From: Wilke, John
`
`
`
`Sent: 2/19/2019 1:44:13 PM
`
`
`
`To: TTAB EFiling
`
`
`
`CC:
`
`
`
`Subject: U.S. TRADEMARK APPLICATION NO. 87661190 - SEQUENCING BY BINDING - 720167.210 -
`Request for Reconsideration Denied - Return to TTAB - Message 2 of 6
`
`
`
`
`
`
`
`*************************************************
`
`Attachment Information:
`
`Count: 7
`
`Files: patents-6.jpg, patents-7.jpg, patents-8.jpg, patents-9.jpg, ncbi-01.jpg, ncbi-02.jpg, ncbi-03.jpg
`
`
`
`
`
`

`

`
`naps #wehcache oooqieusercnntert cumsearcnmmacne thMqichLiu nnps'lrpaterts iustia conunssmriee/omriiorne
`riflc‘fiudflEzhi:en&cbcirik&gi:u5
`02/19/2015 ID 36 35 AM
`
`Date of Patent: April 3, 201B
`Assignee: OMNIOME, INC,
`Inventors: Corey M. Dambacher. Michael Van Nguyen
`
`METHOD AND SYSTEM FOR SEQUENCING NUCLEIC ACIDS
`Publication number: 20180044727
`Abstract:
`binding procedure n examination
`erripiate nucleic acid using a polymerase-Ahmed, sequencing}
`
`
`step involves monitoring the interaction between a polymerase and template nucleic acid in the
`presence of one or more nucleottdes. Identity of the next correct nucleotide in the sequence is
`determined Without incorporation at any nucleotide into the structure of the primer by formation of a
`phosphodiester bond. An optional incorporation step can be used after the examination step to extend
`the primer by one or more nucleotides, thereby incrementing the template nucleotides that can be
`examined in a subsequent examination step. The sequencing—by—Dlnding procedure does not require
`the use of labeled nucleotides or polymerases. but optionally can employ these reagents.
`Type: Application
`Filed: August 15, 2017
`Publication date: February 15, 2018
`Applicant: OMNiOME. INC
`Inventors: Kandaswamy VIJAYAN. Corey M. DAMBACHER, Eugene TU, Mark A. BERNARD.
`Joseph ROKICKL Kerry WILSON
`
`SEQUENCING METHOD FOR RAPID IDENTIFICATION AND PROCESSING OF COGNATE
`NUCLEO'flDE PAIRS
`Publication number: 20180044715
`Abstract: F‘rciVided are methods and systems tor reducing the time needed for sequencing nucleic
`acids. The approach relies on detecting formation of nucleotide-specific ternary complexes comprising
`a polymerase (2.9.. a DNA polymerizing enzyme). a primed template nucleic acid molecule, and a
`nucleotide complementary to the templatect base of the primed template nucleic acid. The methods
`and systems facilitate determination of the next correct nucleotide, as well as the subsequent next
`correct nucleotide from a cycle of examining four different nucleotides Without requiring chemical
`incorporation of any nucleotide into the primer.
`Type: Application
`Filed: July 1Q, 2017
`
`
`
`
`
`
`
`

`

`I’lEIQS ilwebcache GDDQIQUSBFGDOIEM CDWEeflfCHTfl:CBCI'Ie kPIMQISVDLIJ nttpsu‘lpaterts lLJSIlB cowessmnee/omniome
`rincwuduiarcanespcinkcgiws
`UZ/‘lEIZD'lE it) as 35 AM
`Publi ation date: February 15, 2018
`Applicant: Ornnlome, Inc.
`Inventors: Pinar lyidogan, Kandaswarny \filayan
`
`METHOD OF NUCLEIC ACID SEQUENCE DETERMINATION
`Publication number: 20170314072
`Abstract: Provided are sequencing-by—binding methods ot detecting cognate nucleotides using a
`crippled DNA polymerizing enzyme that possesses the ability to bind the next correct nucleotide
`downstream of a primer in a template-dependent lashicn. but does not possess the actiVIty needed to
`promote phosphodiester bond formation. Use of the crippled DNA polymerase permits interrogation of
`one nucteotide at a time, without incorporation of any nucleotide. Labeled nucleotides, such as
`fluorescently labeled nucleotides. can be used in conjunction with the crippled DNA polymerase to
`establish cognate nucleotide identity in a rapid manner.
`Type: Application
`Filed: April 23, 2017
`Publication date: Novemberz. 2M7
`Applicant: Omnlome, Inc.
`Inventors: Kandaswamy \fliayan. Pinar lyidogan
`
`SEQUENCING METHOD EMPLOYING TERNARY COMPLEX DESTAEILIZATION TO IDENTIFY
`COGNATE NUCLEOTIDES
`Publication number: 20170314064
`Abstract: Provided are methods and systems tor deiecting formation at nucleotide‘specific ternary
`complexes composing a DNA polymerase, a nucleic acid. and a nucleotide complementary to the
`templated base of the primed template nucleic acid. The methods and systems facilitate determination
`of the next correct nucleotide without requiring chemical incorporation of the nucleotide into the primer.
`These results can even be achieved in procedures employing unlabeled. native nucleotides,
`Type: Application
`Filed: April 23. 2017
`Publication date: November 2. 2077
`Applicant: Dmn‘rome. Inc.
`Inventors: Pinar lyidogan, Kandaswamy Vilayan
`
`SEQUENCING DEVICE
`
`
`
`
`
`
`
`

