WO 2013/142087
`
`PCT/US2013/029684
`
`adjustments in the dose or treatment regimen, in order to achieve an optimal therapeutic
`
`outcome. Treatment may be monitored, e.g., by general indicators of disease and/or
`
`infection, such as complete blood count (CBC), nucleic acid detection methods,
`
`immunodiagnostic tests, viral culture, or detection of heteroduplex.
`
`The efficacy of an in vivo administered antiviral antisense oligomer 0f the
`
`invention in inhibiting or eliminating the growth of one or more types of RNA virus may
`
`be determined from biological samples (tissue, blood, urine etc.) taken from a subject
`
`prior to, during and subsequent to administration of the antisense oligomer. Assays of
`
`such samples include (1) monitoring the presence or absence of heteroduplex formation
`
`with target and non-target sequences, using procedures known to those skilled in the art,
`
`e. g., an electrophoretic gel mobility assay; (2) monitoring the amount of viral protein
`
`production, as dctcrmincd by standard techniques such as ELISA or Western blotting, or
`
`(3) measuring the effect on viral titer, e.g. by the method of Spearman-Karber.
`
`(See, for
`
`example, Pari, G.S. et al., Antimicrob. Agents and Chemotherapy 39(5): 1 157-1 161,
`
`1995; Anderson, K.P. et al., Antimicrob. Agents and Chemotherapy 40(9):2004—2011,
`
`1996, Cottral, G.E. (ed) in: Manual of Standard Methods for Veterinary Microbiology,
`
`pp. 60-93, 1978).
`
`In some embodiments, the oligomer is actively taken up by mammalian
`
`cells. In further embodiments, the oligomer may be conjugated to a transport moiety
`
`(e. g., transport peptide) as described herein to facilitate such uptake.
`
`D.
`
`Preparation of the Oligomers
`
`The morpholino sub units, the modified intersubunit linkages and
`
`oligomers comprising the same can be prepared as described in the examples and in US.
`
`Patent Nos. 5,185,444 and 7,943, 762 which are hereby incorporated by reference in
`
`their entirety. The morpholino subunits can be prepared according to the following
`
`general Reaction Scheme I.
`
`10
`
`15
`
`20
`
`25
`
`39
`
`

`

`WO 2013/142087
`
`PCT/US2013/029684
`
`Reaction Scheme 1. Pre aration of Mo holino Subunits
`
`
`O B
`
`1. NalO4, MeoH (aq)
`2- (NH4)2B4O7
`
`HO
`
`3. Borane-triethylamine
`4. Methanolic acid (p--TsOH
`or HCI)
`
`HO
`
`OH
`
`1
`
`o
`9RSRN—PI—O
`
`|
`
`if
`|
`9R8RN—P—Cl
`
`
`CI
`4
`
`HO
`
`5
`
`B
`
`o
`
`N
`
`3
`
`Referring to Reaction Scheme 1, wherein B represents a base pairing
`
`moiety and PG represents a protecting group, the morpholino subunits may be prepared
`
`from the corresponding ribinucleoside (1) as shown. The morpholino subunit (2) may be
`
`optionally protected by reaction with a suitable protecting group precursor, for example
`
`trityl chloride. The 3’ protecting group is generally removed during solid—state oligomer
`
`synthesis as described in more detail below. The base pairing poiety may be suitable
`
`protected for sold phase oligomer synthesis. Suitable protecting groups include benzoyl
`
`for adenine and cytosine, phenylacetyl for guanine, and pivaloyloxymethyl for
`
`hypoxanthine (I). The pivaloyloxymethyl group can be introduced onto the N1 position
`
`of the hypoxanthine heterocyclic base. Although an unprotected hypoxanthine subunit,
`
`may be employed, yields in activation reactions are far superior when the base is
`
`protected. Other suitable protecting groups include those disclosed in co-pending US.
`
`Application No. 12/271,040, which is hereby incorporated by reference in its entirety.
`
`10
`
`15
`
`Reaction of 3 with the activated phosphorous compound 4, results in
`
`morpholino subunits having the desired linkage moiety (5). Compounds of structure 4
`
`can be prepared using any number of methods known to those of skill in the art. For
`
`example, such compounds may be prepared by reaction of the corresponding amine and
`
`40
`
`

