Protein Engineering vol.4 no.7 pp 773-783. 1991
`
`Humanization of a mouse monoclonal antibody by CDR-grafting:
`the importance of framework residues on loop conformation
`
`Downloaded from https://academic.oup.com/peds/article-abstract/4/7/773/1479749 by Reprints Desk user on 20 July 2019
`
`Catherine A.Kettleboroueljfr Jos£ Saldanha,
`Victoria J.Heath, Charlotte J.Morrison and
`Mary M.Bendig
`
`Medical Research Council Collaborative Centre, 1-3 Buttonhole Lane. Mill
`Hill. London NW7 IAD, UK
`
`'To whom correspondence should be addressed
`A mouse monoclonal antibody (mAb 425) with therapeutic
`potential was 'humanized' in two ways. Firstly the mouse
`variable regions from mAb 425 were spliced onto human
`constant regions to create a chimeric 425 antibody. Secondly,
`the mouse complementarity-determining regions (CDRs) from
`mAb 425 were grafted into human variable regions, which
`were then joined to human constant regions, to create a
`reshaped human 425 antibody. Using a molecular model of
`the mouse mAb 425 variable regions, framework residues
`(FRs) that might be critical for antigen-binding were
`identified. To test the importance of these residues, nine
`versions of the reshaped human 425 heavy chain variable
`(VH) regions and two versions of the reshaped human
`425 light chain variable (VJ regions were designed and
`constructed. The recombinant DNAs coding for the chimeric
`and reshaped human light and heavy chains were co-
`expressed transiently in COS cells. In antigen-binding
`assays and competition-binding assays, the reshaped human
`antibodies were compared with mouse 425 antibody and to
`chimeric 425 antibody. The different versions of 425-reshaped
`human antibody showed a wide range of avidities for antigen,
`indicating that substitutions at certain positions in the human
`FRs significantly influenced binding to antigen. Why certain
`individual FR residues influence antigen-binding is discussed.
`One version of reshaped human 425 antibody bound to
`antigen with an avidity approaching that of the mouse
`425 antibody.
`antibody/anti-tumour/CDR-grafting/chimeric/
`Key words:
`molecular model-building
`
`Introduction
`The mouse monoclonal antibody 425 (mAb 425) was raised
`against the human A431 carcinoma cell line and found to bind
`to a polypeptide epitope on the external domain of the human
`epidermal growth factor receptor (EGFR). It was found to inhibit
`the binding of epidermal growth factor (EGF) at both low and
`high affinity EGFR sites (Murthy et al., 1987). Enhanced
`expression of EGFR is found to occur on malignant tissue from
`a variety of sources, thus making mAb 425 a possible agent for
`the diagnosis and therapeutic treatment of human tumours.
`Indeed, mAb 425 was found to mediate tumour cytotoxicity
`in vitro and to suppress tumour cell growth of epidermoid and
`colorectal carcinoma-derived cell lines in vitro (Rodeck et al.,
`1987). Radiolabelled mAb 425 has also been shown to bind to
`xenografts of human malignant gliomas in mice (Takahashi
`et al., 1987).
`
`Since mouse mAbs elicit an immune response in the human
`patient (Giorgi et al., 1983; Jaffers et al., 1986), two strategies
`for the humanization of mouse mAb have been developed. In
`the first, the mouse constant regions from both the light and heavy
`chain can be replaced with human constant regions. Such
`'chimeric' mouse—human antibodies have been successfully
`constructed from several mouse mAbs directed against human
`tumour-associated antigens (Sun et al., 1987; Whittle et al., 1987;
`Liu etal., 1987; Gillies and Wesolowski, 1990). This approach
`totally conserves the antigen-binding site of the mouse antibody,
`and hence the antigen affinity, while conferring the human
`isotype and effector functions. In the second approach, only the
`complementarity-determining regions (CDRs) from the mouse
`variable regions are grafted into human variable regions. It is
`reasoned that this technique will transfer the critical and major
`portion of the antigen-binding site to the human antibody (Jones
`et al., 1986). CDR grafting has been carried out for several rodent
`monoclonals (Jones et al., 1986; Richmann et al., 1988;
`Verhoeyen et al., 1988; Queen et al., 1989; Co et al., 1991;
`Gorman etal., 1991; Maeda etal., 1991; Tempest etal., 1991).
`All retained their capacity to bind antigen, although the affinity
`was usually diminished. In most cases it was deemed necessary
`to alter certain amino acids in the human framework residues
`(FRs). It appears that at least a few changes in the human FRs
`are essential to ensure that the CDR-grafted or 'reshaped human'
`antibody has an antigen-binding site with the correct functional
`conformation. Both chimeric and CDR-grafted antibodies have
`proved superior to the mouse antibodies in the clinic (Hale et al.,
`1988; LoBuglio et al., 1989; Mathieson et al., 1990).
