`WWWWWWWWWWWWWWWWWWW
`
`
`
`‘ m sits-1
`
`«mt-t -
`
`Fig. 3 - Treatment with rhlL-11 in nephrotoxic nephritis (NTN).
`Treatment with high-dose lL-11 reduced expression of glom-
`erular TGF-B1 (A), glomerular tx-SMA (C), periglomerular
`tx-SMA (D), glomerular fibronectin (E) and periglomerular
`fibronectin (F) in comparison with vehicle-treated rats. The
`reduction in glomerular p-p38 MAPK (B) was not significant.
`
`
`
`In this study, we have shown that treatment with a high
`dose of lL-11 reduced glomerular expression of TGIF-(31,
`Oi-SMA and fibronectin in NTN. To our knowledge, the
`present study is the first demonstration that administration
`of rhlL-11 may alleviate glomerular expression of TGIF-B1
`activation of myofibroblasts and extracellular matrix depo-
`sition in experimental glomerulonephritis.
`In the kidney, myofibroblasts may derive from perivasoular
`smooth muscle cells, pericytes and interstitial fibroblasts,
`after stimulation by cytokines such as TGF-B1 and lL-1B
`(15-17). Myofibroblasts are implicated in the development
`
`of sclerotic lesions (18, 19). Adenoviral gene transfer of
`soluble TGF-B1 receptor || reduced the number of OI-SMA
`(+) cells and ameliorated interstitial fibrosis in NTN (20). In
`our study, a-SMA was expressed initially in the periglom-
`erular area on day 4; however, its periglomerular as well as
`mesangial expression was increased on clay 6, when the fi-
`bronectin expression was also increased. The periglomeru-
`lar a-SMA up-regulation can be attributed to myofibroblast
`formation. Activated myofibroblasts become hypertrophic
`and secrete extracellular matrix proteins, and this may lead
`to glomerulosclerosis, fibrous crescent formation and tubu-
`lointerstitial fibrosis (18).
`Phosphorylation and activation of p38 MAPK was noticed
`very early, only 5 hours after NTS induction, but most inter-
`estingly, its activation happened in a repeated way. P-p38
`MAPK expression was increased 5 hours after induction
`of NTN, reduced to normal levels during days 2-4 and re-
`lapsed on day 6. Transient inactivation of p-p38 MAPK may
`be due to its interaction with MAPK phosphatases (MKPs).
`MKPs are a family of protein phosphatases, which are re-
`sponsible for the dephosphorylation and inactivation of
`MAPKs. MKPs are activated simultaneously with MAPKs
`(20, 21), and they may be responsible for p-p38 MAPK in-
`activation.
`In the present study this inactivation seemed
`to be transient, because p38 MAPK was reactivated later,
`probably as a result of cytokine and growth factor produc-
`tion. To our knowledge, this dual activation of p38 MAPK
`has not been described previously; however, more specific
`studies are necessary to investigate it further.
`There was only a small reduction in renal p-p38 MAPK ex-
`pression in lL-11—treated rats. These results suggest that
`glomerular expression of TGF-[31 and infiltration/transfor-
`mation of myofibroblasts may proceed independently of
`p-p38 MAPK, this is in accordance with a previous study,
`which showed that p-p38 MAPK was not the only down-
`stream signalling intermediate in the pathway from TGIF-B1
`to a-SMA (22). Also, administration of a TGF-B1 receptor
`inhibitor (SD-208) resulted in the attenuation myofibroblast
`transformation of lung fibroblasts, an effect that could not
`be achieved by a p38 MAPK inhibitor(SD 282) (2 ).
`In our previous report, both high and low doses of lL-11
`reduced proteinuria and glomerular fibrinoid necrosis, but
`had a different effect on glomerular macrophages (10). Dai-
`ly treatment with a high close (1,360 ug) of rhlL—11 reduced
`the number of infiltrating macrophages; a low dose (800
`ug) of rhlL-11 reduced only the number of activated mac-
`rophages, not the total number of macrophages. Based on
`this reduction, the anti-TGF effect of lL-11 could be attrib-
`uted to its anti-inflammatory properties, a mechanism that
`has also been described for other agents (24). However,
`
`© 2011 Societa Italiana di Nefl'ologia , ISSN 112178428
`
`1 09
`
`Ex. 2001 - Page1544
`Ex. 2001 - Page1544
`
`
`
`WWWWWWWWWWWWWWWWWWW
`Stangou et al: Anti-TGF effect of lL-11 in glomerulonephritis
`
`the fact that low-dose rhlL-11 was enough to reduce IL-
`10 production, and macrophage activity, but not TGF-B1,
`ot-SMA and fibronectin expression, makes the position
`more complicated. It seems that administration of rhlL—11
`has the potential to reduce inflammation, even when giv-
`en at lower doses, but this anti-inflammatory effect is not
`enough to justify its anti-TGF effect, which requires higher
`dosage, and is also independent from p38 MAPK dephos-
`phorylation and inactivation. One of the speculations is that
`the reduction in the number of glomerular macrophages is
`needed to reduce the TGIF-[31 expression. Further work is
`needed to investigate this possibility.
`Findings of the present study suggest that lL-11 has a
`dose-dependent effect in glomerular expression of TGF-B1,
`myofibroblast differentiation and extracellular matrix depo-
`sition in NTN. This finding may be of relevance to develop-
`ment of possible new applications of lL-11 and also novel
`treatment strategies in patients with glomerulonephritis.
