0’
`
`Européisches Patentamt
`
`.
`European Patent Office
`Office européen des brevets
`
`® Publication number:
`
`0 1 20 694
`A2
`
`®
`
`EUROPEAN PATENT APPLICATION
`
`@ Application number: 843019968
`
`@ Dateofmins: 23-03-84
`
`I
`
`@ Int.Cl.3: C 12 N 15/00
`C 12 P 21/00, A 61 K 39/00
`A 61 K 39/395, A 61 K 47/00
`B 01 D 15/08, G 01 N 33/54
`//C12R1/19,C12R1/125,
`C12R1/865
`
`Priority: 25.03.83 GB 8308235
`
`Date of publication of application:
`03.10.84 Bulletin 84/40
`
`Designated Contracting States:
`AT BE CH DE FR GB IT LI LU NL SE
`
`@ Applicant: CELLTECH LIMITED
`244-250 Bath Road
`Slough Berkshire SL1 4DY(GB)
`
` ® Inventor: Boss, Michael Alan
`
`
`
`
`
`
`
`@ Multichain polypeptides or proteins and processes for their production.
`@ This invention relates to multichain polypeptides or pro-
`teins and processes fortheirproductionIn cells of host organ—
`isms which have been transformed by recombinant DNA
`techniques.
`According to a first aspect ofthe present invention, there
`is provided a process for producing a heterologous mul-
`tichain polypeptide or protein in a single host cell, which
`comprises transforming the host cell with DNA sequences
`coding for each of the polypeptide chains and expressing said
`polypeptide chains in said transformed host cell.
`According to another aspect of the present invention
`there is provided as a product of recombinant DNA technol-
`ogy an lg heavy or light chain or fragment thereof having an
`intact variable domain.
`
`20 Hunter Court Huntercombe Lane North
`Slough Berkshire SL1 6DS(GB)
`
`® Inventor: Kenten,John Henry
`24 Avery Avenue
`Downley High Wycombe BuckinghamshirelGB)
`
`® Inventor: Emtage, John Spencer
`12, Benjamin House Amersham Hill
`High Wycom be BuckinghamshirelGB)
`
`® Inventor: Wood, Clive Ross
`Whych Wood Buddle Hill
`North Gorley NEAR Fordingbridge Hants(GB)
`
`
`
`Representative: Votier, Sidney David at al..
`CARPMAELS & RANSFORD 43, Bloomsbury Square
`London WC1A ZRAlGB)
`
`
`
`C terminus
`
`EP0120694A2
`
`The invention also provides a process for increasing the
`level of protein expression in a transformed host cell and
`vectors and transformed host cells for use in the processes.
`
`
`Croydon Printing Company Ltd.
`
`

`

`1 1 _
`
`01 20694
`
`MULTICHAIN POLYPEFTEDES OR PROTEINS AND PROCESSES FOR
`.
`,
`THEIR PRODUCTION
`'
`’
`'
`
`This invention relates to multichain polypeptides or
`proteins and processes for their production in cells
`of host organisms which have been transformed by recombi-
`nant DNA techniques.
`'
`:—
`
`In recent years advances in molecular biology based
`
`on recombinant DNA techniques have provided processes
`for the production of heterologous (foreign) polypeptides
`or proteins in host cells which have been transformed
`with heterologous DNA sequences which code for the
`
`production of these products.
`
`the recombinant DNA approach may be
`Theoretically,
`applied to the production of any heterologous polypeptide
`or protein in a suitable host cell, provided that appro—
`priate DNA coding sequences can be ident_ified and used
`to transform the_ host cell.
`In practice, when the
`recombinant DNA approach was first applied to the produc—
`tion of commercially useful produCts, its application
`for the production of any specified polypeptide or
`protein presented particular problems and difficulties,
`and the success of applying this approach to the production
`of any particular polypeptide or product was not readily
`
`predictable.
`
`However, a large number of heterologous single chain
`polypeptides or proteins have now been produced by,
`host cells transformed by recombinant DNA techniques.
`Examples of sucheheterologous single chain polypeptides
`or proteins include human interferons,
`the A and B
`chains of humanvinsulin,_human and bovine growth hormone,
`somatostatin, calf prochymosin and urokinase.
`Such
`
`5
`
`10
`
`15
`
`20
`
`25
`
`30
`
`35
`
`