`
`This paper describes the cloning, sequencing and humanization
`of mouse mAb 425. A chimeric antibody was constructed by
`fusing the mouse light chain variable (VJ and heavy chain
`variable (VH) domains of mAb 425 to human kappa and
`gamma-1 constant domains respectively. The human gamma-1
`domains were selected because they have been demonstrated to
`be the most effective in complement and cell-mediated lysis
`(Bruggemannefa/., 1987; Reichmann et al., 1988). CDR-grafted
`or reshaped human antibodies were constructed by transferring
`the mouse mAb 425 CDRs into human variable regions that show
`a high degree of homology to the mouse mAb 425 variable
`regions. It was found that changes at several positions in the
`human FRs were essential to ensure good antigen-binding. To
`help select potentially important FR residues, a molecular model
`of the mouse 425 VL and VH regions was constructed. The
`effect of specific changes in the FRs on antigen-binding was
`investigated and the influence of the FR residues on antigen-
`binding is discussed.
`
`Materials and methods
`Molecular cloning and sequencing
`Total RNA was isolated from cell line W425-15 (Chirgwin et al.,
`1979). Supernatant from the W425-15 cells used for total RNA
`isolation was assayed by ELISA to ensure that the cells were
`producing mAb 425 in high amounts. Poly(A)+ RNA was
`
`© Oxford University Press
`
`773
`
`Lassen - Exhibit 1048, p. 1
`
`

`

`Downloaded from https://academic.oup.com/peds/article-abstract/4/7/773/1479749 by Reprints Desk user on 20 July 2019
`
`Description
`
`light chain primer for cDNA synthesis
`heavy chain pnmer for cDNA synthesis
`chimcnc VH front pnmer
`chimenc VH back pnmer
`chimeric VL front pnmer
`chimenc VL back primer
`
`pnmer to introduce F7IY into RVL
`
`primer to introduce S30T into RVH
`
`primer to introduce V48I into RVH
`
`-3' pnmer to introduce R66K. V67A. L7IV
`into RVH
`
`primer to introduce L71V into RVH
`
`C.A.Kettleborough et al.
`
`Table I. Oligonucleotidcs used for cDNA cloning, construction of chimencs and mutagenesis
`
`No.
`
`Sequence
`
`5'-G T A G G A T C C T G G A T G G T G G G A A G A T G - 3'
`5'-G T A G G A T C C A G T G G A T A G A C C G A T G - 3'
`5'-C T C C A A G C T T G A C C T C A C C A T G G - 3'
`5'-T T G G A T C C A C T C A C C T G A G G A G A C T G T G A - 3'
`5'-A G A A A G C T T C C A C C A T G G A T T T T C A A G T G - 3'
`5'-G T A G A T C T A C T C A C G T T T T A T T T C C A A C - 3'
`
`5'-A G C G G T A C C G A C T A C A C C T T C A C C A T C - 3'
`+
`*
`5'-A T A C C T T C A C A T C C C A C T G - 3'
`
`5'-C G A G T G G A T T G G C G A G T - 3'
`•
`*
`
`*
`
`9 1
`
`0
`
`5'-T T T A A G A G C A A G G C T A C C A T G A C C G T G G A C A C C T CT
`
`5'-C A T G A C C G T G G A C A C C T C T - 3'
`In primers 7—11, starred bases indicate base changes resulting in codon changes.
`
`prepared from the total RNA (Aviv and Leder, 1972). Double-
`stranded cDNA was synthesized according to the methods of
`Gubler and Hoffman (1983), except that primers homologous
`to the 5' regions of the mouse kappa and gamma-2a constant
`regions were used to prime first-strand synthesis (Levy et al.,
`1987). The design of the light chain primer (oligonucleotide 1;
`Table I) and heavy chain primer (oligonucleotide 2; Table I) was
`based on published data (Kaariten etal., 1983; Kabat etal., 1987;
`Levy et al., 1987). Primers were synthesized on an Applied
`Biosystems 380B DNA Synthesizer and purified on urea —
`acrylamide gels. After second-strand synthesis, the blunt-ended
`cDNAs were cloned into Smal-digested pUC 18 and transformed
`into competent Escherichia coli cells, DH5-alpha. Clones were
`screened by hybridization using 32P-labelled
`first-strand
`synthesis primers (Carter et al., 1985). Sequencing of double-
`stranded plasmid DNA was carried out using Sequenase (United
`States Biochemical Corporation).
