D3
`
`Targeted Expression of lL-11 in the Murine Airway Causes Lymphocytic
`Inflammation, Bronchial Remodeling, and AinNays Obstruction
`
`Weiliang Tang,* Gregory P. Geba,* Tao Zheng,* Prabir Ray,* Robert J. Homer}§ Charles Kuhn Ill,“ Richard A. Flavell,H
`and Jack A. Elias*
`
`*Department ofInternal Medicine, Section ofPulmonary and Critical Care Medicine, *Department ofPathology, and HDepartment of
`Immunobiology, Yale University School ofMedicine, New Haven, Connecticut 06520; §VA—CT Health Care System, West Haven,
`Connecticut 06516; and lDepartment ofPathology, Brown University School ofMedicine, Memorial Hospital othode Island,
`Pawtucket, Rhode Island 02860
`
`Abstract
`
`Interleukin-11 is a pleotropic cytokine produced by lung
`stromal cells in response to respiratory viruses, cytokines,
`and histamine. To further define its potential effector func-
`tions, the Clara cell 10-kD protein promoter was used to ex-
`press IL-11 and the airways of the resulting transgene mice
`were characterized. In contrast to transgene (—) littermates,
`the airways of IL-11 transgene (+) animals manifest nodu-
`lar peribronchiolar mononuclear cell infiltrates and impres-
`sive airways remodeling with subepithelial fibrosisThe in-
`flammatory foci contained large numbers of B220(+) and
`MHC Class II(+) cells and lesser numbers of CD3(+),
`CD4(+), and CD8(+) cells. The fibrotic response contained
`increased amounts of types III and I collagen, increased
`numbers of 01. smooth muscle actin and desmin-containing
`cells and a spectrum of stromal elements including fibro-
`blasts, myofibroblasts, and smooth muscle cells. Physiologic
`evaluation also demonstrated that 2-m0-old transgene (+)
`mice had increased airways resistance and non-specific air-
`ways hyperresponsiveness to methacholine when compared
`with their transgene (—) littermates. These studies demon-
`strate that the targeted expression of IL-11 in the mouse air-
`way causes a B and T cell—predominant inflammatory re-
`sponse, airway remodeling with increased types III and I
`collagen, the local accumulation of fibroblasts, myofibro-
`blasts, and myocytes, and obstructive physiologic dysregu-
`lation. IL-11 may play an important role in the inflamma-
`tory and fibrotic responses in viral and/or nonviral human
`airway disorders. (J. Clin. Invest. 1996. 98:2845—2853.) Key
`words: epithelial cell - fibrosis - cytokine - myofibroblast -
`collagen
`
`Introduction
`
`Obstructive airways disorders are a major cause of morbidity
`and mortality, with asthma affecting N 9—12 million people
`(1, 2), chronic obstructive pulmonary disease (COPD)1 affect-
`ing 12—14 million people (3), and bronchiolitis and bron-
`chiectasis affecting large numbers of people (4, 5)
`in the
`
`Address correspondence to Jack A. Elias, Yale University School of
`Medicine, Section of Pulmonary and Critical Care Medicine, Depart—
`ment of Internal Medicine, 333 Cedar Street, 105 LCI, New Haven,
`CT 06520. Phone: 203—785—4163; FAX: 203—785—3826.
`Received for publication 30 May I 996 and accepted in revised form
`10 October 1996.
`
`The Journal of Clinical Investigation
`Volume 98, Number 12, December 1996, 2845—2853
`
`United States alone. Chronic airway inflammation and airway
`remodeling (defined as fibrosis, matrix alterations, and/or
`changes in structural or resident cells of the airway wall) are
`important features of these disorders (15—11). However, the
`pathogenetic mechanisms that generate these responses and
`the relationship between these responses and the physiologic
`dysregulation characteristic of these disorders are poorly un-
`derstood.