`

`WO 2013/142087
`
`PCT/US2013/029684
`
`phosphorous oxychloride. In this regard, the amine starting material can be prepared
`
`using any method known in the art, for example those methods described in the
`
`Examples and in US. Patent No. 7,943, 762. Although the above scheme depicts
`
`preparation of linkages of type (B) (e. g., X is -NR8R9), linkages of type (A) (e.g., X is
`
`dimethyl amine) can be prepared in an analogous manner.
`
`Compounds of structure 5 can be used in solid-phase automated oligomer
`
`synthesis for preparation of oligomers comprising the intersubunit linkages. Such
`
`methods are well known in the art. Briefly, a compound of structure 5 may be modified
`
`at the 5’ end to contain a linker to a solid support. For example, compound 5 may be
`
`10
`
`linked to a solid support by a linker comprising L1. An exemplary method is
`
`demonstrated in Figures 3 and 4. In this manner, the oligo may comprise a 5’— terminal
`
`modification after oligomer synthesis is complete and thc oligomer is cleaved from the
`
`solid support. Once supported, the protecting group of 5 (e.g., trityl) is removed and the
`
`free amine is reacted with an activated phosphorous moiety of a second compound of
`
`structure 5. This sequence is repeated until the desired length oligo is obtained. The
`
`protecting group in the termina 5’ end may either be removed or left on if a 5 ’—
`
`modification is desired. The oligo can be removed from the solid support using any
`
`number of methods, or example treatment with a base to cleave the linkage to the solid
`
`support.
`
`The preparation of morpholino oligomers containing boronic acid or
`
`boronic acidc cstcr moieties are described in more detail in thc Examples. In general, the
`
`boronic acid (or ester) moiety is prepared according to methods known in the art. A
`
`suitable linkage, for example a carboxylic acid-containing moiety, is covalently attached
`
`to the boronic acid moiety. Conjugation of the boronic acid moiety is then completed by
`
`activation of the boronic acid with a suitable activating agent (e. g., EDC and the like) in
`
`the presence of an oligomer containing a free amine.
`
`15
`
`20
`
`25
`
`E.
`
`Methods of Treating Diseases with the Oligomers
`
`In other embodiments, the present invention is directed to a method of
`
`treating a disease in a mammalian subject, the method comprising administering a
`
`41
`
`

`

`WO 2013/142087
`
`PCT/US2013/029684
`
`therapeutically effective amount of an oligonucleotide analogue of any of the preceding
`
`claims to a subject in need thereof.
`
`The present disclosure also provides a method of inhibiting production of
`
`a protein, the method comprising exposing a nucleic acid encoding the protein to an
`
`oligomer as disclosed herein. Accordingly, in one embodiment a nucleic acid encoding
`
`such a protein is exposed to an antisense oligomer comprising at least one boronic acid
`
`or boronic acide ester moiety, as disclosed herein, where the base pairing moieties Pi
`
`form a sequence effective to hybridize to a portion of the nucleic acid at a location
`
`effective to inhibit production of the protein. The oligomer may target, for example, an
`
`ATG start codon region of an mRNA, a splice site of a pre-mRNA, or a viral target
`
`sequence as described below.
`
`In another embodiment, the disclosure provides a method of enhancing
`
`antisense activity of an oligomer having a sequence of morpholino subunits, joined by
`
`intersubunit linkages, supporting base-pairing moieties, the method comprises modifying
`
`an oligomer as described herein to at least one boronic acid or boronic ester moiety.
`
`In some embodiments, enhancement of antisense activity may be
`
`evidenced by:
`
`(i)
`
`a decrease in expression of an encoded protein, relative to that
`
`provided by a corresponding unmodified oligomer, when binding of the antisense
`
`oligomer to its target sequence is effective to block a translation start codon for the
`
`encoded protein, or
`
`(ii)
`
`an increase in expression of an encoded protein, relative to that
`
`provided by a corresponding unmodified oligomer, when binding of the antisense
`
`oligomer to its target sequence is effective to block an aberrant splice site in a pre-
`
`mRNA which encodes said protein when correctly spliced. Assays suitable for
`
`measurement of these effects are described further below. In one embodiment,
`
`modification provides this activity in a cell-free translation assay, a splice correction
`
`translation assay in cell culture, or a splice correction gain of fianction animal model
`
`system as described herein. In one embodiment, activity is enhanced by a factor of at
`
`10
`
`15
`
`20
`
`25
`
`30
`
`least two, at least five or at least ten.
`
`42
`
`