`Construction of chimeric genes
`For each variable region, two polymerase chain reaction (PCR)
`primers (front and back) were synthesized (oligonucleotides 3—6;
`Table I). PCR reactions were set up using 1 ng of pUC18 plasmid
`DNA containing the cloned cDNA, front and back PCR primers
`at a final concentration of 1 yM each, 1.25 mM of each dNTP,
`10 mM Tris-HCl (pH 8.3), 50 mM KC1, 1.5 mM MgCl and
`0.01 % gelatin (w/v). Amplitaq DNA polymerase (Perkin Elmer
`Cetus) was added at 2.5 U/assay. After an initial melt at 94°C
`for 1.5 min, 25 cycles of amplification were performed at 94°C
`for 1 min, 45°C for 1 min and 72°C for 3 min. A final extension
`step at 72°C was carried out for 10 min. PCR reactions were
`phenol/chloroform extracted twice and ethanol precipitated before
`digesting with HindUl and BamHl. The PCR fragment coding
`for the VL or VH region was then cloned into an expression
`vector. This vector contains the human cytomelovirus (HCMV)
`enhancer and promoter, the bacterial neo gene, and the SV40
`origin of replication. A 2.0 kb BamHl fragment of genomic DNA
`coding for the human gamma-1 constant region and containing
`the necessary signals for correct splicing and poly(A)+ sites
`(Takahashi et al., 1982) was inserted in the correct orientation
`(see HCMV-
`downstream of the VH region fragment
`CVH425-gamma 1 in Figure 1). This vector was later modified
`by removing the BamHl site at the 3' end of the constant region
`
`774
`
`fragment, thus allowing variable regions to be directly inserted
`into the heavy chain expression vector as Hindlll— BamHl
`fragments (Maeda et al., 1991). The fragment coding for the
`VL region was inserted into a similar HCMV expression vector,
`in this case containing a BamHl fragment of genomic DNA
`- 2 .6 kb in size, coding for the human kappa constant region
`and containing a splice acceptor site and a poly(A)+ site
`(Rabbins et al., 1984) (see HCMV-CVL425-kappa in Figure 1).
`Molecular modelling of mAb 425 VL and VH
`A molecular model of the variable regions of mouse mAb 425
`was built on the solved structure of the highly homologous anti-
`lysozyme antibody, Hy-HEL5 (Sheriff etal., 1987). The variable
`regions of mAb 425 and Hy-HEL5 have 90% homology.
`The model was built on a Silicon Graphics Iris 4D workstation
`running under the UNIX operating system and using the
`molecular modelling package 'QUANTA' (Polygen Corp.).
`Identical residues in the FRs were retained; non-identical residues
`were substituted using the maximum overlap procedure (Snow
`and Amzel, 1986) incorporated
`into QUANTA'S protein
`modelling facility. The main-chain conformation of the three
`N-terminal residues in the heavy chain were substituted from an
`homologous antibody structure (HyHEL-10; Padlan etal., 1989)
`since their temperature factors were abnormally high (greater than
`the mean plus three standard deviations from the backbone
`temperature factors) and since they influence the packing of VH
`CDR3 (H3) (Martin, 1990).
`The CDR1 (LI) and CDR2 (L2) sequences of the VL region
`and the CDR1 (HI) and CDR2 (H2) sequences of the VH region
`from mAb 425 corresponded to canonical forms postulated by
`Chothia et al. (1989). LI and L2 belong to canonical structural
`group 1 for both CDRs, and HI and H2 belong to canonical
`structural groups 1 and 2 respectively. The main-chain torsion
`angles of these loops were kept as in HyHEL-5. The CDR3 (L3)
`sequence of the VL region and the CDR3 (H3) sequence of the
`VH region from mAb 425 did not correspond to canonical
`structures and, therefore, were modelled in a different way. The
`computer program of Martin et al. (1989) was used to extract
`loops from the Brookhaven Databank (Bernstein et al., 1977).
`The loops were then sorted based on sequence similarity, energy
`and structure-determining residues (Sutcliffe, 1988). The top-
`ranked loops were inspected on the graphics and the best selected
`
`Lassen - Exhibit 1048, p. 2
`
`

`

`Downloaded from https://academic.oup.com/peds/article-abstract/4/7/773/1479749 by Reprints Desk user on 20 July 2019
`
`H.nd III
`
`I coHl
`
`i con
`
`Humanization of a mouse monoclonal antibody
`
`! com
`
`Hind III
`
`I. com
`
`EcoRI
`
`com
`
`Fig. 1. Schematic representations of the vectors used for the expression of chimeric and reshaped human antibodies. Restriction sites used in the construction
`of the expression plasmids are marked The variable region coding sequences are represented by the dark boxes, constant regions by the light boxes, the
`HCMV promoter and enhancer by the hatched boxes, and the nucleotide fragment from the plasmid pSVneo by the speckled boxes The directions of
`transcription arc represented by arrows
`
`by eye. H3 was modelled on bovine glutathione peroxidase (Epp
`etal., 1983) in the region of residues 92-103. L3 was modelled
`on the murine IgA (J539) Fab fragment (Suh et al., 1986) in
`the region of residues 88—96 of the light chain.