`
`Respiratory viruses play an important role in obstructive
`disorders of the human airway. Viruses are important precipi-
`tants of asthmatic exacerbations (6, 12—15) and may similarly
`exacerbate COPD (16). In addition, epidemiologic investiga-
`tions have demonstrated important associations between infan-
`tile viral infections and the existence of asthma (12, 13, 17, 18),
`and pediatric infections and COPD (16, 19) in later life. These
`viral effects are felt to be mediated via a number of mecha-
`
`nisms, including the induction and modulation of local inflam-
`mation (10, 12, 20). Virus-stimulated cytokine production is
`increasingly understood to play a prominent role in the gener-
`ation of these inflammatory abnormalities (6, 21—23). The con-
`tribution(s) that each virus-stimulated cytokine makes to the
`pathologic and physiologic abnormalities characteristic of viral
`infections in hosts with normal and obstructed airways has,
`however, been inadequately investigated. In addition, we
`know little about the mechanism(s) by which pediatric viral in-
`fections and virus-induced cytokines predispose to airways dis-
`orders in later life.
`
`IL-11 was initially discovered as a plasmacytoma prolifera-
`tion stimulating activity in supernatants from transformed
`marrow fibroblasts (24, 25). In accordance with this finding,
`most studies of IL-11 have focused on its roles in hematopoie-
`sis (25). IL-11 has, however, been shown to have a variety of
`other bioactivities, including the ability to stimulate the acute
`phase response (25), augment the production of metallopro-
`teinase inhibitors (26, 27), increase immunoglobulin produc-
`tion (25, 28), and alter neural phenotype (29). Previous studies
`from our laboratory demonstrated that human lung fibroblasts
`and epithelial cells produce IL-11 in response to cytokines (IL-1
`and TGF-Bl), histamine, and viruses that have been epidemio-
`logically associated with asthmatic exacerbations (rhinovirus,
`respiratory syncytial virus [RSV], and parainfluenza virus type
`3, [PIV3]) (21, 30, 31). Our studies have also demonstrated
`that IL-11 can be found in the nasal secretions of children with
`
`viral upper respiratory tract infections and that IL-11 induces
`
`1. Abbreviations used in this paper: AHR, airways hyperresponsive—
`ness; BAL, bronchoalveolar lavage; CC10, clara cell 10—kD protein;
`COPD, chronic obstructive pulmonary disease; MCh, methacholine;
`PIV3, parainfluenza virus type 3; RSV, respiratory synctial virus.
`
`Transgenic Expression of Interleukin-II in the Mouse Airway
`
`2845
`
`Lassen — Exhibit 1009, p. l
`
`Lassen - Exhibit 1009, p. 1
`
`

`

`airways hyperresponsiveness (AHR) when inhaled in a tran-
`sient fashion into murine lungs (23). As a result of these obser-
`vations, we postulated that IL—11 plays an important role in the
`pathogenesis of human airway disorders, particularly those
`that are associated with viral infections.
`
`In keeping with the chronic nature of disorders such as
`asthma, COPD, bronchiectasis, and bronchiolitis, we addressed
`this hypothesis by defining the respiratory tract manifestations
`of IL-11 when chronically present in the respiratory tract. This
`was done by generating and evaluating the airways of trans-
`genic mice in which the Clara cell 10-kD protein (CC10) pro-
`moter was used to target IL-11 to the respiratory tree. These
`studies demonstrate that IL-11 causes impressive airway alter-
`ations with transgene (+) animals manifesting a nodular B and
`T cell—predominant peribronchiolar inflammatory response,
`bronchial remodeling with subepithelial fibrosis, and physiologic
`dysfunction characterized by airways obstruction and nonspe-
`cific AHR.