`
`Financial support: This work was supported by a research project
`grant from Kidney Research UK. MS. received a research project
`grant from the Greek Renal Association.
`
`Conflict of interest statement: James C. Keith Jr is an employee of
`Wyeth Research, Cambridge, MA, USA.
`
`Address for correspondence:
`Maria Stangou, MD
`Nephrology Department Aristotle University
`Hippokration Hospital
`50 Papanastasiou Street
`Thessaloniki, Greece
`mstangou@math.com
`
`2.
`
`3.
`
`4.
`
`
`1.
`Trepicchio WL, Dorner AJ. Interleukin-11: a gp130 cytokine.
`Ann N YAcad Sci. 1998;856:12-21.
`MUIIer—Newen G. The cytokine receptor gp130: faithfully pro-
`miscuous. Sci STKE. 2003;2003:PE40.
`Heinrich PC, Behrmann l, Haan S, Hermanns HM, Muller—
`Newen G, Schaper F. Principles of
`interleukin (lL)-6—
`type cytokine signalling and its regulation. Biochem J.
`2003;374:1-20.
`Schwertschlag US, Trepicchio WL, Dykstra KH, Keith JC,
`Turner KJ, Dorner AJ. Hematopoietic,
`immunomodula—
`tory and epithelial effects of
`interleukin-11. Leukemia.
`1999;113:1307-1315.
`Kurzrock R, Cortes J, Thomas DA, Jeha S, Pilat S, Talpaz M.
`Pilot study of low—dose interleukin—11 in patients with bone
`marrow failure. J Clin Oncol. 2001 :19:4165—4172.
`Ragni MV, Jankowitz RC, Chapman HL, et al. A phase II
`prospective open-label escalating dose trial of recombinant
`interleukin-11 in mild von Willebrand disease. Haemophilia.
`2008;14:968—977.
`Schmitz B, Thiele J, Witte O, Kaufmann R, Wickenhauser C,
`Fischer R. Influence of cytokines (IL-1 alpha, lL-3, lL-11, GM-
`CSF) on megakaryocyte-fibroblast interactions in normal hu-
`
`5.
`
`6.
`
`7.
`
`8.
`
`man bone marrow. Eur J Haematol. 1995;55:24—32.
`Peterson RL, Wang L, Albert L, Keith JO Jr, Dorner AJ. Mo-
`lecular effects of recombinant human interleukin-11 in the
`
`9.
`
`10.
`
`11.
`
`HLA-B27 rat model of inflammatory bowel disease. Lab In-
`vest. 1998;78:1503—1512.
`Tang W, Geba GP, Zheng T, et al. Targeted expression of IL—
`11 in the murine airway causes lymphocytic inflammation,
`bronchial remodeling, and airways obstruction. J Clin Invest.
`1996;923:2845-2853.
`Lai PC, Cook HT, Smith J, Keith JC Jr, Pusey CD, Tam FW.
`Interleukin—11 attenuates nephrotoxic nephritis in Wistar
`Kyoto rats. J Am Soc Nephrol. 2001;12:2310-2320.
`Lai PC, Smith J, Bhangal G, et al.
`lnterteukin-11 reduces
`renal
`injury and glomerular NF-kappa B activity in murine
`experimental glomerulonephritis. Nephron Exp Nephrol.
`2005;101:146—154.
`12. Tam FW, Smith J, Morel D, et al. Development of scarring
`and renal failure in a rat model of crescentic glomerulone-
`phritis. Nephrol Dial Transplant. 1999;14:1658-1666.
`13. Martin MM, Buckenberger JA, Jiang J, et al. TGF—beta1 stim—
`ulates human AT1 receptor expression in lung fibroblasts by
`cross talk between the Smad, p38 MAPK, JNK, and PI3K
`signaling pathways. Am J Physiol Lung Cell Mol Physiol.
`2007;293:790-799.
`14. Kutz SM, Hordines J, McKeown—Longo PJ, Higgins PJ. TGF—
`
`110
`
`© 2011 Societa Italiana di Nefrologia - ISSN 11218428
`
`Ex. 2001 - Page1545
`Ex. 2001 - Page1545
`
`
`
`§EPHROL 2011; 24(01): 106-111
`WWWWWWWWWWWWWWWWWWW
`
`15.
`
`16.
`
`17.
`
`18.
`
`19.
`
`20.
`
`B1—induced PAl—1 gene expression requires MEK activity and
`cell-to-substrate adhesion. J Cell Sci. 2001 ;1 14:3905-3914.
`Vesey DA, Cheung CW, Cuttle L, Endre ZA, Gobe G, Johnson
`DW. Interleukin-1 beta induces human proximal tubule cell in-
`jury, alpha—smooth muscle actin expression and fibronectin
`production. Kidney Int. 2002;62:31—40.
`Kondo S, Kagami S, Urushihara M, et al. Transforming growth
`factor-beta1 stimulates collagen matrix remodeling through
`increased adhesive and contractive potential by human renal
`fibroblasts. Biochim Biophys Acta. 2004;1693:91—100.
`Zeisberg EM, Potenta SE, Sugimoto H, Zeisberg M, Kalluri Fl.
`Fibroblasts in kidney fibrosis emerge via endothelial-to-mesen-
`chymal transition. J Am Soc Nephrol. 2008;193:2282-2287.