`The model was subjected to steepest descents and conjugate
`gradients energy minimization using the CHARMm potential
`(Brooks et al., 1983) as implemented in QUANTA in order to
`relieve unfavourable atomic contacts and to optimize van der
`Waals and electrostatic interactions.
`
`Construction of humanized antibody genes
`The construction of the first version of reshaped human 425 VL
`region was carried out using a CDR-grafting approach similar
`to that described by Reichmann et al. (1988) and Verhoeyen et al.
`(1988). Single-stranded template DNA was prepared from a
`M13mpl8 vector containing a HindUl—BamUl fragment coding
`for the human anti-lysozyme VL region (Winter, 1988). Three
`oligonucleotides were designed which consisted of DNA
`
`sequences coding for each of the mouse mAb 425 light chain
`CDRs flanked on each end by 12 bases of DNA complementary
`to the DNA sequences coding for the adjacent human FRs.
`Oligonucleotides were synthesized and purified as before.
`All three oligonucleotides were phosphorylated and used
`simultaneously in an oligonucleotide-directed in \itro mutagenesis
`system based on the methods of Eckstein and co-workers (Taylor
`et al., 1985a,b; Nakamaye and Eckstein, 1986; Sayers et al.,
`1988) (as supplied by Amersham pic). The manufacturer's
`instructions were followed throughout the exonuclease III
`digestion step. The reaction was then phenol/chloroform
`extracted, ethanol precipitated and resuspended in 100 /tl of TE.
`A volume of 10 /*1 was used as template DNA in a 100 /tl
`PCR-amplification reaction containing Ml3 universal primer and
`reverse sequencing primer to a final concentration of 0.2 fj.M
`each. Buffer and thermocycling conditions were as described
`previously with the exception of using a 55°C annealing
`temperature. The PCR reaction was phenol/chloroform extracted
`
`775
`
`Lassen - Exhibit 1048, p. 3
`
`

`

`Downloaded from https://academic.oup.com/peds/article-abstract/4/7/773/1479749 by Reprints Desk user on 20 July 2019
`
`subcloned into the heavy chain expression vector to produce the
`plasmids HCMV-RVHh425-gammal and HCMV-RVHi425-
`gamma 1.
`Transfection of DNA into COS cells
`COS cells were electroporated with 10 ng each of the expression
`vectors bearing the genes coding for the heavy and light chains.
`Briefly, 10 jtg of each plasmid was added to a 0.8 ml aliquot
`of a 1 x 10* cells/ml suspension of COS cells in PBS. A
`Bio-Rad Gene Pulser was used to deliver a pulse of 1900 V, at
`a capacitance of 25 /iF. The cells were left to recover at room
`temperature for 10 min before plating into 8 ml DMEM
`containing 10% fetal calf serum. After 72 h incubation, the
`medium was collected, centrifuged to remove cellular debris and
`analysed by ELISA.
`Quantification of IgG production and detection of antigen binding
`Human IgG present in COS cell supernatants was detected by
`ELISA. In the ELISA assay for human IgG, 96 well plates were
`coated with goat anti-human IgG (whole molecule) (Sigma) and
`human IgG in the samples that bound to the plates was detected
`using alkaline phosphatase-conjugated goat anti-human IgG
`(gamma-chain specific) (Sigma). Purified human IgG (Sigma)
`was used as a standard. Binding to the antigen recognized by
`mAb 425 was determined in a second ELISA. Plates were coated
`with an EGFR protein preparation and antibodies binding to
`EGFR were detected using either an anti-human IgG (gamma-
`chain specific) peroxidase conjugate (for chimeric and reshaped
`human antibodies) or an anti-mouse IgG (whole molecule)
`peroxidase conjugate (for the mouse mAb 425 antibody) (both
`conjugates supplied by Sigma). Purified mouse mAb 425 was
`used as a standard.
`
`Competition binding assay
`Mouse mAb 425 was biotinylated using a kit supplied by
`Amersham pic. ELISA plates were coated with an optimal
`dilution of the EGFR protein. Dilutions of the COS cell
`supernatants, in a volume of 50 /tl, were mixed with 50 jtl of
`the biotinylated mouse mAb 425 (estimated by ELISA to be
`1.75 jig/ml each). Each COS cell supernatant was tested in
`duplicate. Plates were incubated at room temperature overnight.
`Bound biotinylated mouse mAb 425 was detected by the addi-
`tion of streptavidin horseradish peroxidase complex (Amersham
`pic). A control with no competitor present allowed a value of
`percentage of inhibition or blocking to be calculated for each COS
`cell supernatant as follows: 100 — [(OD450 of sample/OD450 of
`control) X 100].