`
`Methods
`
`Production and identification of transgenic mice. To study the effec—
`tor functions of IL—11 in the airway, we took advantage of the fact
`that the murine respiratory tract epithelium contains 50—60% clara
`cells (32, 33). As previously described (32), we used the promoter of
`the CC10 gene to target the expression of human IL—11 to airway tis—
`sues. The rat CC10 promoter was a gift of Drs. Barry Stripp and Jef—
`frey Whitsett (34). It was isolated as a 2.3—kb HindIII fragment and
`subcloned into the HindIII site of construct pKS—SV40, yielding con—
`struct pKS—CC10—SV40. pKS—SV40 had been previously prepared by
`inserting a 0.85—kb BglII/BamHI fragment containing SV40 intronic
`and polyadenylation sites into the BamHI site in construct pBlue—
`script IIKS (Stratagene Inc., La Jolla, CA). The cDNA encoding hu—
`man IL—11 was a generous gift of Dr. Paul Schendel (Genetics Insti—
`tute, Cambridge, MA). It was isolated as a 1.2—kb EcoRI fragment,
`end filled with Klenow enzyme and subcloned into the EcoRV site in
`pKS—CC10—SV40 using standard techniques. All constructs were
`checked for correct orientation of the inserts by restriction enzyme
`digestion, and junction sequences were confirmed by sequencing. The
`resulting CC10—IL—11—SV40 construct was purified, digested with Asp
`718 and BamHI to generate the CC10—IL—11—SV40 fragment (Fig. 1),
`separated by electrophoresis through 1% agarose, and isolated by
`electroelution into dialysis tubing. The DNA fragment was then puri—
`fied through Elutip—D columns following the manufacturer’s instruc—
`tions (Schleicher and Schuell, Inc., Keene, NH) and dialyzed against
`injection buffer (0.5 mM Tris—HCl/25 mM EDTA, pH 7.5). Trans—
`genic mice were prepared in (CBA >< C57 BL/6) F2 eggs using stan—
`dard pronuclear injection as previously described (32, 35). The pres—
`ence or absence of the transgene was evaluated in offspring animals
`using tail—derived DNA. This was initially done by Southern blot
`analysis using 32P—labeled IL—11 cDNA as a probe. Similar results
`were obtained by PCR using 5’—CGACTGGACCGGCTGCTGC—3’
`and 5 ’—CTAACTAGGGGGAGATAATGGCGGGGGGA—3’ as up—
`per and lower primers, respectively. 35 cycles were performed. Each
`cycle was heated at 95°C for 1 min, annealed at 63°C for 1 min, and
`elongated at 72°C for 2 min.
`
`AS718
`Bam HI
`
`
`
`rat CC10 promoter
`human lL-ll (DNA SV40 sequence
`
`Tl
`+
`1.2 kb
`0.85 kb
`l‘
`2.3 kb
`
`Figure 1. Schematic illustration of CC10—IL—11 construct used in the
`preparation of the transgenic mice described in this manuscript.
`
`2846
`
`Tang et al.
`
`Bronchoalveolar lavage and quantification oflL-II levels. Mice
`were killed via cervical dislocation, a median sternotomy was per—
`formed, blood was obtained via right heart puncture and aspiration,
`and serum was prepared. The trachea was then isolated via blunt dis—
`section and small caliber tubing was inserted and secured in the air—
`way. Three successive washes of 0.75 ml PBS with 0.1% BSA were
`then instilled and gently aspirated. Each bronchoalveolar lavage
`(BAL) aliquot was centrifuged and the supernatants were harvested
`and stored individually at —70°C until ready to be used. The levels of
`IL—11 in the BAL fluid and serum were quantitated immunologically
`via ELISA and biologically using the B9.11 plasmacytoma prolifera—
`tion bioassay. The ELISA was performed as previously described by
`our laboratory (21, 30) using antibodies 11h3/15.6.1 and 11h3/19.6.1
`provided by Dr. Edward Alderman (Genetics Institute). The bioas—
`say was also performed as previously described by our laboratory
`(36, 37) using B9.11 cells also provided by Genetics Institute. Since
`both IL—6 and IL—11 can stimulate B9.11 cell proliferation, this assay
`was performed in the presence and absence of neutralizing antibodies
`against IL—11 (a gift of Dr. Alderman) and IL—6 (a gift of Dr. Pravin
`Sehgal, New York Medical College, Valhalla, NY) to assess the rela—
`tive contribution of each of these moieties.
`
`Northern analysis. Total cellular RNA from a variety of mouse
`tissues was obtained using guanidine isothiocyanate extraction and
`formaldehyde—agarose gel electrophoresis as previously described
`(21, 30). IL—11 gene expression was assessed by probing with 32P—
`labeled IL—11 cDNA. Equality of sample loading and efficiency of
`transfer were assessed via ethidium bromide staining.
