Reply to Office Action of November 27, 2017
`
`Application No. 15/121,623
`
`- 7 -
`
`GEUIJEN er a].
`
`AATAATTCTAGACTGGCACGTCCAGACCCAGG
`
`AAGCTGGCTAGCACCATGGAGCTGGCGGCCTTGTGC gSEQ ID NO: 41 The full-length
`
`amplified product was digested with NheI-XbaI and subsequently cloned in the corresponding sites
`
`of pcDNA3.1. The clone was sequenced and aligned with sequences available of rhesus monkeys
`
`()flVI_OO280045 1) to check correctness of the ErbB-2 clone.
`
`Cynomolgus HER3 extracellular domain was PCR amplified from cynomolgus cDNA--Monkey)
`
`Normal Colon Tissue (Biochain). The primers used for the amplification of cynomolgus HER3
`
`were as follows:
`
`Forward primer: AAGCTGGCTAGCACCATGAGGGCGAACGGCGCTCTG
`
`AAGCTGGCTAGCACCATGGAGCTGGCGGCCTTGTGC gSEgg ID NO: 51, Reversed primer:
`
`AATAATTCTAGATTACGTTCTCTGGGCATTAGC
`
`AAGCTGGCTAGCACCATGGAGCTGGCGGCCTTGTGC gSEQ ID NO: 61The full-length
`
`amplified product was digested with NheI-XbaI and subsequently cloned in the corresponding sites
`
`of pcDNA3.1. The clone was sequenced and aligned with sequences available of rhesus monkeys
`
`(ENSMMUPOOOOOO27321) to check correctness of the HER3 clone.
`
`Please amend the paragraph beginning on page 95, line 13 as follows:
`
`The monovalent binding affinity of PB4188 and PB3448 for recombinant HER2 and HER3 was
`
`determined by SPR (Biacore T100). BIACOREBiaeereTM. ..
`
`Atty. Dkt. No. 4096.0100002/DAS/PAC/E-H
`
`

Accessing this document will incur an additional charge of $.

After purchase, you can access this document again without charge.

Accept $ Charge

This document could not be displayed.

We could not find this document within its docket. Please go back to the docket page and check the link. If that does not work, go back to the docket and refresh it to pull the newest information.

Your account does not support viewing this document.

You need a Paid Account to view this document. Click here to change your account type.

Your account does not support viewing this document.

Set your membership status to view this document.

With a Docket Alarm membership, you'll get a whole lot more, including:

  • Up-to-date information for this case.
  • Email alerts whenever there is an update.
  • Full text search for other cases.
  • Get email alerts whenever a new case matches your search.

Become a Member

One Moment Please

The filing “” is large (MB) and is being downloaded.

Please refresh this page in a few minutes to see if the filing has been downloaded. The filing will also be emailed to you when the download completes.

Your document is on its way!

If you do not receive the document in five minutes, contact support at support@docketalarm.com.

Sealed Document

We are unable to display this document, it may be under a court ordered seal.

If you have proper credentials to access the file, you may proceed directly to the court's system using your government issued username and password.


Access Government Site

We are redirecting you
to a mobile optimized page.

We are unable to display this document.

PTO Denying Access

Refresh this Document
Go to the Docket