`
`Results
`Cloning and sequencing of variable region genes of mAb 425
`From the cDNA synthesis and cloning using the kappa chain
`primer, 314 colonies were picked for screening. From the cDNA
`synthesis and cloning using the gamma-2a primer, 252 colonies
`were picked for screening. After screening by hybridization using
`the two respective cloning primers, 21 light chain colonies and
`12 heavy chain colonies gave strong signals. Plasmid DNA was
`isolated from these colonies and analysed by restriction enzyme
`digests to determine the size of the cDNA inserts. Clones that
`appeared to have inserts 400-500 bp or 500-600 bp for
`the VL and VH respectively were selected as candidates for
`sequencing. Three VL clones and three VH clones were
`sequenced on both strands using M13 universal and reverse
`sequencing primers. Of the three possible VL clones sequenced,
`one coded for a complete variable region and the others appeared
`
`C.A.Kettleborough et al.
`
`twice and ethanol precipitated before digestion with HindUl and
`BamHl and subcloning into pUC18. Putative positive clones were
`identified by hybridization to 32P-labelled mutagenic primers
`(Carter et al., 1985). Clones were confirmed as positive by
`sequencing. A VL region containing all three mouse mAb 425
`CDRs was cloned as a HindUl — BamHl fragment into the light
`chain expression vector
`to create plasmid HCMV-
`RVLa425-kappa.
`Version 'b' of reshaped human 425 VL was constructed
`using the PCR mutagenesis method of Kammann et al. (1989),
`with minor modifications. The template DNA was the RVLa
`subcloned into pUC18. The first PCR reaction was set up in a
`total volume of 50 y\ and contained 1 ng template, M13 reverse
`sequencing primer and primer 7 (Table I) at a final concentration
`of 1 fiM. The reaction conditions were as described in Kammann
`et al. (1989). The PCR reaction was phenol/chloroform extracted
`and ethanol precipitated before isolating the PCR product from
`a TAE agarose gel. A tenth of the first PCR reaction was then
`used as one of the primers in the second PCR reaction. The
`second reaction was as the first, except the first reaction product
`and 20 pmol of M13 universal primer were used. Cycling was
`as described in Kammann et al. (1989). The HindUl-BamHl
`fragment was cloned into pUC18 and sequenced. A correctly
`mutated DNA fragment was subcloned into the light chain
`expression vector to create plasmid HCMV-RVLb425-kappa.
`The first version of the reshaped human 425 VH region was
`chemically synthesized at British Bio-technology Ltd. A DNA
`sequence was designed coding for the required amino acid
`sequence and containing the necessary flanking DNA sequences
`(see Results). Codon usage was optimized for mammalian cells
`with useful restriction enzyme sites engineered into the DNA
`sequences coding for FRs. The 454 bp was synthesized and
`subcloned into pUC18 as an EcoRl — HindUl fragment. A
`HindUl-BamHl fragment coding for the reshaped human 425
`VH region was then transferred into the heavy chain expression
`vector to create plasmid HCMV-RVHa425-gammal.
`Eight other versions of the reshaped human 425 VH
`regions were constructed by a variety of methods. The
`HindUl -BamHl
`fragment coding for the version 'a' of the
`reshaped human 425 VH region was transferred to M13mpl8
`and single-stranded DNA prepared. Using oligonucleotides
`8—10 (Table I). PCR-adapted M13 mutagenesis, as described
`above, was used to generate DNA coding for reshaped human
`425 VH regions versions 'd', 'e', 'f and 'g' in pUC18. These
`versions were subcloned into the heavy chain expression
`vector as HindUl -BamHl
`fragments
`to create plasmids
`HCM V-R VHd425-gamma 1, HCM V-RVHe425-gamma 1,
`HCMV-RVHf425-gammal and HCMV-RVHg425-gamma 1.
`Reshaped human 425 VH regions versions 'b' and 'c' were
`generated using the PCR-mutagenesis method of Kammann et al.
`(1989) as described above. The template DNA was reshaped
`human 425 VH region version 'a' subcloned into pUC18, and
`the mutagenic primer used in the first PCR reaction was either
`primer 10 or 11 (Table I). After mutagenesis and sequencing,
`sequences bearing the desired changes were subcloned into
`the heavy-chain expression plasmid to create plasmids HCMV-
`RVHb425-gammal and HCMV-RVHc425-gammal.