`Histologic evaluation. Animals were killed via cervical disloca—
`tion, median stenotomies were performed, and right heart perfusion
`was accomplished with calcium and magnesium—free PBS to clear the
`intravascular space. The heart and lungs were then removed en bloc,
`inflated with 1 cc neutral buffered 10% formalin, fixed overnight in
`10% formalin, embedded in paraffin, and sectioned and stained. He—
`matoxylin and eosin, and Mallory’s trichrome stains were performed.
`Morphometric analysis. Morphometric study was carried out on
`mice aged 15 d, 1 mo, and 2 mo. The thickness of the walls of small
`airways from the base of the columnar epithelium to the outer limit of
`the adventitia was measured using an eye—piece reticle. Bronchioles
`< 250 mm in diameter that presented a closed circular or oval profile
`were selected and all measurements were made at 400 magnification
`to the nearest whole micrometer. The wall thickness was routinely
`evaluated at two points on opposite sides of the short axis of the ellip—
`tical profiles and measurements were made at locations where cell
`borders appeared sharp to minimize tangential sectioning. 5—12 air—
`ways were measured per mouse, mean 8.4. The presence or absence
`of lymphoid nodules was recorded for each bronchiolar profile,
`whether or not it was considered appropriate for measuring wall
`thickness. Statistical evaluations of the morphometric results were
`performed by the Bonferonni multiple comparisons test using Instat
`software for the Macintosh.
`
`the vascular tree
`lmmunohistochemistry. Animals were killed,
`was perfused, and the heart and lungs were removed en bloc as de—
`scribed above. The tissues were then processed using a number of ap—
`proaches. For evaluations of cell surface markers and subepithelial
`airway cellularity, lungs were inflated with 1 X PBS/33% (vol/vol)
`OCT tissue—tek compound (Miles Laboratories, Inc., Elkhart, IN)
`and snap frozen in OCT by submersion into 2—methylbutane cooled
`with dry ice. Tissue sections were cut, transferred onto silane—treated
`glass slides, fixed with acetone for 15 min, and stained with various
`antibody reagents
`as previously described (32). Sections were
`blocked with avidin—blocking kit (Vector Laboratories, Inc., Burlin—
`game, CA) and BSA before reaction with the desired biotinylated
`primary antibody. The slides were then washed three times (in 0.1 M
`Tris buffer, pH 7.5) and the tissue sections were incubated with a pre—
`diluted streptavidin—alkaline phosphatase solution (Vector Laborato—
`ries, Inc.) for 1 h. The sections were washed and developed using
`Vector red staining (Vector Laboratories, Inc.) in accordance with
`the manufacturer’s instructions. The slides were counter stained with
`
`Lassen — Exhibit 1009, p. 2
`
`Lassen - Exhibit 1009, p. 2
`
`

`

`Meyer’s hematoxylin, and then mounted with aqueous histologic
`mounting medium (Zymed Laboratories, Inc., So. San Francisco, CA).
`For types I and III collagen immunostaining, mouse lungs were
`chilled in acetone containing protease inhibitors (20 mM iodoaceta—
`mide and 2 mM phenylmethyl sulfonyl fluoride) at —20°C for 16—20 h.
`The lungs were then chopped into N 2 X 5 X 6 mm3 pieces and im—
`mersed three times in glycol methacrylate (GMA) monomer at 4°C
`for 6 h. The samples were then embedded in GMA according to the
`manufacturer’s instructions (JB4 Embedding Kit; Polysciences Inc.,
`Warrington, PA) and 2—ptm sections were cut and transferred onto si—
`lane—treated glass slides. Immunohistochemical staining was under—
`taken as described above except that sections were treated with 1 M
`citric acid (pH 3.0) for 2 h before staining, and primary antibody incu—
`bation took place at 4°C overnight.