`Goumenos D, Tsomi K, latrou C, et al. Myofibroblasts and
`the progression of crescentic glomerulonephritis. Nephrol
`Dial Transplant. 1998;13:1652—1661 .
`Roberts IS, Burrows C, Shanks JH, Venning M, McWilliam
`LJ. Interstitial myofibroblasts: predictors of progression in
`membranous nephropathy. J Clin Pathol. 1997;50:123-127.
`Zhou A, Ueno H, Shimomura M, et al. Blockade of TGF—beta
`action ameliorates renal dysfunction and histologic progres—
`sion in anti-GBM nephritis. Kidney Int. 2003;64:92-101.
`
`21.
`
`22.
`
`23.
`
`24.
`
`Dickinson RJ, Keyse SM. Diverse physiological functions
`for dual-specificity MAP kinase phosphatases. J Cell Sci.
`2006;119:4607-4615.
`Ding Q, Gladson CL, Wu H, Hayasaka H, Olman MA. Fo-
`cal adhesion kinase (FAK)—related non—kinase inhibits
`myofibroblast differentiation through differential MAPK
`activation in a FAK-dependent manner. J Biol Chem.
`2008;283:26839-26849.
`Kapoun AM, Gaspar NJ, Wang Y, et al. Transforming growth
`factor—beta receptor type 1
`(TGFbetaRl) kinase activity but
`not p38 activation is required for TGFbetaRl—induced myofi—
`broblast differentiation and profibrotic gene expression. Mol
`Pharmacol. 2006;70:518-531.
`Nagatoya K, Moriyama T, Kawada N, et al. Y—27632 prevents
`tubulointerstitial fibrosis in mouse kidneys with unilateral ure—
`teral obstruction. Kidney Int. 2002;651:1684—1695.
`
`Received: July 14, 2009
`Revised: February 22, 20 7 0
`Accepted: March 0 7, 20 70
`
`© 2011 Societa Italiana di Nefrologia , ISSN 112178428
`
`111
`
`Ex. 2001 - Page1546
`Ex. 2001 - Page1546
`
`
`
`THE JOURNAL OF BI
`I<3 19:78 by The Arm.
`
` K.
`
`
`Jeralshfv and Molecular Biology, 1444:
`
`Transforming Growth Factorwfl Stimulates luterleukln-ll
`Transcription Via Complex Activating Proteinmlailepemieut
`Pathways*
`
`(lfiaceived for puhli alien, September 3-3, 1997, and in revised form, December 19., 1997)
`
`
`Weiliang Tangi, Llu Yang§, Yul-Chung Ya44g§, Shawn X. Lengé, and Jack A. Eliasi‘l‘:
`
`
`
`Fir-m, r'he '
`echo/.3 of Pulmonary and. (Jihad Care 133’.
`'rLe, Yale Unil'e
`fy 843has]. of Mledicirze, Department of Inferno?
`
`t 065.91'}-8057 and §Indiana Um}
`
`.Lry School 0,4 Li 4dicing, Departn‘zcnts offifedicme
`Mcduine, New Haven Lonnec
`(Homotologv/Oncmogv), and BiochemistrylM’chcular Bioiogy, Walth
`(3r Oncology, cmLcr, Indianapoiis. Indiana 4‘220.?
`
`Studies were undertaken to characterize the mecha-
`nism by which transforming growth factor-.61 (TGF—fi.)
`stimulates epithelial cell interleukin (Ha-ll production.
`Nuclear run—0n studies demonstrated that TGF—fi] is a
`potent stimulator (3f lL-ll gene transcription. THE-431
`also stimulated the luciferase activity in cells trans
`fected with reporter gem: constructs containing nude»
`otides ~728 to +58 of the ILull. promoter. Studies with.
`progressive 5" deletion constructs and site-specific mun
`tatlons demonstrated that this stimulation was depend.»
`cut on 2 AP-l sites between nucleoticies -— 10:53 and "-82 in
`the 1142—11 promoter. Mobility shift assays demonstrated
`that TGFvfil stimulated AP-l protein-DNA bincfing to
`both AP- 1 sites. Super-shift analysis demonstrated that
`Junfl was the. major moiety contributing to AP-1 -DNA
`binding in unstimulated! cells and that c-J4141-. Fra——l-,
`and Fra-Z-DNA binding were increased whereas Jun!)-
`DNA binding was (leer-eased in TGF—fil-stimulatecl cells.
`The. sequence in the ID“ promoter that contains the
`AP-l. sites also conferred. TGF-fil responsiveness, in a
`Izosltionnlntlependent 'fl’ashlon, on a lieterologeus minim
`mal promoter. Thus, TGF-Bl stimulates IL-ll gene tram»
`fieripfion Via. a complex AP-l dependent pathway that is
`(lcpemlent on 2 AP-l motifs between. nucleotides —1|.1}(1
`and "-82 that function as an enhancer in the lL-ll
`promoter.
`
`Interle ohm—11 (IL-11)1 was originally discovered as a soluble
`factor 4'14 supernatants from transformed Shame}. cells that
`Stimulated plasmacytoma cell proliferation (1‘4. It. has subse-
`q uently been shown to be a pleiotropic member ol’the I] 6-type
`cylcklue family that mediates
`
`s biologic 2 Villas V43.ahmdlug‘
`
`
`to a multimeric receptor complex 41', at contains the 543130 mol-
`eculc’2-u5) Among its many effects 444£3 the ahihy 1:0 regulate.