`

`- 2 -
`
`01 20694
`
`transformed host cells provide a reproducible supply
`
`of authentic heterologous polypeptide or protein Whidl
`
`may bexuomxmdonanindustrial scale using industrial
`
`fermentation technology.
`
`It should be pointed out that some of these polypeptides,
`
`for instance urokinase, after secretion by a host cell
`
`appear as
`-two chainwnoleculea However,
`in such cases,
`the molecule is synthesised by the host cell'as a single
`
`chain polypeptide, coded for by a single DNA sequence,
`
`which iScleavedin the hest cell subsequent to synthesis
`to form the tmo chain structure.
`
`It is known that in both human and animal systems there
`
`are a number of polypeptides or proteins which have
`
`multichain structure in which the chains are not derived
`
`from the cleauage of a single chain polypeptide coded
`
`the gene
`In such cases,
`for by a single DNA sequence.
`for eaéh of the chains may be located at different points
`on the same chromosome or even on different chromosomes.
`
`In these cases,
`
`the polypeptide chains are synthesised
`
`separately and then assembled into the complete molecule
`
`subsequent to synthesis. Heretofore, no such.multichain
`
`polypeptide or protein has been produced by recombinant
`
`DNA techniques from a single host cell.
`
`A particular example of a class of:fizch multichain‘poly—
`peptides or proteins is the immunoglobulins.
`
`Immunoglobulins, commonly referred to as antibodies,
`
`are protein molecules produced in animals by B—lymphocyte
`
`cells in response to challenge with foreign antigenic
`
`agents, such as bacteria, viruses and foreign proteins.
`The immunoglobulins comprise a crucial part of the immune
`
`systems of humans and animals,
`
`The immunoglobulins
`
`10
`
`15
`
`2O
`
`25
`
`30
`
`35
`
`

`

`_ 3 _
`
`01 20694
`
`recognise specific parts of the foreign agents and
`
`bind onto them.
`
`The specific parts are usually known
`
`as antigenic determinants or antibody binding sites.
`
`A given foreign agent is likely to have a number of
`
`different antigenic determinants.
`
`A typical immunoglobulin (Ig) molecule is shown in
`
`Figure l of the accompanying drawings,
`to which reference
`is now made.
`The Iglmolecule comprises two identical
`polypeptide chainscfabout 600 amino acid residues (usually
`
`10
`
`referred to as the heavy chains H),disulphide bonded
`
`to each other, and two identical shorter polypeptide
`
`chains of about 220 amino acid residues (usually referred
`
`to as_the light chains L),each light chain being disulphide
`bonded to one end of each heavy chain as shown.
`
`15
`
`When the 1g molecule is correctly folded3each chain
`
`is formed into a number of distinct globular areas,
`
`usually known as domains,
`
`joined by a more linear poly—
`
`peptide chain.
`
`The light chains have two such domains,
`
`one of which is ofveriable sequence VL,’and the other
`
`Themheavy chains
`of which is of constant sequence CL.
`have a single variable domain VH adjacent the variable
`domain VL Aof the light chain, and three or four constant
`domain-S CH1—3 or 4.
`
`The variable domains on both the heavy and the light
`
`chains each contain three hypervariable regions (HVl—B)
`
`which, when the Ig molecule is correctly folded)are
`
`located adjacent one another and form the antigen binding
`
`site.
`
`It is this area which recognises and binds to
`
`the antigenic determinant for which the Ig molecule
`
`is specific.
`
`20
`
`25
`
`30
`
`35
`
`

`

`_ 4 _
`
`01 20694
`
`The constant domains of the Ig molecule do not take part
`in the binding to the antigenic determinant, but mediate
`
`the actions triggered by the binding of the Ig molecule
`
`to the antigenic determinant.
`
`It is believed that this
`
`triggering is caused by an allosteric effect induced
`
`by the binding of the Ig molecule to the antigenic deter-
`minant.
`The constant domain may enable the 1% molecule
`
`~to fix complement or may cause mast cells to release
`histamine.
`
`10
`
`15
`
`20
`
`1g '5 may be categorised by class or subclass, depending
`
`on which of a number of possible heavy chain constant
`
`domains they contain,
`
`there being eight such possible
`
`heavy chains in mice.
`
`Thfls, for instance, an 1% molecule
`
`with a_u heavy chain belongs to the class 18M, and one
`
`with a X1 heavy chain to the classIgGl.'
`
`Ig'S may also contain one of two light chains, designated
`as fi‘and )\
`light chains, which have different constant
`domains and different sets of variable domains.
`
`The structure of the Ig;molecule and the_location of
`
`the genes coding for the various domains thereof are
`
`25
`
`discussed more fully by Early and Hood,
`in Genetic
`Engineering, rinciples and Methods, Vol.3, pages 158—158
`
`(edited by Setlow and Hollaender, Plenum-Press).
`
`.It is known that Ig molecules on digéknfion with selected
`
`enzymes can produce a number of immunologically' functional
`
`30
`
`35
`
`Two such fragments are known as the Fab
`fragments.
`and (Fag)2 fragments.
`The Feb fragmentgcomprises one
`light chain linked to the VH andCfin_ domains of a heavy
`.
`.
`.
`I
`chain as shown in Figure l.
`The (Fab)2 fragment consists
`
`essentially of two Fab fragments linked-together by a
`
`small addflfionalportion of the heavy chains as shown
`
`

