the entire 2l—mer claimed in the instant case.
`
`15/417401
`
`Claims 66 and 67 are provisionally rejected on the ground of nonstatutory double
`
`patenting as being unpatentable over claims 1, 7, 8, 10, ll, l2, 19, 24, 25, 28, 29, and 39 of
`
`
`
`Application/Control Number: 15/789,862
`Art Unit: 1674
`
`Page 9
`
`copending Application No. 15/417401. Although the conflicting claims are not identical they are
`
`not patentably distinct from each other because the instant claims are encompassed and rendered
`
`obvious by the ‘401 claims that read on a PMO antisense oligonucleotide of the 21—mer sequence
`
`that is identical to the instantly claimed PMO nucleotide sequence as evidenced by the fact that
`
`the oligonucleotides of 20—50 nucleotides in length comprising at least 20 nucleotides of SEQ ID
`
`NO:1 encompass the instantly claimed 21—mer sequence. Note that SEQ ID NO:1 of the '401
`
`claims comprise the entire 21—mer claimed in the instant case.
`
`Conclusion
`
`Any inquiry concerning this communication or earlier communications from the
`examiner should be directed to JENNIFER PITRAK MCDONALD whose telephone number is
`(571)270—3061. The examiner can normally be reached on M—F, 8:30—5:00.
`Examiner interviews are available via telephone, in—person, and video conferencing using
`a USPTO supplied web—based collaboration tool. To schedule an interview, applicant is
`encouraged to use the USPTO Automated Interview Request (AIR) at
`http://www.uspto.gov/interviewpractice.
`If attempts to reach the examiner by telephone are unsuccessful, the examiner’s
`supervisor, Ram Shukla can be reached on 571—272—0735. The fax phone number for the
`organization where this application or proceeding is assigned is 571—273—8300.
`Information regarding the status of an application may be obtained from the Patent
`Application Information Retrieval (PAIR) system. Status information for published applications
`may be obtained from either Private PAIR or Public PAIR. Status information for unpublished
`applications is available through Private PAIR only. For more information about the PAIR
`system, see http://pair—direct.uspto.gov. Should you have questions on access to the Private PAIR
`system, contact the Electronic Business Center (EBC) at 866—217—9197 (toll—free). If you would
`like assistance from a USPTO Customer Service Representative or access to the automated
`information system, call 800—786—9199 (IN USA OR CANADA) or 571—272—1000.
`
`JENNIFER PITRAK MCDONALD
`
`Primary Examiner
`Art Unit 1674
`
`/Jennifer Pitrak McDonald/
`
`Primary Examiner, Art Unit 1674
`
`

Accessing this document will incur an additional charge of $.
After purchase, you can access this document again without charge.
Accept $ ChargeStill Working On It
This document is taking longer than usual to download. This can happen if we need to contact the court directly to obtain the document and their servers are running slowly.
Give it another minute or two to complete, and then try the refresh button.
A few More Minutes ... Still Working
It can take up to 5 minutes for us to download a document if the court servers are running slowly.
Thank you for your continued patience.

This document could not be displayed.
We could not find this document within its docket. Please go back to the docket page and check the link. If that does not work, go back to the docket and refresh it to pull the newest information.

Your account does not support viewing this document.
You need a Paid Account to view this document. Click here to change your account type.

Your account does not support viewing this document.
Set your membership
status to view this document.
With a Docket Alarm membership, you'll
get a whole lot more, including:
- Up-to-date information for this case.
- Email alerts whenever there is an update.
- Full text search for other cases.
- Get email alerts whenever a new case matches your search.

One Moment Please
The filing “” is large (MB) and is being downloaded.
Please refresh this page in a few minutes to see if the filing has been downloaded. The filing will also be emailed to you when the download completes.

Your document is on its way!
If you do not receive the document in five minutes, contact support at support@docketalarm.com.

Sealed Document
We are unable to display this document, it may be under a court ordered seal.
If you have proper credentials to access the file, you may proceed directly to the court's system using your government issued username and password.
Access Government Site