`

`I‘lElQS rlwebcsche oocqieusercmtem ccn’usesrcntd:cacne leMqichLiu ntips'flpatents rustle eomlassranee/pmninme
`emcefiudfl‘lEzhi:en&cbcirk&gi:u5
`UZ/‘iEleD'iE ID 36 35 AM
`uhuul—b‘uil‘u mun...
`Publication number: 20170191125
`Abstract: Systems and methods for performing DNA sequencing An exampie system includes a flow
`cell, a mechanism to generate fluid flow, a number cit reservoirs tor containing respective fluids, and a
`number valves configured such that fluid from any particular one of the plurality of reservoirs can be
`individually supplied to the flow cell under the impetus ofthe mechanism to generate fluid flow by
`opening of the respective valve of the particular reservoir and closing the other valves Fluids
`containing lest nucleotides may be sequentially flowed through the flow cell and the flow cell imaged at
`each step to detect binding of the test nucleotides to a sample The nucleotide sequence of the
`sample is derived from the images The sample may be arrayed on a sensing surface ofa prism, and
`the images may be obtained, for exampie‘ by surface plasmon rescnance imaging [SPRi] cfthe
`sensing surtace or other techniques,
`Type: Application
`Filed: December 28‘ 2016
`Publication date: July E, 2017
`Applicant: Omninme, Inc,
`Inventors: Kandaswamy Vijayan. Maxim Abashin. Yi Zhang, Espir Kahatt‘ Kerry Wilson
`
`METHODS FOR DETERMINING SEQUENCE PROFILES
`Publication numben 20170137873
`Abstract: Provrded herein are methods for analyzing a signature sequence in a nucleic acid sample
`by rapid sequencing ofa target nucleic acid region. The method examines the target nucleic acid
`directly and minimizes the number of examination steps needed to determine a signature that is
`Characteristic ofa genetic feature of the nucleic acid sample,
`Type: Application
`Filed: November ‘in 2016
`Publication date: May 18, 2017
`Applicant: Dmniome. Inc.
`invenmrs: Michael Nguyen, Eugene Tu
`
`NUCLEIC ACID SEQUENCING METHODS AND SYSTEMS
`Publication number: 20170022553
`Abstract: The present disclosure provides compositions. methods and systems for sequencing a
`tempiate nucleic acid using a polymerase based. nucleic acid binding reaction involving examination of
`the interaction between a polymerase and template nucleic acid in the presence of one or more
`
`
`
`
`
`
`
`