`

`WO 2013/142087
`
`PCT/US2013/029684
`
`Described below are various exemplary applications of the oligomers of
`
`the invention. This description is not meant to limit the invention in any way but serves
`
`to exemplify the range of human and animal disease conditions that can be addressed
`
`using oligomers comprising the modified intersubunit linkages described herein.
`
`1.
`
`Neuromuscular Diseases
`
`In certain embodiments, the disease is a neuromuscular disease, for
`
`example Duchenne muscular dystrophy. In some embodiments, the oligonucleotide
`
`analogue for treating neuromuscular disease may be selected from the group consisting
`
`of:
`
`10
`
`15
`
`(a)
`
`an antisense oligomer targeted against human myostatin, having a
`
`base sequence complementary to at least 12 contiguous bases in a target region of the
`
`human myostatin mRNA identified by SEQ ID NO: 1, for treating a muscle wasting
`
`condition, as described previously (See, e.g., US. Patent Apn. No. 12/493,140, which is
`
`incorporated herein by reference; and PCT publication WOZOO6/086667). Exemplary
`
`murine targeting sequences are listed as SEQ ID NOs: 2—4.
`
`(b)
`
`an antisense oligomer capable of producing exon skipping in the
`
`DMD protein (dystrophin), such as a PMO having a sequence selected from SEQ ID
`
`NOs: 5-18 and 39, to restore partial activity of the dystrophin protein, for treating DMD,
`
`as described previously (See, e.g., PCT Pubn. Nos. WO/2010/048586 and
`
`20
`
`WO/2006/000057 or US. Patent Publication No. US09/061960 all of which are
`
`incorporated herein by reference).
`
`Several other neuromuscular diseases can be treated using the oligomers
`
`of the present invention. Exemplary compounds for treating spinal muscle atrophy
`
`(SMA) and myotonic dystrophy (DM) are discussed below.
`
`25
`
`SMA is an autosomal recessive disease caused by chronic loss of alpha-
`
`motor neurons in the spinal cord and can affect both children and adults. Reduced
`
`expression of survival motor neuron (SMN) is responsible for the disease (Hua, Sahashi
`
`et al. 2010). Mutations that cause SMA are located in the SMNl gene but a paralogous
`
`gene, SMN2, can allow viability by compensating for loss of SMNl if expressed from an
`
`43
`
`

`

`WO 2013/142087
`
`PCT/US2013/029684
`
`alternative splice form lacking exon 7 (delta7 SMN2). Antisense compounds targeted to
`
`intron 6, exon 7 and intron 7 have all been shown to induce exon 7 inclusion to varying
`
`degrees. Antisense compounds targeted to intron 7 are employed in certain embodiments
`
`(see e.g., PCT Publication Nos. WO/20lO/l48249, WO/2010/120820, WO/2007/002390
`
`and US Patent No. 7838657). Exemplary antisense sequences that target the SMN2 pre—
`
`mRNA and induce improved exon 7 inclusion are listed below as SEQ ID NOs: 19-21.
`
`It is contemplated that selected modifications of these oligomer sequences using the
`
`boronic acid or boronic ester moieties described herein would have improved properties
`
`compared to those known in the art. Furthermore, it is contemplated that any oligomer
`
`targeted to intron 7 of the SMN2 gene and incorporating the features of the present
`
`invention has the potential to induce exon 7 inclusion and provide a therapeutic benefit
`
`to SMA patients. Myotonic Dystrophy typc l (DM1) and typc 2 (DMZ) arc dominantly
`
`inherited disorders caused by expression of a toxic RNA leading to neuromuscular
`
`degeneration. DM1 and DM2 are associated with long polyCUG and polyCCUG repeats
`
`in the 3 ’—UTR and intron 1 regions of the transcript dystrophia myotonica protein kinase
`
`(DMPK) and zinc finger protein 9 (ZNF9), respectively (see e.g., W02008/O36406).
`
`While normal individuals have as many as 30 CTG repeats, DMl patients carry a larger
`
`number of repeats ranging from 50 to thousands. The severity of the disease and the age
`
`of onset correlates with the number of repeats. Patients with adult onsets show milder
`
`symptoms and have less than 100 repeats, juvenile onset DMl patients carry as many as
`
`500 rcpcats and congcnital cascs usually have around a thousand CTG rcpcats. The
`
`expanded transcripts containing CUG repeats form a secondary structure, accumulate in
`
`the nucleus in the form ofnuclear foci and sequester RNA-binding proteins (RNA-BF).
`
`Several RNA-BF have been implicated in the disease, including muscleblind-like
`
`(MBNL) proteins and CUG—binding protein (CUGBP). MBNL proteins are homologous
`
`to Drosophila muscleblind (Mbl) proteins necessary for photoreceptor and muscle
`
`differentiation. MBNL and CUGBP have been identified as antagonistic splicing
`
`regulators of transcripts affected in DMl such as cardiac troponin T (cTNT), insulin
`
`receptor (IR) and muscle—specific chloride channel (ClC—l).
`
`10
`
`15
`
`20
`
`25
`
`44
`
`