`Reshaped human 425 VH regions versions 'h' and V were
`constructed from the pUC-based clones of existing versions. A
`0.2 kb Hindlll-Xhol
`fragment from version 'e' was ligated to
`a 2.8 kb Xhol-HindUl
`fragment from either version 'b' or
`'c' producing the new versions 'h' and M' respectively. The
`HindUl -BamHl
`fragments coding for these versions were
`
`776
`
`Lassen - Exhibit 1048, p. 4
`
`

`

`Downloaded from https://academic.oup.com/peds/article-abstract/4/7/773/1479749 by Reprints Desk user on 20 July 2019
`
`Humanization of a mouse monoclonal antibody
`
`to code for unrelated peptides. Two of the VH clones coded for
`identical VH regions, while the other appeared to code for the
`VH region with the intron between the leader sequence and FR1
`still present. Apart from the intron, the third VH clone contained
`coding sequence identical to that of the first two clones. To verify
`the sequence of the VL region, three more cDNA clones
`containing inserts of the appropriate size were sequenced. Two
`of these gave sequences in agreement with the first VL clone.
`The third was an unrelated DNA sequence. In the clones
`sequenced, not all of the original primer sequence was present.
`The extent of the deletions varied from clone to clone. These
`deletions, which probably occurred during cDNA synthesis and
`cloning, may have decreased the efficiency of the colony
`screening. Indeed, other groups have reported the need to
`use different oligonucleotides for the priming and screening
`(Hoogenboom et al., 1990).
`The VL and VH genes for mAb 425 are shown in Figure 2.
`For patent reasons, the DNA sequences coding for CDRs are
`represented by Xs. The amino acid sequence of the 425 VL and
`VH regions were compared with other mouse variable regions
`in the Kabat data base (Kabat et al., 1987). The VL region could
`be placed into the mouse kappa chain variable region subgroup
`IV or VI. Within the FRs, the 425 VL region has an 86%
`identity to the consensus sequence for mouse kappa subgroup
`IV and an 89% identity to subgroup VI. The 425 VL region
`
`appears to use the JK4 segment. The 425 VH region has a 98%
`identity to the FRs of the consensus sequence for mouse heavy
`chain subgroup II(B).
`
`Construction and expression of chimeric 425 antibody
`To construct the chimeric genes, front and back PCR primers
`were synthesized for each variable region. The front primer was
`designed to incorporate a HindUl site for cloning into the
`expression vector and a Kozak sequence to optimize translation
`(Kozak, 1987). The back primer was designed to incorporate a
`BamHl site (VH) or a BglU site ( VJ for cloning and the
`necessary splice donor site. The PCR reaction was carried out
`as described in Materials and methods.
`The PCR-modified VL region DNA was cloned into the
`HindUl —BamHl sites of the HCMV light chain expression vector
`as a HindUl-BglU
`fragment. The entire PCR-modified VL
`fragment was sequenced to ensure that no errors had been
`incorporated during the PCR step. The PCR-modified VH DNA
`was cloned to the HCMV heavy chain expression vector as a
`HindUl— BamHl fragment and also sequenced to confirm the
`absence of PCR errors.
`The expression vectors containing the chimeric 425 VL and
`VH regions were co-transfected into COS cells. After 72 h of
`transient expression, the COS cell culture medium was assayed
`by ELISA for the production of human IgG and for the ability
`
`CGAGCTCGGctgagcacacaggacctcaccatgggttggagctatatcatcctctttttg
`
`GCTCCAGCCgactcgtgtgtcctggagtggtacccaacctcgatatagtaggagaaaaac
`5' -CTCCAAGCTTGACCTCACCATGG-3'
`mndiri
`
`Q V Q L Q O FG
`