`

`rittps ilwehcache aooqieusercnnter‘t com/searcn7c:cacne leMcichLiu nms'flpatents iustia carrilasmqnee/omnionic
`riflC‘fiEdflEzhl:en&cbclnk&gl:u5
`02/19/2015 10 36 35 AM
`
`unlabeled nucleotides The methods rely: in part, on identifying a base ofa template nucleic acid
`during nucleic acid synthesis by controlling the sequencing reaction conditions, Template nucleic acid
`bases may be identified during an examination step followed by an optional incorporation step.
`Type: Applicatlon
`Filed: July 21, 2015
`Publication date: January 26, 2017
`Applican120MNl0ME. INC.
`Inventors: Kandaswamy Vijayan. Eugene Tu: Mark A. Bernard
`
`Justia Legal Resources
`FIND A LAWYER
`IN DIVIDUALS
`Bankruptcy Lawyers
`Bankruptcy
`Criminal
`Business Lawyers
`Divorce
`Criminal Lei-were
`DUI
`Employment Lawyers
`Estate Planning Lawyers
`Estate Planning
`Family Lawyers
`Famiiy Law
`Personal lnjury Lawyers
`Personal Injury
`More.”
`More. :
`US FEDERAL LAW
`US STATE LAW
`US Constitution
`State Constitutions
`US Code
`State Codes
`State Case Law
`Regulations
`California
`Supreme Coun
`Circuit Courts
`Florida
`District Courts
`New York
`Texas
`Dockets & Filings
`More i
`More. ,
`
`BUSINESS
`Business Formation
`Business Operations
`Employment
`Intellectual Property
`International Trade
`Real Estate
`Ta1 Law
`More...
`OTHER DATABASES
`Legal Blogs
`Legal Forms
`GAO Reports
`Fmduct Recalls
`Patents
`Trademarks
`Countries
`More ,
`
`LAW STUDENTS
`Law Schools
`Admissions
`Financial Aid
`Course Outlines
`Law Journals
`Blogs
`Employment
`More...
`LEGAL MARKETIN G
`Law Firm Websites
`Lawyer Blogs
`Content
`Social Media
`Local Marketing
`Paid Ads lCPCfFPC)
`Lawyer Directory
`More. ,
`
`Privacy Policy Marketing Solutions
`
`EngDIQJustia
`
`f’in
`
`LegalPortal
`
`Company
`
`Help
`
`TennsofSerVice
`
`
`
`
`
`
`
`

`

`
`
`hflDS‘IMWW ncmnlmnm nflwpmclammBS/PMQETBSQQI 021190019 WD‘MI‘H AM
`
`
`
`mmreelfi(mnw.s(umloeczmm
`
`
`Funds:
`
`
`mg
`Arliclo F PM | 4*“)ij [ PDFC‘TM! |
`Share
`,2014
`'
`42
`I
`1
`1
`CI} m
`
`w Den.5()|15—i3
`PM PM 9
`“Fa: k.T,
`.
`5,
`mm online am Dec 19.
`PMID: 25534360
`a
`
`
`“(WWW
`HI. I‘-
`E‘
`
`
`w mu m Fm ‘ -
`
`
`
`
`Regulatory Potenhal
`g]
`.- M
`”my
`
`
`
`Yummm'mmmmmwm'mmmm,‘
`Mdmwmhrwigenmxwm
`sills revealed as hiemcnicd rule iI [Plant Cell 1'1"]
`Vnsiihau 1me 1 and “mini Mum"
`
`
`
`
`DNA-ummmm‘‘ cum-um
`
`
`'Muiafumw -N‘iclsnotls' memnse mmwm
`We: CIA-buxnmflsmh rPlantthsinl 2MB]
`
`
`Arlh'llnqrss' uhmlnafin limndding [Eh HCKLE
`imam mm namcrinfion facmr H‘ [Plant CE" 2'11 3]
`
`RobnfchlP-seuin “disemryulummlon‘‘
`fact! b‘lld'n] shes. ddlhenfial Def ICE" EVER? 1'1”]
`
`
`DNA sequence mdlif n'flknfnllhuhs rurcmp.
`
`5mm
`[AflVFMBin (2mm S'mc'BiOl,
`
`
`1
`Assumed Data
`- Sumlmlalflaymy
`
`
`
`Gul'niEl
`Abslrld
`
`
`
`mum-«minus
`
`Swunlu‘msuipfimWEFFs)cmxdmmWWofipedfic
`Dal-:inginlhednrk'mmnsqmlmwms
`
`
`wnmmmipfimdmfl.hmbidapmthafimifismmdh
`
`
`Wlmfiflwmfitmflflmmfllfiswm Trmscriptsfrmu I
`'ve
`Menfifyhrgugmciflmtuedirecflymgnlzbdhyfisinmdummdmdh
`mam-15ml [Plooeedingsnnhembnalk ]
`
`
`
`
`mplatepimznfnplml’smscfiplmgpnfileJhgminvnfiykflnmknf mmdpmmwflmmmm
`1heLDNGI-[YPOCOTYL5 am)m:uipfionfimthatldsnanphawof
`menu-lumwmcmficmfific Rm 2016]
`
`
`
`
`WichuiuimmvmmDflfihiflingaES-ymm mammummLmrlmm
`
`
`wid: imnmpmcipimion Ind nut-Mm main-seq) innud of
`Prmem m Umviniel 3 Hi; [Flam Pwsuobgy 20‘5]
`
`
`l‘wnvmdni— ‘ufi‘hb W‘Ju'mflna mnh'fnnwiiri-rl lun— unit (imilur m 91— mnh'F
`
`
`
`
`5’ mmmmmmmhm(wmm.mm
`
`
`Bound to a Transcription Factor in Win) Reveals ll: (Kain-9‘—
`
`Next-Generation Sequencing of Genomic DNA Fragments
`
`
`
`
`
`Sena"
`
`