`hematopo-esls. rsLilo-dale the prod:Action (at aculc phase pro-
`
`t-z3444s induce 1:he tib
`, )i?:04 of metalloprotclnasc4, 4£'3gu-
`
`
`* This wmk was supported by National l44n1.i1441es of Heallh Giants
`
`I’ll—44313708. ABS/4953, l’ll4-549897 lllrfifiSé‘
`’to.:'. A. E.). DK~50570 and
`3.37.). The costs of publication 01 tHi: "Micle were
`Ill-48819 (to V.
`
`
`deFrayefl in part by the paynmnt of page Charges. Tl
`"tmle 4444154.
`
`therefore be hereby marked “advertis 71.42215" in accordance with 18
`
`USC Section 1734 solely to indicat-e t
`3 fact.
`.ion 01' Pulmo-
`.431: Sr:
`ll 0 Whom correspondence should be addr
`
`
`
`
`
`harmand Crii. cal Co>4re Medicine. Yale loiver. lty School 01’ Vladiu'ue.
`Dept. oflutcmal Medicine, 333 ledar $131105 14'. New Haven, CT
`
`
`0652
`Tel; 203-
`.-4lo‘i.: Fax: 203-3 533826;
`E—mull:
`jack.
`
`eliasfié‘ya" '3. ed 44.
`‘F—f}.. translbrming
`1 The abbrc
`tions need 3449: 1L. i4 e4leuhin;
`
`
`
`
`growll“ 133.0th[34; Al” 1, athV’dhll’l’ pr-th11; l’LV, respl (wary syncytial
`
`
`
`
`vf
`'44s; DMEM Dul‘oecl‘os modified Eagles medium; Dl‘l‘, ditl '4thre-
`
`itol; EMSA, e .clrophm. 4lC mobility shift 34.5533.3; hp, ha, 53 pal,
`.k.
`14hymidiue 1414424563.
`
`late bone metabolism, and alter epithelial proliferah(4n =2,
`6—10). Studies from our laboratories and others have also (lem—
`onstrated that IL-11 can induce tissue fibrosis, regulate tissue
`(nym‘yte and myofibrohlast accumulation, alter airway physi—
`ology, and confer protection in the context ofmncosal injury of
`the resplrator 7 and gastrointestinal tracts (11—143.
`In keeping with the biologic. importance ofIL-ll. a number or
`444"%tlgators have studied its sites of croductlon and the reg»
`4.41at4o4‘4 ol these responses. These stodles demonstrated that
`
`IL-ll is produced by a varlety of stromal cells '
`response to a.
`variety of stimuli. including (:57tokines,histaminc, cosinophil
`\.
`
`
`major basic protein. and r p'iratory tropu: Viruses ('7, 15—20). A.
`prominent finding in our inches of fibroblasts; {18), epithelial
`cells (19), and 04444044444444: (20) and studio? by others of Chon-
`(lrocyles and :;rrioviocyles (’7‘ has been the imporLance of
`TGF- 43 moieties 4n the 3414mulat4tm ol' ll. 1] product4o44 Whose
`studies also demonstrated that TG‘rF—p1 stimulamon of IL—11
`
`protein production is as slated with proportionate changes in
`lL~ll mRNA accumulation and7 in our studies,
`lL—ll gene
`transcription (18).
`The lL—ll promoter has been cloned and the cls—elemem's
`and trans-acting fictors that regulate the level." of bacal lL—ll
`production have been ldenhfied44y our laboratories (21). De—
`sgn493the demonstrated importance of gene transcrimm.on in the
`stiw. 444la'4044 of Ell-ll prtoduomm. the (4 8elements; and trans—
`acting factors that mediate the 4,1anscriptional actwatmn of
`IL- 11 have not 7434344 investigated. To forthcr our understand-
`ing of the regulation of Ill-ll, studies were undertaken to
`
`characterize the 1:414. scrip onalclemenlsu.
`13d by'.
`19431444
`
`
`the stimulation (:1: IL-ll. These :‘tudic: identifv 4m;- actlva ling
`
`prr'
`44-1 (Al‘-
`) motifs between 3331603 and "’82 in the lL—ll
`promoter that are essential for 'l‘GF-,8-44'4d14ced lL-l] transcrip-
`
`tional activation They -also demonstrate that this stimulation
`43 assocmicd with complex alteramons in the compomtion ol'thc
`ARI subunits that bind to these sites and that DNA which
`contains these AP—l elements confers TGIF—4'31 resoonsivcness
`or. a heterologous promoter. Lastly they demonstrate that this.
`mechanism is stimulus-Specific since respiratory syncytlal Vl-
`rus (RSV) stimulates IL-ll
`transcription via a different
`mechanism.
`
`EXPEth/IEN TAL PROCEDURES
`
`Cell Culture and TGF—B, Stimulation
`
`A4549 human alveolar epitheli:
`the cells were obtained from the
`American Type Culture Collection {ATOQ Rocha/ills, MD) and grown to
`
`
`confluence in Dulbe
`’s modified Eagl
`’ medium {DMEM) supple-
`
`mented with 10% (’9.