`

`WO 2013/142087
`
`PCT/US2013/029684
`
`It is known in the art that antisense oligonucleotides targeted to the
`
`expanded repeats of the DMPK gene can displace RNA—BP sequestration and reverse
`
`myotonia symptoms in an animal model of DM1 (W02008/036406). It is contemplated
`
`that oligomers incorporating features of the present invention would provide improved
`
`activity and therapeutic potential for DM1 and DM2 patients. Exemplary sequences
`
`targeted to the polyCUG and polyCCUG repeats described above are listed below as
`
`SEQ ID NOs: 22—38 and further described in US Appn. No. 13/ 101,942 which is
`
`incorporated herein in its entirety.
`
`Additional embodiments of the present invention for treating
`
`neuralmuscular disorders are anticipated and include oligomers designed to treat other
`
`DNA repeat instability genetic disorders. These diseases include Huntington’s disease,
`
`spino-ccrcbcllar ataxia, X-linkcd spinal and bulbar muscular atrophy and spinoccrcbcllar
`
`ataxia type 10 (SCAl 0) as described in W02008/018795.
`
`Table 2. Exemplary Oligonucleotide Sequences
`
`Name
`
`Sequence (5’ to 3’)
`
`SEQ
`
`10
`
`15
`
`GAAAAAAGATTATATTGATTTTAAAATCATGCA
`huMSTN target
`
`AAAACTGCAACTCTGTGTT
`muMSTN25-104 CATACATTTGCAGTTTTTGCATCAT
`
`muMSTN25 -183 TCATTTTTAAAAATCAGCACAATCTT
`muMSTN25 — l 94 CAGTTTTTGCATCATTTTTAAAAATC
`
`Exon44—A
`GATCTGTCAAATCGCCTGCAGGTAA
`Exon44—B
`AAACTGTTCAGCTTCTGTTAGCCAC
`Exon44—C
`TTGTGTCTTTCTGAGAAACTGTTCA
`
`
`
`
`Exon45—A
`Exon45-B
`
`Exon45—C
`ExonSO-A
`
`EXOn5 O-B
`Exon5 O-C
`
`Exon5 l-A
`Exon5 l-B
`
`Exon5 1-C
`
`Exon53-A
`Exon53-B
`
`CTGACAACAGTTTGCCGCTGCCCAA
`CCAATGCCATCCTGGAGTTCCTGTAA
`
`CATTCAATGTTCTGACAACAGTTTGCCGCT
`CTTACAGGCTCCAATAGTGGTCAGT
`
`CCACTCAGAGCTCAGATCTTCTAACTTCC
`GGGATCCAGTATAC TTACAGGCTCC
`
`ACATCAAGGAAGATGGCATTTCTAGTTTGG
`CTCCAACATCAAGGAAGATGGCATTTCTAG
`
`GAGCAGGTACCTCCAACATCAAGGAA
`
`CTGAAGGTGTTCTTGTACTTCATCC
`TGTTCTTGTAC TTCATC C CACTGATTCTGA
`
`SMNZ-A
`
`CTTTCATAATGCTGGCAG
`
`45
`
`

`

`WO 2013/142087
`
`PCT/US2013/029684
`
`SMN2 B
`
`CATAATGCTGGCAG
`
`AGC lSmer AGC AGC AGC AGC AGC
`
`
`AGC 18mer AGC AGC AGC AGC AGC AGC
`
`GCA 9mer GCA GCA GCA
`
`GCA 12mer GCA GCA GCA GCA
`GCA 15mer
`
`GCA GCA GCA GCA GCA
`
`
`
`46
`
`

`

`WO 2013/142087
`
`PCT/US2013/029684
`
`EXAMPLES
`
`Unless otherwise noted, all chemicals were obtained from Sigma-Aldrich-
`
`Fluka. Benzoyl adenosine, benzoyl cytidine, and phenylacetyl guanosine were obtained
`
`from Carbosynth Limited, UK.
`
`Synthesis of PMO and PMO containing further linkage modifications as
`
`described herein was done using methods known in the art and described in US. Pat.
`
`Nos. 5,698,685; 5,217,866; 5,142,047; 5,034,506; 5,166,315; 5,185,444; 5,521,063; and
`
`5 ,506,33 7, US patent application pub. Nos. 2009/0131632; 2009/0131624; and
`
`10
`
`2012/0065169; and PCT publication number WO/2009/064471 , which have previously
`
`been incorporated by rcfcrcncc in their cntircty for all purposes.
`
`EXAMPLE 1
`
`CONJUGATION or BORONIC ACID TO 5 ’—TERM1NAL END
`
`Tr—
`Compound 1 (EGFP sequence)
`
`0/
`
`0
`
`OH
`
`EGFP sequence: 5'-EG3: GCT ATT ACC TTA ACC CAG
`
`Compound 2
`
`15
`
`(SEQ ID NO: 40)
`
`Compound 1, a 5-EG3-PMO (EG3 I triethylene glycol) with the EGFP
`
`sequence (3 ’-free base, 30 mg, 4.8 mmol) is dissolved in water (500 mL) at room
`
`temperature. To this is added EDC (4 mg, 24 mmol) and N-succinyl—5—
`
`47
`
`