`

`0211912319 W442“ AM
`hflDS‘IMWW ncm .nlmJ‘Im nownmclamc‘as/PMQETBQQQI
`
`Inna)I
`
`(Wanna
`
`[manna -—-u-aJ-u-.J
`
`mmmrmeuys-mgmmmmhmmmmmem
`mpmmdmvimnlymdmmwflmHYS—hindinglocihrgelywulwdwifllfln
`HYS-tugmd unfidmgmeiflemfiadhmvimchmdip Indyfiljy
`mhiningflmemmxwflhmimnymalysigwefimfifiedhlnimdsufmfi-
`bindingwslhmwediflwwfially mmnedinhyi.Wcalwobmeddshyed
`indnmimofnmeWofHYS—binflnggmsmhyfmmaminwm
`bhn—flglnmnfiudarknem Mmmvm 51))”.ng
`mphdwithwingisannnvafienlandpawnfifimdhndmhidgpmgxp
`mammumhgmmmmmmngfim,
`Keywolil: plum, Iran-criminal final, HYS, mun-blinding, next-gm
`Burning
`
`1. Introduction
`some
`Msmwwmfimmwmfimfia
`dwelapmmhlphaushifiumemunfledhaugfiupenifin multiplemachanimat
`www.mpfimflmflmlafimflthmpfimis
`poxifivelymnegafivelycmofledbyuvaalmmu'ufinnfimsffls) [LalTFA
`mDNAbMingpuI/zmiflgmemllybindtofimewicregmnawhume
`mmormhnmuregiomnflgmcmufivmminxfimhwimh
`Arabidapsilv Miamifisutimnlndthmwmimmly 10%(~3000)nfn1lgenn
`mummmmmmmrmmmmmmmm
`Rmnm)mmfimfllofimphyomflmlamdcvelqmmmlphnmdming
`lheformlfionofmmdfism‘MmWHJnmuwmw
`WMTFscmdimlomgflmmWhmaIWMofwific
`wmmlahmmmwmiflmfifidMme
`APETAIAZIFQIideIpmpaMwwmdfiuhdevehpmafiflA].whfleflleDREB
`andAREBfinnilyTFsmguflaheWmnfflmdomgmflinmhedin
`Mummmmdabadficfidmimdyuflfl‘
`Shwemmflimnyfiummpflcmdnawmhwdflwmmfim
`iti-impmhntmidanfifyihchngagmthtmmgfldedhyflsinmdam
`Wmmmofflnwhokplmm
`mmmfihmflhmgmaflykmmtoumfifyw
`wwwmslglqngflmmmmmmmm
`WMMhmmmflpmifindwificmfibodkugfinnfla
`usurmmammmmmpm mmeflgwhhhmthne-
`manning tn m.mmfima raquimdforfllemw mayJ’mvimuwml:
`mflfiedarwidmalmfurflenfifi-ingmmufaDNA—Hndingpmfin,
`namedDEPqfianwhichpmifiedputeimandsheuengNAfiammm
`mixgdmvmajmmin-gDNAsmimmumpmcipmdmm gDNAtlmwas
`bmmdmlheplmiusishybddizedmafil'mganyw. Thismalmdmulsi'n
`
`
`
`
`
`
`Imh'
`C3
`PuhMEd
`Tamnulrly
`
`Ian-III Wily
`Elmm
`B Nan-Gm Sequlncing oi Genomic DNA
`”HMS BombeTmr-scriww Fac“,
`593mm ,,
`
`[Genume Res, 21mm
`
`-symlumsmnim am lhe normal :1
`gene expression.
`[Scmma Zfluz]
`— Fundimfl “was nflmrmnuhnnhdms
`WNW:
`[PM Call Physio! ZUEIB]
`Gems direclna Mar development n
`Am
`Mantceil. 1989]
`Ammummlhmwcnam
`APEI'M during Amhapsi [Well 2'11"
`AREEI is a II-Imrq‘un Iufivmufmlml ABRE.
`dspmdnm ABA signding mat on! [Plant Cell-9105]
`Fumfimd anflys'fi 01 3| Arm hmrJIfiion
`Each, DREBzA, im in drlePiantpeM, 2006]
`Dul mntnnn ufan Arabians: hnsm'nfiun hclor
`nRFnDA nmh [PM Nallked Sc; U S A ZUWI
`AREBI‘ ARWZ. and ABFJ ave lam!
`Unnsaphon lachrsmal comm [Plflljl Jr 2‘1““
`
`Icmporal Iranscrwoml rlsponsew magnum
`drives gm humane truss-loam EEME 2'1”]
`Am “Immune A Dmlv Tami
`Nunemus Plummets for lndrvidu [Plant 0912011]
`Analysis nfhanscripfnn ram m5 ammo
`nnmg sues M!!! II: Memmn [91am Cell. _20lJTl
`Genus-wide finding s'le minis ol FAR-RED
`ELONGATED HYPDCDTYLI! rm Mam Cell 201‘]
`DIP-cm; rapid ml ammo minim n!
`UNMJInang specificity
`
`
`
`