`1 bovine 594444444 (2 ). A1. coni'lussru‘c. van/Eng con-
`
`centrations of recombinant 1444444341 TGF-fi
`(1—10 44;;4’344‘4) (R ("2 D Sy‘
`
`terns7 Minneapol;
`) or 444436144440 controls Vv
`arlded, and the :
`we
`
`
`lncuhatefi. for up to 48 h. Al: the deswed points .114 Lime, s44;
`.matan
`
`were rcmov :3 and stored at —20 ”C. and mm
`
`0 haw .ted for
`further 44noge (see below).
`
`This paper is avaxlablc on line at hiip:/wv4w ihcorg
`
`Ex. 2001 - Page1547
`Ex. 2001 - Page1547
`
`
`
`
`
`14143:41401;papmlumoq
`
` ’4.
`{4’4
`
`'3113‘St}I
`
`
`
`910:‘1[.IaqmaAoN140£010431193{OK1544112
`
`
`
`
`
`
`
`
`TGF- {.l Stimulates ILKZ Z Transcription
`’1"? ed
`The DNA trad ments with that- various 5" deletions we 'e then ..
`
`
`
`by electrophoresis. electrr :iuted, and ligated into BamHI/i hol-
`
`li earls-ed pXPZ—luc vector Clones from the suhseq uent transforms 1011
`
`were screened for insert
`an, and DNA sccucncing was used to verify
`junction sequences for all clones that w ere chosen for further
`utilization.
`
`‘, a series m" com
`Through the combined efforts at both z'pproacli
`
`---728 to ~81. ln
`structs were prepared whose 5" ends extended fro J
`
`
`
`all cases. the 3’ end was +58 rela .379 to the tra
`ription initiati .n
`site.
`
`Nye/car R11 nr-on Assay
`
`‘ative rates of gene transcription were assessed using mod
`
`
`
`
`
`.d by our laboratory (22 25..
`cations of protocols previously -:l
`A549 cells were incuhaterl For 18 h under control conditions, With
`TGF—fil (10
`ml), or after infection with respiratory syncytial virus
`
`(RSV) at a inultiplimty of infection of 3 as described previously (17—19).
`The cells (3 K 107 per condition) were then washed twice with ice-cold
`
`
`phoe
`a 3 huffere-
`.
`ine.pel .
`d, and re . spended inl
`uft'erl'm
`
`mM Tris-HCl, pll 7.4.
`:3 mM Maul? 3 mM Call”), 3 41.er dithiothreitol
`
`
`(D‘ T), 300 mM sucrose, 0.5% ‘ riton X400). The nuclei were then
`harvested by cuntrifugation and resuspended in 100 lid of storage butter
`(50 D‘lM Tris-HG}, pl-l 8.3, 3 mM MgCl% 0.1 mM Ell'l‘A, 40% glycerol) and
`stored at "-60 “C until further utilized. Nylon membranes were pre-
`
`pared carrying 20 ug a”
`h of isolated cDNA fragments encoding lI.-1‘.-
`(a gift of Dr. Paul Schendel, Genetics lnstitute, Cambridge, MA] and
`
`pUClS without- a cDNA i
`t (a con rol for nonspec ""c h‘ “urn: 'zation)
`
`
`using a slot-blotting apparatt
`{MINLFOLD ll, Schleic ier Sr Scour
`and halted in a vacuum oven \80 “C [or 2 h). VVheu rea'l
`nuclei were
`thawed on ice and pelleted in a microcentrifuge at 4 °C
`30 s. and in
`
`(zit/"o transcription and RNA labeling were carried out in transcription
`
`buffer {20 min Tris—HCL pH 8.3, 160 mM KCl, 4.5 mM MgCl, 2 mM DTT,
`and 409 MM each of ATP, GTP, and CT?) in the presence of 200 ;.:.Ci of
`ia-‘EZFIUTP {“3000 (.li/nnnol, Amersham Corp.) and 20% glycerol at
`
`‘30 °C for ‘3-3 min. Tl
`ction w followed with a cold
`.
`‘
`
`
`of lOll in}? UT? for 10 min t 30 °C. The re
`tion was then terror
`.
`
`by incubating with stop butler (50- 111M Tris—HCl, pH 83 500 mM NaCl,
`5 mM EDTA) with 200 itg’n‘il RNase-free DNase I and 750 units.i
`l
`Ranin (BL ‘hringox” ltlannheim) at 30 °C for l5 min. RNA was can
`
`
`
`tracted s i
`r phenol/chloroform, precipitated, and washed
`i alcohol.
`
`Dried RNA pellets were dissolved in equal volumes of TE huff
`(10 mM
`Tris-Hal and l mM EDTA. pH 7.x“ and i‘arlioacti'
`'
`' was determined by
`
`
`
`
`the mean of duplicate countings of l-ul aliqut
`Hybridization Vv
`.
`performed by incuhatingr each membrane with equal numbers of counts
`of radiolaheled RNA. The membranes were then washed at high strin—
`
`gency, and binding was evaluated 1. sing autoradiography.
`
`Pr
`
`
`, iter Extension Antily
`
`A549 cells were incubated for 16 h with TGF-[fi1 (10 ng/ml). T
`super atant.