`gtagcaacagctacagatgtccactcccaggtccagctgcaacaacctggggctgaactg
`I
`|
`1
`1
`^
`+
`catcgttgtcgatgnctacaggtgagggiiccaggtcgacgttgttggaccccgacttgac
`
`V K P G A S V K L S C K A . S G Y T F T (X
`
`gtgaagcctggggcttcagtgaagttgtcctgcaaggcttccggctacaccttcaccio-*-
`
`cacttcggaccccgaogtcacttcaacaggacgttccgaaggccgatgtggaagtggxx*
`
`B
`
`TTCGAGCTCGGTACCCacaaaa t g g a r - t t t c a a g t g c a g a t t Ll cage l i c et gel eta t c
`
`AAGCTCGAGCCATGGGtgttttacctaaangttcacgtctaaaagtcgaaggacgai
`5'-AGAAAGCTTCCACCATGGATTTTCAAGTG-3'
`HihdIII
`L S RG
`
`Q I V L T Q S P A IM
`
`S A S VI
`
`i aq
`
`agtgcctcagtcatactgtccagaggacaaattgttctcacccagtatccagcaatcatg
`
`tcacggagtcagtatgacaggtctcctgtttaacaagagtgggtcagaggtcgttagtac
`
`X X X X ) W V K Q R A G Q G I . E W I G ( XX
`
`S A S P G E K V T H T C ( X X X X X X XX
`
`xxxxxxxxxxxxtgggtgaagcagagggctggacaaggccttgagtggatcggaxxyxxx
`
`tctgcatctccaggggagaaggtc*ct«tg*cctgcxxxxxxxxxxxxxxxx\xxxxxxx
`
`xxxxxxxxxxxxacccacttcgtctcccgacctgttccggaactcacccagcctxxxAvx
`
`agacgtagaggtcccctcttccagtgatactggacgxxxxxxxxxxxxxxxxxxxxxxxx
`
`xxxxxxxxxxx
`
`xyxxxxxxxxaaggccacactgact
`
`xxxxxxxxx <ttccggtgtgactga
`
`V D K S S S T A Y M Q L S S L T S E DS
`
`gtagacaaatcctccagcacagcctacatgcaactcagcagcctgacatctgaggactcl
`
`catctgtttaggaggtcgtgtcggatgtacgttgagtcgtcggactgtagactcctgaga
`
`x ) w Y Q Q K P G S S P R L L} Y (x X
`
`xxxxtggtaccagcagaagccaggatcctcccccagactcctgatttatxwxx;
`
`xxxxaccatggtcgtcttcggtccteggagggggictgaggectaaataxxxxx)
`
`G V P V R F S G S G S G T S YS
`
`vggagtccctgttcgtttcagtggcagtgggtctgggacctcitactci
`
`xcctcagggacaagcaa»gtcaccgtcacccagaccctggagaatgaga
`
`LT
`
`I
`
`S R M E A E D A A T Y Y c f x X XX
`
`ctcacaatcagccgaatggaggctgaagatgctgccacttattactgcxxxxxxxxxxx
`
`gagigttagtcggcttacctccgacttctacgacggtgaataatgacgxxxx•\xy•xv
`
`G Q
`
`ggcca,
`
`BamHIi
`T L T V S S
`3'-AGTGTCAGAGGAGTCCACTCACCTAGGTT-5'
`
`ccggttccgtggtgagagtgtcagaggagtcpgttttgttgtggggtagccagataygtg
`v-c splice
`
`x x x y x x x v x /t v H
`
`xxxxxxxxxxxx
`
`BgLlI
`F G S G T K L E IK
`3' -CAACCTTTATTTTGCACTCATCTAGVTG-V
`xttcggctcggggacaaagttggaaataaaacfcjggctgatgctgca
`
`xaagccgagcccctgtttcaacctttattttgpqcgactacgacgL
`V-C splice
`
`tggatTCCTCTAGAGTCGACC
`
`acctaAGGAGATCTCAGCTGG
`
`ccaactgtatggatcttcccaccat ccaggatccGGGGATCC
`
`ggtigacatacctagaagggtggtaggtcctaggCCCCTAGG
`
`Fig. 2. The nucleotide and amino acid sequences of the VH425 (panel A) and VL425 (panel B) cDNA as cloned into pUC18. Nucleotides from the pUC18
`vector are in upper case lettering. The amino acids contributing to the leader are underlined and CDRs are indicated by brackets; information concerning the
`CDRs has been removed for patent reasons The splice sites between the variable regions and constant regions are also shown. The front and back
`PCR-pnmers and their annealing sites, used in the construction of the genes coding for the chimeric antibodies, are shown.
`
`777
`
`Lassen - Exhibit 1048, p. 5
`
`

`

`Downloaded from https://academic.oup.com/peds/article-abstract/4/7/773/1479749 by Reprints Desk user on 20 July 2019
`
`most like the original mouse FRs. Such FRs would, it was hoped,
`preserve any FR residues important in antigen binding and also,
`since individual FR residues affect the packing of the CDRs
`(Chothia and Lesk, 1987), preserve the structural conformations
`of the CDRs. The FRs of mouse mAb 425 VH region were
`compared with the FRs from the consensus sequences for all
`subgroups of human VH regions (Kabat et al., 1987). This
`comparison showed that the FRs of mouse mAb 425 VH were
`most like the FRs of human VH subgroup I showing a 73%
`identity within the FRs and a 65% identity over the entire
`VH region.