`The antibodies that were employed and their sources are listed
`below. They included antibodies to CD3, CD4, CD8 (Gibco Labora—
`tories, Grand Island, NY), Mac—1 (Pharmingen, San Diego, CA),
`B220 (Pharmingen), MHC Class II (a gift from Dr. Kim Bottomly,
`Yale University), type I collagen (Chemicon International, Inc., Te—
`mecula, CA), type III collagen (a gift from Dr. J. Madri, Yale Univer—
`sity), OL-SIHOOth muscle actin (Sigma Chemical Co., St. Louis, MO),
`and desmin (Sigma Chemical Co.).
`Electron microscopy. Fragments of lung from three age— and sex—
`matched littermate pairs were fixed in 3% gluteraldehyde, postfixed
`in osmium tetroxide, and embedded in Epox 812 (Ernest F. Fulham,
`Inc., Latham, NY). Tissues were then cut onto grids, stained with ura—
`nyl acetate and lead nitrate, and examined in a Philips 300 micro—
`scope (Philips Electronic Instruments, Inc., Mahwah, NJ).
`Physiologic evaluation of transgenic mice. Age, sex, and weight
`matched littermate mice were anesthetized with pentobarbital (90
`mg/kg) and tracheostomized with an 18—gauge angiocatheter. Air—
`ways resistance was then measured using a modification of the tech—
`niques described by Martin et al. (38) as previously described (32).
`With these techniques, the changes in the lung volumes of anesthe—
`tized and tracheostomized mice were measured plethysmographically
`by determining the pressure in a Plexiglass chamber using an inline
`microswitch pressure transducer. Flow was measured by differentia—
`tion of the volume signal and transpulmonary pressure was deter—
`mined via a second Microswitch pressure transducer placed in line
`with the plethysmograph and animal ventilator. Resistance was then
`calculated using the method of Amdur and Mead (39). The resistance
`of the tracheostomy catheter was routinely eliminated. Baseline mea—
`surements of pulmonary resistance were obtained by ventilating the
`mouse in the plethysmograph at volumes of 0.4 ml at a rate of 150
`breaths per minute (settings previously shown to produce normal ar—
`terial blood gases in this species) (38). Bronchial reactivity was also
`assessed using noncumulative methacholine challenge procedures as
`previously described by our laboratory (32). In this procedure, in—
`creasing concentrations of methacholine (MCh) in PBS were admin—
`istered by nebulization (20 one—ml breaths) using a Devilbiss Aerosonic
`nebulizer (Model 5000; DeVilbiss Health Care, Somerset, PA) that
`produces particles 1—3 ptM in diameter. Pulmonary resistance was cal—
`culated precisely 1 min later. Stepwise increases in MCh dose were
`then given until the pulmonary resistance, in comparison with the
`baseline level, had at least doubled. All animals received serial three—
`fold increases in MCh from 1 to 100 mg/ml. The data are expressed as
`the PC100 (provocative challenge 100), the dose at which pulmonary
`resistance was 100% above the baseline level as calculated by linear
`regression analysis.
`Statistical analysis. Values are expressed as meansiSEM. Unless
`otherwise noted, group means are compared with the Student’s two
`tailed unpaired t test using the StatView software for the Macintosh.
`
`Results
`
`Generation of transgenic mice. To generate transgenic mice in
`which IL-11 is overproduced in a lung-specific/selective fash-
`
`Funnéers
`
`copy 4? controls
`
`242* 3-l Ill—2*
`
`35 34% 3-9
`
`3-40
`
`x4 x16 x64
`
`(~}littermate
`
`
`4—1.2 kl)
`
`1234567891011”
`
`Figure 2. Southern blot analysis of CC10—IL—11 mice. Tail DNA was
`obtained and the presence or absence of the CC10—IL—11 construct
`was determined using Southern blot analysis as described in Methods.
`The results obtained using tail DNA from transgene (+) founder ani—
`mals (lanes 2—8) are compared with a transgene (—) littermate (lane
`1) and copy number control (lanes 9—12).