`. then removed, and polyiAl’ RNA wa
`‘olated using
`
`
`
`olign(-
`) affix-:ty hased methodology as descriherl (2F 97). Primer ex"
`
`
`
`tension a" i then performed usi'l _.;‘ a radinlaheled ZO-l
`c rnplernen-
`.:
`
`tary synthetic o
`onucleo
`
`e corresponding to o
`onuclec ides --11 to
`
`
`
`+9 with respect t
`the tran
`"on start site. The 5’ end of the resulting
`using the Moloncy rnurinc leukemia virus
`TL»!
`iiiRNA was defint
`e
`primer extension syster
`(l’romega, Madison, WI) as desc ”ibed by tl~
`
`manufacturer. In this ,
`.cm the 5’ end-labeled oligonuclcot “lc hybrid--
`
`
`iaed with the ill-11 inh‘NA and was uti
`ed a 2. primer by the Molouey
`niurine leukemia Virus reverse transcriptase which, in the presence of
`deoxynucleotides, synthesized cDNA until the 5 end of the mRNA was
`reached. The extended product was then resolved on an 8% urea/
`
`
`polyacwlanide sequci
`ing gel along with a known DNA sequence
`ladder.
`
`U0
`1
`8a.rna.
`
`EE
`
`3:5
`5‘:
`
`
`
`ifiio‘J.
`
`910:‘1[requiemNno£01013nagIOK15H]12
`
`Site-directed .Mutuge‘nesis
`Mutation of the Al’ul sites in the parent lL-ll promoter was per-
`
`
`
`l’ormed usii g the Mute-G en M13 In Vino Mutage
`Kit (Bio-Rad,
`
`catalog numuer 170—3580} l3
`‘ed on Kunkel’s method (29, 30‘), The
`382-bp Bomlll/thl fragment 0-” Ill-11 promoter was excised from
`
`
`le’Z-lli—l 1—324 and su'bclon d into M13 phage. The recombinant plu
`
`DNA was then transformed into bacterial
`
`train Eschc 'c.’ in cali CJ236
`(dut—, ung—,
`thi—, and relA—l to generate uracil-containing single—
`stranded DNA. Such singlenstranded DNA was allowed to anneal to
`mutagcnic primer, and second strand DNA was synthesized with T7
`
`
`
`DNA polyn
`and T4 D .'A ligas . When transihr \ed into hart
`.1
`strain M‘Jllgfltdt
`, ung+), omen-containing sin_
`stranded DIVA
`
`
`template was degraded, and only newly synthesized mutation-hearing
`second strand DNA. would propagate. The wild type and mutated ARI
`
`
`sequences are as follows: wild type 5’ (dist ll AP-
`. 5’-TGAGTC;
`;
`
`
`
`in ut
`ted 5" (dis
`l Al’ul, 5"-'llGAcgaA—3’; wi
`. tvpe 3" (proziniall All-l,
`
`5"n'l‘
`ETTA—3’; mutated 3’ (proximal) AP-l, 5’—TG'l‘c raA—fl’. All nt'the
`AP-l mutation cons tructs underwent DNA sequencing to verify the site
`and extent of the induced alterations.
`
`
`Preparation of [Ir 7 i / He / .m‘ Constructs
`
`A 156-bp BomHL’XhoI f agmcnt ”rem thc herp
`mplcx Virus thy-
`midine liinase ltk) minimal pron’ioter/chloramphenicol acetyltrans—
`ferase reporter gene construct ptli—CAT (313 was obtained from Dr
`
`and sulicloned into the.
`Annradha Ray (V ' U. '
`tensity, New Haw
`
`
`BamHI and X01
`
`
`of the pXFZ‘; uc re orter gene construct
`to
`
`
`generate ptk-XPZ.
`cleotides (5’-GA_ COG AGG GTG AGT
`GAG GAT GTG ’T‘CA (”Kiri") CG AGC TT-B" and 5—6231“ CAA GCT TCG
`
`GCC TGA CAC CTG ACT CAD CCT CG-B’l Vere then ‘vnthesized and
`
`
`annealed to form a 538-bp DNA duplex with sticky ends compatible witl
`the ,i’iomlll site (5" of herpes simplex Virus tk promoter! in ptk V332.
`This insert conta s a 27—hp DNA seq uence ofthe IL~11 promoter
`03
`
`
`to — 7'? relative to transcription start site) t lat contains hoth the 5’ and
`3"
`. l‘his double . tranded DNA sequence was then cloned into
`
`
`
`p
`P2 in the correct (sense, (plLll-(+ )tk—XPZ) and reverse (ant
`2)
`
`(plLlll—ltk—XPZ) directions. DNA .
`uencing was performed to verify
`the sequence and orientation of DlKA insertion.
`
`Coll ' 'mizsfcctinn and Reporter Gene Assay
`
`A549 cells were at éded at 40—50% confluence and i
`'uhated over-
`
`
`night in DMij w
`higl glucose and 10% fetal bovine s rum. Trans—
`
`
`
`
`fecti
`s were performed using the DEAE-r, xtran method a describe-“l
`
`
`
`prcvxoos ‘ bv our lahorator r
`. The cells were then incubated for 2- n
`
`
`in
`urn—tree DMEM alone or in DMEM supplemented with TGFfil {10
`
`rig/ml). in experiments where RSV was utilized the A549 ce ‘5 were
`
`
`incuhaterl for 9-3 min with RSV (inultiplir v m” infect-.011. ; 3) or appro—
`priate medium control. washed and then A icuhated for 24 h in serumx-
`ire DMEM. At the end of these incubations, cell lysates were prepared7
`and luciferase activity was assessed on a Lumat luminometer using the
`
`
`
`Lucite-ruse Assay S
`cm from Promcga (Madison, V ll). In all trans :30-
`
`
`
`tions the construct pGl‘i/l'l-O-gal (CliiONTEC-H, Palo Alto, CA) was a,,,.so
`included to control for transfection efficiency. The B—galactosidase ac—
`
`
`ti v ity in unstimulal ed and sti ulaied cell lysates was character
`d
`
`
`u ' .g the CPR 3 method as descrihed previously h.