`

`0211912319 WD‘MI‘H AM
`hflDS‘IMWW ncm .nlm.nm nownmclamc‘as/PMQETBQQQI
`WW... “Fawn“,mmmuWu.., I'M. .mmm.~.wm
`
`(paw-n9
`
`luauIna
`
`(wall-9
`
`DONGHYPOCOTYLS (HYSHE alaZlP-Iypemflpfimfinmrthmexumiwly
`WWWWMWMWWW
`whplmllafij lbw-1Y5 “WMWW
`www.mM-fimcfimfiafidqxumofwmw
`iainaemhivemflgmmmmalmghypowylphenuypemderdiflhmtfiglm
`
`mum-nSOODHYSbindingaiainmcga-nnnlm.1naddhim,ummuzqnn
`mmwmwwmmmaysmmsonmm
`seqlnmemmifim‘
`TFnfiarinvihnDNAhhxlhzgmysmnfimpmdumdmiugnpmhm
`mini ”Jimmissystunmfladifimmmwfiumahrym
`nnigivul-p‘xl-mslmimmlmodificflinnl. Whnlgumlexmilnpnwarfifl
`cafl-fiumqumlwmmnfmmfimmvm
`MWM 20g] .Pmneimsynfllesimdbymii mamm-
`mmmmstummmmnmpmwmm
`WMWTFB. flisinpmbmfliahammemeniemmhd
`“MWMDIP-chinhflfismmfimemfismmifl
`vmwmgmmhommmmsmmmhym
`mummdymmulmodel'fl‘ Indpedomadnemwmim
`nqlnnsfingmidanfifyTF-himlhgnghnl. W: 5150 :Imwflrrflafimshipbeiwaen
`lhebindingmgmandlhebhehghkmspmemuledWRM-anke,“
`MumbawwfiduuufmmabfldxénmmmmthchNAhhfing
`patnfi-lnf’i’l-‘s.
`2. Expen'menlnl Section Gum:-
`
`11.an
`Theoodhgseqwnc: ofHYS (AT5G11260)WI5 ampfificdfi'omacDNAchmby
`PCR using PrimeSTAR max palms: (leII) and have primes, 5'-
`ACTCGAGATGCAGGAACMGCGACTAGCl'C-T and 5'-
`AGOGCHXEGCI'CAAGCATAATCTGGTACATCATATGGATAAAGGCITGC
`ATCAGCATTAGMC—Tfim mum includes asequeme £0: IHA kg.
`mdmflmdhmmepcnfl—mmvecmfljfe Technologies) muting p011]-
`HYS—HA. '[IJAHYS-HAfi'agmmxishg fiomruuicfimduvmoprRH-HY}
`HAWiIhanImdelwm imam! inhequivnlznl simnflthEUVeflzu-(Cell
`Free Science) creating pEU-Hii-HYS-HA. Fur min synlhesis from pEU-Hii—
`HYS-MHUHrawmsaipfimmuamhfiminwheatgumm
`(WEPRO’IMOH Expression Id!) wing me mint-D1 II, In mum: nudline
`(CellFlee Swim), was petfimndmudi'nghmmlfimhm‘: mflruc‘fim.
`
`Am mp 9mm m5 (teem Imam:
`mm [meanwhile gunmen ir [Flam Cell. 1993]
`urge-an dumlmmm’ mm ducinq fight
`regulma anvelopmml mmniflnps lNalum. 2000]
`Thu Ariidoosis HTS gene eludes a IxZIP Beulah
`that mum sfilmlmiuduced [Gafieg‘ WV 19931
`— Lnlmegulelea Innstnuional moms in
`highsr phms
`[Man Ray Semi 211m]
`
`(:eLeree 2mm“ systems“
`mm M" W [Curr Opin savanna. 2006]
`Pmficd oel—llee que'm sycmns's syshem Ils'l'lll
`wnfiadwhefl 9mm
`
`INalProtoc. 201a]
`
`
`
`