`
`ion, pronuclear microinjections of the CC10-IL-11-SV40 con-
`struct were performed on two separate occasions. From these
`microinjections, seven animals with transgene copy numbers
`varying between 1 and 70 were obtained (Fig. 2). These
`founder animals were bred with C57 BL/6 mice and the trans-
`
`gene status of these offspring were similarly analyzed. This
`analysis demonstrated that the transgenes passed on to the off-
`
`Muuse Tissue RNA
`
`0
`
`me
`ta
`3:5m_
`
`Kidney Liver
`
`Lung Muscle
`
`Pancrea
`
`Spleen Uterus
`
`Skin
`
`
`S] HuIL-llcontrol
`
`
`Figure 3. Northern blot analysis of IL—11 mRNA expression in mouse
`organs. Total cellular RNA was isolated from the noted organs of
`transgene (+) CC10—IL—11 mice and the levels of IL—11 mRNA char—
`acterized using Northern blot analysis as described in Methods. The
`IL—11 mRNA in total cellular RNA from the different tissues is com—
`
`pared with the IL—11 mRNA in TGF—Bl (10 ng/ml)—stimulated human
`lung fibroblasts (Hu lL-II control). Ethidium bromide controls are in
`bottom panel.
`
`Transgenic Expression of Interleukin-11 in the Mouse Airway
`
`2847
`
`Lassen — Exhibit 1009, p. 3
`
`Lassen - Exhibit 1009, p. 3
`
`

`

`
`
`Figure 5. Histologic abnormalities in airways of CC10—IL—11 trans—
`genic mice. The lungs of transgene (+) and (—) animals were re—
`moved, fixed, and evaluated using hematoxylin and eosin and
`trichrome stains. The histologic appearance of the transgene (—)
`mouse lung (A) is compared with the peribronchiolar lymphocytic in—
`filtrates and bronchiolar thickening in the transgene (+) animals (B
`and C). The collagen content of the lungs of transgene (—) animals
`appears in green in D. This contrasts with the impressive subepithe—
`lial fibrosis seen in the airways of transgene (+) animals (E). (Origi—
`nal magnification 67.5>< .)
`
`Eflect ofIL-11 on murine airways. Progeny mice were killed
`at various intervals between 0.5 and 2 mo of age, and the air-
`ways of transgene (+) and (—) littermates were compared. A
`total of 78 age and sex matched littermate pairs were evalu-
`ated. In contrast with their transgene (—)
`littermates. the
`transgene (+) animals manifest an impressive airway pheno-
`type oomposed of: (a) nodular collections of lymphocyte-like
`cells next to bronchi and bronchioles. and (b) airway wall
`thickening and remodeling (Fig. 5. A—C). The collections of
`lymphocytes were appreciated less often in the 0.5-mo-old ani-
`mals. but were prominently noted in the 1- and 2-mo-old ani-
`mals (data not shown). The impressive and progressive effects
`of IL—11 on the thickness of the airway wall were easily seen in
`the morphometric evaluations (Fig. 6). Insight into the cause
`of this thickening and remodeling was obtained from the
`trichrome evaluations. These stains demonstrated only small
`amounts of collagen in the lungs of transgene (—) animals.
`This contrasted with the extensive subepithelial fibrosis seen in
`the airways of the IL—11 transgene (+) animals (Fig. 5,1) and E).
`Composition ofperibronchiolar nodules. The results noted
`above demonstrate that IL-11 overexpression in the murine
`airway generates nodular collections of lymphocyte-like mono-
`nuclear cells. The phenotype of these cells was. therefore. ana-
`lyzed by immunohistochemistry using frozen lung sections.
`These studies demonstrated that the majority of the cells in
`these nodules were MHC Class II (+) and B220 (+) (Fig. 7).
`Collections of CD3(+). CD4(+). and CD8(+) cells were also
`noted (Fig. 6). Significant Mac-1 immunoreactivity was not
`
`Lassen — Exhibit 1009, p. 4
`
`
`
`
`BAL
`__
`2/ Serum
`
`Positive
`Negative
`Transgene Status
`
`EB
`
`) 2
`i:
`V
`
`IL-11
`
`Figure 4. Levels of immunoreactive IL—11 in BAL fluid and serum of
`transgene (+) and ( —) littermates. The noted values represent the
`mean: SEM of the evaluations of four separate pairs of transgene
`(+) and (—) littermates (*P < 0.01 vs. serum of transgene (+) ani—
`mals and BAL and serum of transgene (—) animals; paired ttest).