`' iis lahora tory ( “,_
` ya.
`
`
`ihe B-galactosidase levels were then i. ' ed to standardize the ins
`merits of lucii’erase activity.
`
`EZezfif/‘ophureiic M’nhiliiy Shift A my (Ed/IS; )
`
`
`Preparation of Nuclear Er’racts --Nuclear extracts were prepared
`
`
`
`
`. .g morli . .
`ions of the
`i niques of S
`reiber et al. (32). Unstimu-
`
`lated7 'l‘l'lll'fifs inulated, and RSVlini‘ected . 549 cells were prepared
`as noted above. At the desired points in time, the cells {107 per condi-
`tion) were mechanically detached. suspended in Tris-buffered saline
`
`freshly supplemented with protease ii:
`ihitors (l pig/ml leupeptin, 5
`lag/ml aprot-inin, and 1 mM phcnylmcthylsultbnyl fluoride), pelleted at
`4- "C, and resuspended, and swollen in solution A (10 mM HEPES, pH
`
`Ex. 2001 - Page1548
`Ex. 2001 - Page1548
`
`P1asm Ed Construction
`
`A 786-bp Pvull fragment of the human lL—ll promoter was previ-
`ously isolate.“ and cloned in our lahnra .nries (21:). This promoter frag—
`ment contain.
`uences hctween —728 and +5.8 relative to the
`
`transcri
`tion start site defined above. it was cloned into the Smal site
`
`of the i ciferase reporter gene vector pXPZ—luc (A- CC) to generate the
`construct le’Z—llrl 1-‘7‘ 8.
`
`Preparation uf5’ Deletion Constructs
`
`
`
`Two techniques were used to gel
`e a series of 5" dele‘ one of the
`plill2-llii—11-7238 parent construct. When appropriate restriction sites
`
`were present, they were util.,. d to generate dele
`n mutants. This
`
`
`approach was u
`zed with theA ..
`the Hinfl site at
`
`--96. In both -':ases7 the »--728 to +58 iragment
`the IL~11 promoter
`
`
`
`
`
`was suhjected to cnzyr
`di
`'on. an
`the desired fragment '
`; re--
`cloned into the vector pLX'PZ-luc using standard approaches. ‘thn on
`
`propriate restr'ction sites were not available Bal -‘ i exonuclease diges-
`
`tion was employed to introduce
`eti as. This technique takes
`advantage oi'tlie Fact that Hal-Ell de‘ rides hath the 5’ and 3’ enrls ol’
`
`double-stranded DNA without inserting internal cleav
`‘8). Briefly,
`BamllI-linearized parent construct pXPQ-ll.-l1-324 was incubated
`with Bail-31 one-nuclease for varying periods. Hamill linkers (New
`England Biolahs, catalogue number 1071. Beverly. MA) were then
`added, and the DNA was subjected to BumHl/thl double digestion
`
`
`
`5508
`
`incubation Conditions
`
`]
`
`TGF—[E Stimulates IL-Il Transcription
` 1 mm DTT with l} eslily
`7.9, 10 mM KCl7 0.1 niM EDTA, 0.1 mm EGT
`added nro
`inhibitors as abov
`br 15 min on i Membrane lysis
`
`
`
`
`
`‘ complished by ad’ ing 25 ,ul of Nonidet P-I‘Q fol-g veal by vigorous
`
`
`
`
`
`agitation. The nuclei w . o coll..ctc(l by ccntnfugntion, rcsuspcndcd in
`5-5) ,u.l ofsolution B (20 mM HEPES, pH 7.9, 460 mM NaCl, 1 mM EDTA.
`1 mM EGTA, 1 mM‘ DTT and freshly added protease inhibitors as above).
`and agitated vigorously at 4 ”C lbr 15 min. The membrane. debris was
`discarded, and the nuclear extracts were snap~fiozen in small aliquots
`and stored at —80 “C.
`r(, ein concentrations of the nuclear extrac s
`
`were determined using t e DC Protein Assay System (Bic—Rail).
`Oligcnuclcotide Prob
`.
`probes
`
`were used in these experiments. For the Make of simplicity, only the top
`
`strand DNA sequences are illustrated l'
`e. Four oligonucleotide probes
`
`were syiitli
`'(l Using the (:iligonucleutiile synt
`lity at Yale.