`

`“5
`
`0120694
`
`in Figure 1‘7 These agments and othe.r similar fragments
`can be of use in various tests and diagnostic and medical
`
`methodst,.
`
`5
`
`The principle method employed for‘the production of Ig's
`involves the immunisation of susceptible animals with
`the antigenic agentito provide an immune reaction.
`, Generally the animal is immunised a second tfme to
`improve the yield of 1%.; The animal is then——bled and
`1,3 '7 .-
`'316’
`the Ia is recovered .fr_om the serum.
`
`However, the product of this method -is not a homogeneous
`protein.- The animal will produce Igzof different classes..
`; andalso I3 specific .for each 0£ the different antigenic
`determinants on.the antigenic agent, and. its blood. .will
`.therefore contain a heterogenousmixture of :I%' s.
`Obtainingaspec1f1c Ig of particular class and desired
`spec1fic1ty from such a mixture requires very difficult
`and tediousturif1cat1on procedures.
`'
`s
`; “'f
`
`is .1
`
`20
`
`1 __:.25 ..
`
`‘4
`
`Recently, it has become possible to produce a homogeneous
`Ig‘of a single class and a single Specificity by-a
`technique first described by Kohler and Milstein (Nature,
`256, 495-479,1975).1 The. technique involves the fusion
`of single Ig—produc1ng parent cells with cancer cells
`m-producea monoclonal hybridomabellvdnflh‘produces ..1
`the Ig..
`Ig:produced by this technique is usually known."
`': as monoclonal antibody. The nature of the monoclonal
`1% is determined by the class and specificity of the 1;
`produced by the parent cell.
`
`30
`
`Recently,'attempts have been made to use recombinant
`DNA techniques to produce fragments of. Ig.molecu1es._
`For instance, Amster‘et al,
`(Nucleic_ Acid Research, 8,
`LNo.9, 1980, pp 2055 to 2065) disclose the cloning of ‘
`
`85
`
`1_
`
`
`
`

`

`’6 -
`
`0120694
`
`double stranded cDNA sequencesencoding fer'a.mouse Ig
`light chain into a plasmid. An E. Coli strain transformed
`
`by the plasmid synthesised a protein thought to comprise
`
`the complete constant domain of the light chain and.
`
`5.1”:about 40 amino acid residues of its‘variable region.
`
`Kemp and Cowman (Proc. Natl. Acad. Sci. USA, Z§,,1981,
`pp 4520 to 4524) disclose the cloning of cDNA sequences:
`encoding for mouse heavy chain fragments and the trans—
`forming of an E. Coli strain which then synthesised
`
`heavy chain polypeptide fragments.
`
`the polypeptides were produced as
`In both these cases,
`fusion proteins,
`in which the fragments of the Ig poly—
`peptides were fused with additional non-Ig polypeptide
`sequences, and with incomplete variable domains. Thus,
`the polypeptide chains produced in these studies were
`
`.
`
`not immunologically functional polypeptides as they
`were incapable of combining with complementary heavy
`or light chains to provide Iggmolecules having intact
`antigen binding sites and immunological function.
`
`Research studies have also been carried out in mammalian
`
`systems. For instance, Falkner and Zachaug(Nature3gg§,
`1982, pp 286 to 288) report the cloning of cDNA sequences
`
`encoding for mouse light chains into a plasmid which
`was used to transfect genomic eukaryotic cells which
`
`could then transiently synthesise light chains.
`
`'7_9, x1932,
`Rice and Baltimore (Proc.Nat1_. Acad. Sci. USA,
`pp 7862 to 7865) report on the transfection of a functio‘
`nally rearranged K light chain Ig gene into a murine
`
`leukemia virus-transformed lymphoid cell line.
`The
`cell line is then able to express the gene continuously.
`In both these cases,
`the K genes used to transfect the
`
`10
`
`15
`
`20
`
`25
`
`_
`
`30
`
`35
`
`