`A further comparison of the mouse 425 VH region with other
`mouse VH regions from the same Kabat subgroups was carried
`out to identify any FR residues which were characteristic of mAb
`425 and may, therefore, be involved in antigen binding. The
`residue at position 94 of the mouse mAb 425 VH region is a
`serine while in other VH regions from mouse subgroup II(B),
`and also from human subgroup I, residue 94 is an arginine (Kabat
`et al., 1987). This amino acid substitution is a relatively unusual
`one and since position 94 is adjacent to CDR3, it is at a potentially
`important position. Indeed, there is evidence from variants in
`anti-digoxin antibodies that changing a serine for an arginine at
`this position affects antigen binding (Panka et al., 1988). For
`these reasons, the reshaped human 425 VH region was designed
`based on the CDRs of mouse mAb 425 and FRs derived from
`the consensus sequence for human subgroup I FRs (as defined
`by Kabat et al., 1987). It was decided to make position 94 in
`FR3 a serine as found in mouse mAb 425. At positions in the
`consensus sequence for human subgroup I FRs, where no single
`amino acid was listed, the most commonly occurring amino acid
`at that position was selected. If there was no preferred amino
`acid at a particular position in the human consensus sequence,
`the amino acid that was found at that position in the sequence
`of mouse mAb 425 VH was selected. The resulting amino acid
`sequence comprised the first version (version 'a') of reshaped
`
`B
`
`V.4 2S
`
`Q V Q L Q Q P G A E L V K P G A S V K L S C K A S G Y T FT
`
`XXXXX
`
`W V K Q R A G Q G L E W IG
`
`CDR1
`
`F R2
`
`49
`
`RV,a425
`RV,b425
`RV.C425
`RV,d425
`RV.64 25
`RVHf4 25
`RVHg4 25
`RVKh4 25
`RVKi4 25
`
`Q V Q L V Q S G A E V K K P G A S V K V S C K A S G Y T FS
`
`XXXXX
`
`W V R Q A P G Q G L E H VG
`
`T
`
`T
`T
`T
`
`- I-
`- I-
`- I-
`
`VH425
`
`XXXXXXXXXXXXXXXXX KATLTVDKSSSTAYNQLSSLTSEDSAVYYCAS
`
`RVMa425 XXXXXXXXXXXXXXXXX RVTMTLDTSTNTAYMELSSLRSEDTAVYYCAS
`V
`RVHb425
`RVBc425
`V
`RV,d425
`RVHe425
`RV,f425
`RV,g425
`RV,h425
`RVai425
`
`KA
`KA
`
`KA
`
`C.A.Kettleborough et al.
`
`of that human-like IgG to bind to EGFR. Amounts of human
`IgG detected in the media varied from 100 to 400 ng/ml. The
`chimeric antibody produced bound well to EGFR in a standard
`antigen-binding ELJSA, thus confirming that the correct mouse
`variable regions had been cloned and sequenced.
`Initial design, construction and expression of reshaped human
`425 light and heavy chains
`In designing a reshaped human 425 antibody, most emphasis was
`placed on the VH region, since this domain is often the most
`important in antigen-binding (Amit et al., 1986; Verhoeyen et al.,
`1988; Ward et al., 1989). To select the human FRs on which
`to graft the mouse CDRs, it was decided to look for human FRs
`
`H i n di II
`WGCTTGCCGCCACCATSCACTGGACCTGGCGCCTG'1'ITTCCCTGCTCGCCCTGGCTCCT
`
`H D W T K R V FC
`
`GGGGCCCACAGCCACGTGCAACTACTCCAGTCCGGCGCCGAAGTGAAGAAACCCGGTGCT
`+
`+
`+
`+
`-f
`G A H S
`Q
`E
`K
`
`Q
`
`V
`
`Q
`
`L
`
`V
`
`S
`
`G
`
`A
`
`V
`
`K
`
`4
`
`P
`
`GA
`
`TCCGTGAAGCTGACXTGTAAAGCTAGCGGTTATACCTTCTCTXXXXXXXXXXXXXXXTGG
`1
`- - +-
`1
`+-
`1
`f
`S V K V S C K A S G Y T
`S X X X X XW
`_ X h ol
`GTTAGACACGCCCCAGGCCAAGGGCTCGAGTGGGTGGGCXXXX XXXXXXXXXXXX XXXXX
`
`F
`
`V P Q A P G O G L E H V G X X X X X XX
`
`XXXXXXXXXXXXJCXXXXXXXXXXXXXXXXXAGGGTTACCATGACCTTGGACACCTCTACA
`
`X X X X X X X X X X R V T M T
`
`L D T
`
`ST
`
`AACACCGCCTACATCGAACTGTCCAGCCTGCGCTCCGAGGACACTGCAGTCTACTACTGC
`
`N T A Y H E
`
`L
`
`S
`
`S
`
`L R S
`
`E D T A V Y YC
`
`GCCTCAX XXXXXXXXXXXX XX XX XX XX XXXXXXXXXXXX XXJCTGGGGACAGGGTACCCTT
`
`BamHI E c o RI
`GTCACCGTCAi
`.GTTCAGCTCAGTGCATCCGVATTC
`
`V T V S S
`
`Fig. 3. The nucleotide and amino acid sequences of the synthesized gene
`fragment coding for reshaped human VHa425 are shown. The leader
`sequence is underlined and residues contri