`
`
`
`
`University. T M ii ch. lo the lbllmving ti) wilol type 5’ AF-l sequence in
`the IL—ll promoter (5' AP-l) (5’~GGGAGGGTGAGTCAGGATGmG-B’D;
`
`(ii) mutated 5’ AP-l (EH-{XX}: GGGTGA-ega/XGGATGT“3'); (iii) wild
`type 3’ AP-l sequel: .3 in the ill—ll, promoter (3 AP-l) (LR—AGTCAGG—
`ATGTG’l‘CAGGCCGGCCl‘ 3' J; and (iv) mutated 3" AP-l (5’~AGTCAG—
`
`GATGTcgaAGGCCGGC-CC ’),
`Four other oligonucleotides were obtained from commercial sources
`(Stratagene, La Jolla, CA). Th
`included the following: (i) a Classic
`
`
`AP-l nligonucleotiile (5"~CTAGTGATGAGTCAGCCGGAT‘CJ {3; (ii) an
`APE oligonuclcotidc (5’—GATCGAACTGACCGCCCGC ‘GCCCGT—3’);
`(iii) an ASP—3 oligonucleotiile (-5‘-CTAGTGGGACTTTCCACAGATC-S’l;
`and (it/‘1 an 89-1 oligonncleotide (5'-GAT(JGATCGGGGCGGCrGCGA’ll
`(13’).
`
`
`E743
`'trophorc" EMSAS were performed using the techniques of
`r at a].
`(3'2). Eadiolabeleil donhie-stranded
`,
`,‘onucleotio‘e
`Sr,
`
`
`probes were prepared by annealing complementary oligonucleotides
`
`and curl—labeling using [y—MP‘ATP and T4 polynuclcotidc kinasc (New
`England Biolabs‘;. The labeled probes were purified by push—column
`chromatography. diluted with TE bufi'er (10 mM Tris-HUI. pill 80 1 mM
`ED‘T‘A) to the desired concentration, and incubated with equal aliquots
`oi'nuclear extract (2--5 egg) and 2 a}; ofpolyldI-dCl~polyldl-dCl in a total
`volume of 20 Ml at room temperature for 1 11. Resolution was accom-
`
`plisheu by electro plioresing‘ 10 ,u.l of the reaction sol ution on vertical 6%
`
`native polyacrylamide gels containing 2% glycerol using
`'70 TBE
`X)
`
`buffer '
`3 niM Tris-Hm, 22.3 mm boric acid, {1.25 mil EDTA, pH 8.0).
`Binding was assessed via ziiitnrarliograpliy.
`Supershi/Z EflfSAm-SLiperésliil’t assays were used to determine w }lCli
`members of the AP-l family were involved in TGF/sttimulaLion or"
`
`lL—ll gene transcription in t
`‘ studies EMSA were performed as
`
`
`descrihci above except tl
`sntypo matched rabbit pol
`onal antibod—
`
`ies against AP—l proteins or control preimmuue ant erum were in-
`
`
`cluded (in: 'ng the Li) rad'
`labeled probe extract incubation period. All
`of the antibodies. that were used were purchased from Santa Cruz
`Biotechnology (Santa Cruz, CA). They included antibodies that react
`with all Jun family members (Pan-Jun) (catalogue number SC-44X),
`
`JunB (catalogue number 46X), JunD (ca 'l one number SCI-74X). c—Jiin
`
` or SCSZAZX): all Fos fa
`(catalogue nu
`‘
`y members (pan—Foe) (cata—
`
`logue number tail-253$, c-Fr {catalogue number SC-oZX), FosB (cat-
`
`alogue number Bil-48X). Fra-
`:a Lalogiie number S l—EO‘SX). and Fro-2‘:
`((Iltalogue iiuuilier ECG-34X}.
`
`
`RSV (13142 strain) was obtained from the ATCC. Stock virus was
`
`prepar; I
`in permissive cell lines and titered, and A549 cells were
`infected with the virus as described previously by this laboratory
`(17, 19).
`
`RESl Il IFS
`
`TGF—BI and RSV Stirrzulatc i’L-Z 1 Gene Trans '«
`
`vious studies from our laboratory demonq rahxl ,
`a potent stimulator of lL—ll gene transcription in lung fibro—
`blasts (18‘) and that TGEi’il and RSV stimulate A549 alveolar
`epithelial cell ILll protein production and mRNA accumula—
`
`tion (1?, 19). To determine ii" hoth slti
`iuli augment 111"].1 gene.
`transcription in A549 cells. nuclear :un—on assays were per-
`formed, and the levels of lL—ll gene t anscription were evalu—
`ated at base line, after TGF—[31 stimulati‘n and after RSV
`infection. At base line, the levels of IL—11 gene. transcription in
`A549 cells were near the limits of detection Vi. ith our assay (Fig.
`1). In contrast. both TGF—Bl and RSV caused significant. in-
`creases in IL-ll gene transcription (Fig. l).
`
`
`
`
`
`.1111;11101;popmlumoq
`
` r:
`
`'0rd.in
`
`
`
`
`
`910:‘1[ioqmvoNnoEmma1193{OK1qu12
`
`9136
`
`15:11
`
`l
`
`
`
`FIG. 1'. Demonstration of the effects of TGF-[fil and RSV on
`
`IL] I gene transcription. A54?) c9
`, incubate“ in medium alone
`
`(Control), stimula toil with TGF:
`r5113) (l0 ng/nill, or infected with
`
`
`RSV. Twenty four hours later their nuclei wer
`:aryested, and gene
`transcriotion was assessed as described undcr “ltlxpcrimontal Proce—
`dures
`ie lcvo s of Ill-ll, gcuo transcription arc coinparcd with the.
`
`liybridim...ion noted with QUCIS (DUO) without a CDNA insert which
`served as a negative control.
`
`3haram‘erization of t