`

`,
`
`~ 7 h
`
`- '
`
`mammalian cells were obtained from myeloma cells and
`
`the K polypeptides produced were of indeterminate immuno~
`
`logical function.
`
`0120694
`
`A further approach is exemplified in a series of papers
`by Valle et al.
`(Nature, ggi, 1981, 3387840; Nature,
`ggg, 1982, 71—74;~and J. M01. 5101., $29! 1982, 459—474),
`which describe the microinjection oi‘mRNXs encoding-for
`heavy or light chains of Ig isdlated from a mouse myeloma
`line into oocytes of xenopus laevis. Under certain
`
`10
`
`conditions complete Ig molecules were formed. However,
`the mRNAs were obtained from myeloma cells and the ng
`molecules were of indeterminate immunological function.
`
`15
`
`It can thus be seen that hitherto it has not been possible
`
`to produce functional Ingy recombinantlfim,technology.‘
`
`According to a first aspect of the present invention,
`there'is provided a process for producing a heterologous
`multichain polypeptide or protein in a single host cell,
`
`which comprises transforming the host cell with DNA .
`
`sequences coding for each of the polypeptide~chains
`and expressing said polypeptide chains in said transformed
`host cell.
`’
`
`According to a second aspect of the present invention,
`
`there is provided a heterOlogous multichain polypeptide
`or protein produced by recombinant DNA technology from
`
`a single host cell.
`
`The present invention is of particular,?but not exclusive,
`application in the production of Ig molecules and immuno—
`logically functional -*—¥-————--F——*——-f+---f—-—-—-—-—
`._.
`
`20
`
`25
`
`3O
`
`35
`
`

`

`_ 8 _
`
`0120694
`
`Ig fragments of the type referred to above. Hewever,
`
`it will be appreciated that the present invention
`
`can be applied to the production of other multichain
`
`polypeptides or proteins.
`
`10
`
`15
`
`20
`
`25
`
`30
`
`35
`
`In relation to the product of 18 molecules according
`
`to the invention it will be appreciated that,
`
`in order
`
`to produce a functional moleqple, the DNA sequences
`
`used to transform the host cell will need to encode
`
`for at least the VL and VH domains of an Ig molecule.
`Moreover; these domains will need to be complementary
`
`so that when the tWo polypeptide chains fold together
`
`they form an antigen binding site of predetermined
`
`specificity.
`
`’
`
`the Ig molecule or fragment includes
`Preferably,
`a complete light chain and at least the CH1 domain
`in addition to the VH domain of the heavy chain.
`
`Most preferably the Ig molecule is intact.
`
`” ”
`
`It has also been shown by the present applicants
`
`that it is now possible to produce individual heavy
`
`and light chains having intact variable domains.
`This has not previously been possible. Therefore,
`
`according to a third aspect of the present invention
`
`there is provided as a product of recombinant DNA
`technology an Ig heavy or light chain or fragment,
`thereof having an intact variable domain.
`
`the Ig molecule or functional fragment
`Advantageously,
`thereof according to the present invention has a
`variable region (formed by the VL and VH domains)
`which defines a binding site for an antigenic determi—
`
`nant of clinical or industrial importance.
`
`The DNA
`
`coding sequences necessary Eb produce such a molecule
`
`may be derived from naturally occurring or hybridoma
`(monoclonal)Ig—producing cells with the desired
`
`specificity.
`
`

`

`.. 9 _
`
`01 20694
`
`The_constant domains of the Ig molecule or fragment71f
`
`present, may be derived from the same cell line as
`
`the variable region. However,
`
`the constant domains
`
`may be specifically altered, partially or completely
`
`omitted, or derived from a cell line producing a dif-
`
`ferent class of Ig to provide 13 molecules or fragments
`
`having desired properties.
`5
`
`10
`
`For example, an Ig molecule may be produced having
`variable domains (VH and vL)
`idential with those from
`a monoclonal antibody having a desired specificity,
`and constant domain(s) from a different monoclonal
`
`antibody having desired properties, for instance to
`
`provide human compatibility or to provide a complement
`
`15
`
`_ binding site.
`
`Such alterations in the amino acid sequence.of the
`
`constant domains may be achieved by suitable_mutation
`or partial synthesis and replacement or partial pr
`complete substitution of appropriate regions of the
`corresponding DNA coding sequences. Substitute constant
`
`domain portions may be obtained from compatible recombi—
`
`nant DNA sequences.
`
`The invention may be utilised for the production of
`Ig molecules or fragments useful for immunopurification
`immunoassays, cytochemical labelling and targetting
`methods, and methods of diagnosis or therapy.
`'For
`example,
`the Ig molecule or fragment may bind U) a
`
`therapeutically active protein such as interferon
`or a blood clotting factor, for example Factor“VIII,.
`andcmay therefore be used to produce an affinity
`chromatorgraphy medium for use in the immunopurification
`
`or assay of the protein.
`__,
`
`20
`
`25
`
`30
`
`35
`
`