`
`spring of these founder animals in a Mendelian fashion. Of
`these founders. lines 2-12 and 3-2 were chosen for more exten-
`sive analysis. Since they manifest similar pathologic. immuno-
`logic. and physiologic abnormalities. they will be discussed in a
`unified fashion.
`
`Organ specificity and intensity ofIL-1 1 gene expression and
`protein production. To determine if the CClO-IL—ll transgene
`was appropriately expressed. Northern analysis was used to
`compare the levels of IL-11 mRNA in the lungs and extrapul-
`monary organs of transgene (+) and (—) littermates. IL-ll
`mRNA was readily detected in the lungs of transgene (+) ani-
`mals. but could not be appreciated in the lungs of transgene
`(—) animals (Fig. 3 and data not shown). In accordance with in
`Vitro studies using fibroblasts and epithelial cells (21. 30). this
`IL-ll mRNA appeared to have one major and one minor tran-
`script. IL-11 gene expression also appeared to be appropri-
`ately targeted to the lung since human IL-ll mRNA was not
`detectable in the RNA from a variety of extrapulmonary organs
`(Fig. 3). In all cases. IL-ll mRNA appeared to be appropri-
`ately translated since IL-11 was easily detected immunologically
`and biologically in the BAL fluid of the transgene (+) animals.
`but not in the serum of transgene (+) animals or the serum or
`BAL fluid of transgene (—) littermates (Fig. 4 and Table I).
`
`Table I. IL-Il Bioactivity in BAL Fluids From Transgene (+)
`and (—) Animals
`
`[3H]-Tdr incorporationl
`
`Incubation conditions"
`
`No antibody
`
`+ AntiiIL-ll
`
`BAL (—)
`BAL (--)
`
`BAL (--)
`Negative control
`
`3,178:3,708
`57,383:5,351
`52,960:4,717
`1,896:101
`
`1,705il66
`5,568i378
`6,189:5,507
`—
`
`*BAL were performed on transgene (+) and (7) littermate F2 progeny
`of IL—11 transgenic mice. *B9.11 plasmacytoma [3H]—Tdr incorporation
`assessed in the presence and absence of anti—IL—ll. BAL plasmacy—
`toma—stimulating activities are compared with the proliferation (PH]—Tdr
`incorporation) of B911 cells incubated in medium alone (negative con—
`trol). Values represent the meaniSEM of triplicate determinations.
`
`2848
`
`Tang et al.
`
`Lassen - Exhibit 1009, p. 4
`
`

`

`
`
`Figure 8. Immunohistochemical analysis of fibrotic response in
`CC10—IL—11 transgenic mice. Immunohistochemistry was used to
`evaluate the type I collagen in the airways of transgene (+) (A) and
`(—) (C) animals and the type III collagen in the airways of transgene
`(+) (B) and (—) (D) animals. (Original magnification 50X.)
`
`Composition of the subepithelial fibrotic response. Studies
`were undertaken to determine if types I or III collagen were
`increased in the airways of the transgene (+) animals. These
`immunohistochemical evaluations demonstrated modest in-
`
`creases in type I collagen and impressive increases in type III
`collagen in transgene (+) vs. (—) animals (Fig. 8). Thus, the
`subepithelial fibrosis seen in CC10-IL-11 transgenic animals
`results, at least in part, from the increased accumulation of
`type III and, to a lesser extent, type I collagens.
`Immu-
`Structural characterization of the transgenic airway.