`

`-10 _
`
`0120694
`
`It is also envisaged that the Ig molecule may be-synthe—
`
`sised by a hostcelllwith-another peptide moiety attached
`
`to one of its constant domains.
`
`Such a further peptide
`
`moiety may be cytotoxic or enzymatic. Alternatively,
`
`the moiety may be useful in attaching the Ig molecule
`
`to a biological substrate, such as a cell or tissue,
`
`or to a non—biological substrate, such as a chromatog—
`raphy medium; ;Such a peptide moiety is hereinsreferred
`
`to as a structural peptide moiety.
`
`'
`
`3‘3»)
`
`10
`
`It is further envisaged that cytotoxic, enzymic or
`structural peptide moieties could be attached to the
`
`Ig molecule by normal peptide chemical methods, as
`
`15
`
`are already known in the art, rather than by being
`synthesised with the Ig molecule.
`
`20
`
`‘25
`
`30
`
`The Ig molecule or fragment may also comprise a thera-
`
`peutic agent in its own right. For instance, an Ig
`molecule or fragment specific for D blood group antigen
`may be useful for the prevention of haemolytic disease
`I
`of the new born.
`
`Any suitable recombinant DNA technique may be used
`in the production of the multichain polypeptides or
`
`proteins of the present invention. Typical expression
`vectors such as plasmids are constructed comprising
`
`DNA sequences coding for each of the chains of the poly—
`peptide or protein.
`
`It will be appreciated that a single vector may be
`
`constructed which contains the DNA sequences coding
`for more than—one of the chains. For instance,
`the
`
`DNA sequences‘coding for Ig heavy and light chains
`
`may be inserted at different positions on the same
`
`35
`
`plasmid.
`
`--
`
`

`

`-115...
`
`(3112(36fil4
`.
`
`Alternatively,
`the DNA sequence coding flor-each chain.
`may be inserted individually into a plasmid,
`thus
`producing a number of constructed plasmids, each coding
`for a particular chain. Preferably the plasmidS'into
`which the sequences are inserted are compatible-
`
`5
`
`The or each constructed plasmid is used to transform
`
`a host cell so that each host cell contains DNA sequences.
`
`coding for each of the chains in the polypeptide or
`
`10
`
`protein.
`
`Suitable expression vectors which may be used for cloning
`
`in bacterial systems include plasmids, such as Col E1,
`
`.
`
`15
`
`pch, pBR322, pACYC 184 and RP4, phage DNA or derivatives
`of any of these.
`
`For use in cloning in yeast systems, suitable expression
`
`vectors include plasmids based on a 2 micron origin.
`....
`..
`..
`u-
`
`20
`
`Any plasmid containing an appropriate mammalian gene
`
`promoter sequence may be used for cloning in mammalian
`
`systems.
`
`Such vectors include plasmids derived from,
`
`for instance, pBR322, bovine papilloma virus, retrovi—v
`ruses, DNA viruses and vaccinia viruses.
`'
`'
`
`Suitable host cells which may be used for expression
`
`of the heterologous multichain polypeptide or protein
`
`include bacteria, such as E.Co1i and B. Subtilis,
`streptomyces,‘yeaSts, such as S. cervisiae, and eukary—.$
`otic cells, such as insect or mammalian cell lines.
`
`Examples of suitable bacterial host cells include
`
`E. Coli HB 101, E. Coli X1776, E. Coli X2882, E. Coli
`PS 410, E. Coli MRC 1, E. Coli RV308, E..Coli E1033
`and E._Coli B.
`'
`
`"
`
`25
`
`_
`
`30
`
`35
`
`

`

`_ 12 _
`
`0120694
`
`The present invention also. includes constructed expression
`
`vectors and transformed host cells for use in producing
`
`the multichain polypeptides or proteins of the present
`
`invention.
`
`'
`
`After expression of the individual chains in the same
`
`host cell,
`
`they may be recovered to provide the complete
`
`multichain polypeptide or protein.in active form,
`for instance to provide an Ig molecule of predetermined
`
`10
`
`immunological function.
`
`.:It is envisaged that in preferred forms of the invention,
`the individual chains will-be processed by the host
`
`cell to form the complete polypeptide or protein which
`
`advantageously is seereted therefrom.
`
`However, it may be that the individual chains may be
`produced in insoluble or membrane—bound form.
`it
`may therefore be necessary to solubilise the individual
`chains and allow the chains to refold in solution
`
`to form the active multichain polypeptide or protein.
`
`A suitable procedure for solubilising polypeptide
`
`chains expressed in insoluble or membrane—bound form
`
`is disclosed in our copending application No.
`
`(Protein Recovery, Agent's Ref. GF 402120 and 402121).
`
`15
`
`20
`
`25
`
`It will be appreciated that the present application
`
`shows for the first time that it is possible to transform
`
`30
`
`a host cell so that it can express two or more separate
`polypeptides which may be assembled to form a complete
`
`multichain polypeptide or protein; There is no disclo—
`sure or suggestion of the present invention in the .
`
`prior art, which relates solely to the production of
`
`35
`
`a single chain heterologous polypeptide or protein
`from each host cell.
`
`

`

`_ 13 _
`
`01 20694
`
`The present invention will now be described, by way
`
`of example only, with reference to the accompanying
`
`drawings,
`in which:-
`Figure 1 shows a diagrammatic-representation of a typical
`
`intact Ig molecule;
`
`.
`
`Figure 2 shows the construction-of plasmids for the
`direct synthesis of a7\_light chain in E. 0011;
`
`Figure 3 shows the construction of plasmids for the.
`direct synthesis of a,» heavy chain‘in 3.02311;
`Figure 4 is a diagrammatic representation of P mRNA
`sequences around the initiation codongl
`
`Figure 5 Shows the construction of plasmids having
`
`altered secondary structure around the initiation
`codon}
`‘
`Figure 6 is a polyacrylamide gel showing expression
`'
`and distribution of )1 protein from E. 0011 B;
`_
`Figure 7 is a polyacrylamide gel showing pulse chase
`
`10
`
`.15
`
`autoradiograms of.n protein in E. Coli B and in E. Coli
`
`20
`
`HBlOl;_
`u."
`Figure 8 is a polyacrylamide gel showing the results
`
`of')» gene expression in E. Coli;
`
`Figure 9 is a polyacrylamide gel showing the distribution
`
`of recombinant >glight chain polypeptide between the
`
`soluble and insoluble cell fractions;
`
`25
`
`30
`
`Figure 10 is a polyacrylamide gel showing expression
`and distribution of“);protein from E. Coli ElOBS;
`Figure 11 shows the results of the fracitonation of
`)4 and >xprotein expressed by E. Coli B on DEAE Sephacel;
`
`Figure 12 shows the specific hapten binding of recon—
`
`stituted lg molecules; and
`Figure 13 shows the heteroclitic nature of the hapten
`
`binding of the reconstituted Ig molecules.-
`
`

`

`_ 14 _
`
`0120694
`
`In the following examples,
`
`there is described the pro—
`
`duction of Ig light and heavy chain polypeptides derived
`
`from monoclonal antibodies which recognise and bind to
`
`the antigenic determinant 4-hydrexy—3—nitrophenyl acetyl
`
`(NP), using E.coli and S. cerevisiae as ‘the host cells
`
`Recombinant DNA techniques were used to enable the host
`
`cells to express both the-polypeptide chains.
`
`It will be appreciated that the invention is not limited
`
`to the specific methods and emanatction 2- described here—
`
`10
`
`after.
`
`Construction of Lambda Light Chain Expression Plasmid
`
`to wlqich re:erence is now made, shows
`figure 2,
`schematically the method used to construct a.?tlight chain
`
`expression plasmid.
`
`
`It was decided to express the lambda gene in E. coli
`
`15
`
`by direct expression of the gene lacking the eucaryotic
`
`signal peptide but containing a methionine initiator
`
`residue at the amino——terminus (met— lambda).
`
`The approach
`
`used for bacterial synthesis of met— lambda was to reconstruct
`
`2O
`
`the—gene.in vitro from restriction fragments of a cDNA clone
`and to utilise synthetic DNA fragments for insertion into
`
`the bacteridfiplasmid pCT54 (Emtage et al., Proc. Natl.
`
`Acad. Sci- USA., 89; 3671 to 3675, 1983). This vectOr'
`
`contains the E, coli trp ‘promoter, operator and leader
`
`25
`
`ribosome binding site; in addition 14 nucleotides downstream
`
`of the ribosome binding site is an initiator ATG followed
`
`immediately by EcoRl and HindIII sites and the terminator
`
`for E. coli RNA polymerase‘ from bacteriophage T7.
`As a source_of light chain we used a plasmid pABXl—15
`which contains a full—length)!1 light chain cDNA cloned into
`the PstI site of pBR322. This a1 light chain is derived
`from a monoclonal antibody, designated S43, which binds to
`
`30
`
`4—hydroxy—3—nitrophenylacetyl
`
`(NP) haptens.
`
`

`

`~13“
`
`0120694
`
`In order to crsa e a HindIII site 3'
`
`to the end of the
`
`lambda gene for insertion into the 'indlll site of pCT54
`the cDNA was excised from pAB;\1—15 using Pstl.
`The cohesive
`
`ends were blunt ended using the Klenow fragment of DNA poly~
`
`5 merase and synthetic HindIlI linker molecules of sequence
`5'-CCA_AGCTTGG—3'
`ligated.
`'The DNA was digested with
`
`HindIII and the 850bp lambda gene isolated by gel electro-
`phoresis and cloned into HindIII cut 'pAT15‘3 to yield
`plasmid pAT;il—15.
`The 3' end of‘the lambda gene was
`10 isolated from pATA 1—15 by HindIII plus partial Sacl
`I
`digestion as a
`630bp SacI—HindIII fragment
`(2 in Figure 2).
`
`The HindIII cohesive end was dephosphorylated by calf
`intestinal alkaline phosphatase during isolation of the
`
`fragment
`
`to prevent unwanted ligations at this end in
`
`15
`
`subsequent reactions.
`
`‘
`
`A Hian restriction site is located between codons 7}
`and 8 and the lambda sequence.
`The 5! ehd of the lambda
`gene was isolated uas a 148bp Hinfl to SacI fragment
`(1 in
`
`Figure_g).
`
`‘
`
`a."
`
`Two oligodeoxyribonucleotides were designed to restore
`
`20 codons 1—8, and to provide an initiator ATG as well as Bell
`
`and Hian sticky ends.
`The two chemically synthesised
`oligonucleotides made'to facilitate assembly of the
`had the sequences:
`__
`_
`,-"
`R45
`.5' —pGATCAATGCAGGCTGTTGTG
`3'
`‘
`- ;
`5:15:672‘4‘5 ~
`.344
`3'
`' CCGACAACACTGAGTQCTTAp-
`pCT54 was cut with both Bell and HindIII and the
`'
`resulting linear molecules
`isolated, mixed together with the
`two oligodeoxyribonucleotide linkers R44 and R45 and both
`
`gene
`
`25
`
`-
`
`fragments 1 and 2, and ligated using T4 ligase (Figure 2).
`
`30 The mixture was used to transform E. coli DHl to ampicillin
`
`resistance. Recombinant clones in pCT54 were identified by
`
`hybridisation of DNA from replica plated colonies on nitro—
`
`cellulose to a nick—translated probe derived from the : w
`
`pAT h 1—15 insert .
`
`

`

`_ 15 ..
`
`0120694
`
`A clone was identified which hybridised to lambda cDNA
`
`and also showed the predicted restriction fragment'pattern.
`
`This plasmid (designated pCT54 19—1)_was sequenced from the
`
`ClaI site and shown to have the anticipated sequence
`
`except that there was a mutation of the fourth codon from
`
`CTG to ATG, changing the amino acid at this point from
`valine to methionine.
`'
`
`The sequence in this area was:
`
`;
`
`...GAITGAICAJAIG.CAG.GCTI.GTT.AIG.ACT.CAG.GAA1TCT.GCA.CIC.ACC.ACA1TCA~.
`.-._ ....
`1 -__.__..____—~., —-1-
`. 1A~———~.aL..I-.~‘_
`metgfln.auivalnet flu‘ghigbusxx'auilaithr‘fiu‘ser
`
`.. ——-—— --.—.--'—-—......~.»_. 4....%-
`—————
`-~ «_
`_
`_,
`._..... ‘-" "' " "'
`
`
`*
`
`The restriction enzyme sites in pCT54 between the Shine
`and Dalgarno sequence (AAGG),hhid1 is important for
`ribosome binding, and the ATG allow for the adjustment of
`the SD—ATG distance, an important parameter in determining
`expression rates.
`The SD—ATG distance was reduced by
`cutting the plasmid with ClaI or BclI and creating blunt
`ended species by digestion with SI nuclease.
`2 pg of
`ClaI cut DNA was digested with 200 units of S1 nuclease for
`30 minutes at 30° using standard buffer conditions.
`The
`
`15
`
`solution was depmnteinised with phenol and the DNA re—
`20 covered by ethanol precipitation.
`This DNA on religation
`with T4 DNA ligase and transformation into E. coli strain
`
`» ~ -_ ~:‘-V?-
`
`HBlOl gave rise to a number of plasmids which had lost the
`ClaI or BclI site.
`
`'
`
`

`

`417_
`
`0120694
`
`The plasmids which had lost their ClaI.site.were sequenc~
`
`ed in the region surrounding the initiator ATG.
`
`. . . .AAGGGTATTGATCAATG CAG... . .
`
`plasmid pN'Pa
`
`SD
`
`met glu
`
`....AAGGGTTTGATCAATG GAG
`
`plasmid pN?4
`
`SD
`
`met glu
`
`;
`
`In order to achieve high level
`
`expression—a number of
`
`5
`
`Firstly, a series of
`other approaches were followed.
`constructs were obtained which had increasing amounts of
`
`the 3' untranslated region of the cDNA removed by Bal 31
`
`exonuclease.
`
`Secondly, a high copy number plasmid con—
`
`tainingzx cDNA was constructed., This plasmid contained
`
`10
`'
`
`a par function (Meaccck, R A.and Cohen S.N.Cell, g9, 529-‘
`542, 1980) as well as being present in high copy number.
`
`the pNP3 plasmid was transformed into a number
`Thirdly,
`of protease—deficient strains or into H3101 in conjunction
`
`with a protease deficient dominant acting plasmid (Gross—
`
`15 man, A.D.g£ 3; Cell, gg, 151—159, 1983).
`.-_-_.._—__.v_- ._.. __
`a“
`it -v~—~m ,_,__
`.__._._..
`Construction of E Heavy Chain Expression Flasmid
`
`The full—length p heavy chain cDNA derived from the NP
`binding monoclonal antibody B1—8 had been cloned into the
`26 PstI site of pBR822 yielding a plasmid designated‘pAgp—ll
`(Bothwell gt 2;, Cell, 25, 625—637, 1981).
`In order to
`
`achieve high level expression, the p cDNA minus the
`eukaryotic leader was reconstructed into pCT54.
`The con-'
`
`‘struction of the p heavy chain expression plasmid is shown
`25 diagramatically in Figure 3.
`Two chemically synthesised
`oligonucleotides were made to facilitate this.
`These
`have the following sequences:
`—'v
`
`R43
`
`5'
`
`GATCAATGCAGGTTCAGCTGCA
`
`30
`
`.
`
`-..‘
`
`R46
`
`3'
`
`TTACGTCCAAGTCG
`
`3'
`
`5'
`
`

`

`— 18 —
`
`0120694
`
`These were ligated into BclI cut pCT54 using T4 DNA ligase
`
`and the resulting plasmid designated pCT54 Pet.
`
`The
`
`linkers were designed to replace the sequence in pCT54
`
`between the Bell site and the ATG, to provide an internal
`
`SPstI site and to recreate the sequence from pAfip—ll 5‘
`
`to
`
`the PstI site up to codon +1.
`
`pCT54 Pat was cut briefly
`
`with PstI,
`
`treated with alkaline phosphatase and full
`
`length DNA glass isolated from a 1% agarose gel.
`
`Similarly pABp—ll was briefly out with Pet: and the full
`'10length F insert isolated following agarose gel electro—
`phoresis.
`The‘p cDNA was ligated with the full length
`
`pCT54Pst fragment using T4 DNA ligase under standard
`conditions and a plasmid designated pCT54p was identified
`7 which by restriction enzyme analysis was shown to contain.
`15a_full—length n insert.
`The plasmid was sequenced
`
`around the 5'
`
`linker region and was found to have the
`
`anticipated sequence:
`
`5'
`
`”._WTGATCAATGCAGGTICAGC‘IGCAGGGGGGGGA‘IGGGATGGAG 3"; demon-—
`
`strating that it was,
`
`indeed, a full length clone.
`
`A
`
`gocxmmlete PstI digest of pCT54P liberated a 1.4 Kb fragment
`which was purified by 0.8% agrose gel electrophoresis and
`
`glass powder isolation.
`
`This was ligated with PstI cut
`
`pCT54 Pst (see above) using T4 DNA ligase under standard
`
`conditons, followed by transformation into HBlOl.
`
`A
`
`ESplasmid designated pNPl was isolated which was shown by
`
`restriction endonuclease pattern analysis to contain the
`
`1.4 Kb pCDNA fragment in an appropriate orientation
`
`_
`
`-
`
`;
`
`
`
`

`

`a. 19 ~
`
`01 20694
`
`(Figure 13;
`
`iflV;
`
`sex a plasmid which consisted.of an
`
`appropriate 5' end for expression, whilst pCT54 contained
`
`an appropriate 3’ end.
`
`The full length gene was re—
`
`censtructed into pCT54 by cutting both pNPl and PCT54p
`
`5
`
`with AvaI which cuts once in the plasmid and once in the
`
`p gene.
`
`Bothdigests were run on a 1% agrose gel and
`
`the 1.9 Kb fragment from pNP1 and the 3.65 Kb fragment
`
`Following alkaline phosphatase
`from pCT54p isolated.
`treatment of the 8.65 Kb pCTSép fragment,
`the two pieces
`of DNA were ligated to each other and transformed into
`
`10
`
`HBlOl.
`
`A plasmid designated pNP2.was identified which
`
`. demonstrated the correct restriction endonuclease pattern.
`
`It was sequenced in the area surrounding the initiator
`
`ATG and found to have the anticipated sequence:
`
`15
`
`3'
`5'....TurntAenxmserfixscrxutxmcccdittousttrnsmymc....
`‘_ .-
`...
`.
`,.
`A.
`«- _ .. n ..-.......'_‘--.._.__;-.:.-.._.___.rn.,. '.
`
`The vector pCT54 had been constructed to include two restriction sites
`(Bell