`nohistochemistry and electron microscopy were used to fur-
`ther characterize the cellular and structural alterations in the
`
`airways of the CC10-IL-11 transgene (+) animals. The immu-
`nohistochemical evaluations demonstrated an increase in the
`
`
`
`Figure 9. Immunohistochemical evaluation of subepithelial cellular—
`ity in CC10—IL—11 mice. Immunohistochemistry was used to evaluate
`the cellular components of the subepithelial fibrotic response in
`CC10—IL—11 transgene (+) and (—) animals. A and C represent the
`OL—SIHOOth muscle actin immunoreactivity in transgene (—) and (+)
`animals, respectively. B and D represent the desmin immunoreac—
`tivity in transgene (—) and (+) animals, respectively. (Original
`magnification 50>< .)
`
`Transgenic Expression of Interleukin-11 in the Mouse Airway
`
`2849
`
`Lassen — Exhibit 1009, p. 5
`
`*
`
`i
`
`*
`
`——0— Transgene (+)
`—O— Transgene (-)
`
`i
`
`0 . 5
`Age
`
`1 . 0
`(months)
`
`1 . 5
`
`2 . 0
`
`10
`
`8
`
`6
`
`4
`
`2
`
`. 0
`
`o0
`
`Ee
`
`.2
`E(I)
`m
`E.2
`if
`_
`
`E 3
`
`OE
`
`E
`
`O S m
`
`Figure 6. Morphometric analysis of airway wall thickening of
`CC10—IL—11 animals. The thickness of the bronchioles of 0.5—, 1—, and
`2—mo—old transgene (+) and (—) littermates were measured as de—
`scribed in Methods. Values represent the mean: SEM of at least
`three pairs of animals at each time point (*P < 0.001 Bonferonni
`Multiple comparisons test).
`
`appreciated with only a rare cell staining with this antibody
`(Fig. 7). None of the antibodies that were used reacted with
`the airways in sections of lung from transgene (—) mice, in
`great extent because of the lack of airway inflammation in
`these animals (data not shown). These observations demonstrate
`that these nodules are composed of large numbers of B lym-
`phocytes and lesser numbers of CD4(+) and CD8(+) T cells.
`
`
`
`
`
`Figure 7. Immunohistochemistry of peribronchiolar nodular infil—
`trates. Immunohistochemical techniques were used to evaluate the
`cellular composition of the peribronchiolar infiltrates seen in the
`transgene (+) CC10—IL—11 animals. Antibodies against B220 (A),
`MHC class II (B), CD3 (C), CD4 (D), CD8 (E), and Mac—1 (F) were
`employed. (Original magnification 50>< .)
`
`Lassen - Exhibit 1009, p. 5
`
`

`

`
`
`
`
`
`
`Figure 10. Electron microscopic ap—
`pearance of peripheral airway of
`CC10—IL—11 mice. (A) Low power
`View of airway wall with epithelial
`cells (EP), myocytes (M), and fibro—
`blastic cells (P). Note intact base—
`ment membrane (open arrows) and
`collagen deposition (C) (4,000><).
`(B) Smooth muscle cell with well
`formed Golgi (G). Note myofilaments
`(MF) (18,000X ). (C) Fibroblast with
`rough endoplasmic reticulum (RER)
`(18,000X). (D) Myofibroblast with
`subplasmalemmal dense body (open
`arrow) and basal lamina (closed
`arrow) (36,000X). (E) Myofibro—
`blast with myofilaments (MF) and
`subplasmalemmal vesicles (open
`arrow) (36,000X).
`
`number of Cl smooth muscle actin and desmin staining cells in
`the walls of the transgene (+) vs. (—) animals (Fig. 9). This
`staining was not uniform. however. with some stromal cells
`failing to manifest either of these markers. The electron micro-
`graphs demonstrated that the CC10-IL-11 transgene (+) ani-
`mals had normal basement membranes and enhanced striated
`
`collagen deposition (Fig. 10). They also demonstrated the ac-
`cumulation of a variety of stromal cells in these fibrotic loca-
`tions. Ultrastructurally. many cells appeared to be fibroblasts.
`Others appeared to be myofibroblasts based on their fibro-
`blast-like appearance and the presence of myofilaments. dense
`bodies. subplasmalemmal vesicles. and/or identifiable basal
`lamina (Fig. 10 and data not shown). Smooth muscle cells with
`abundant myofilaments were also appreciated. Some of these
`cells showed morphologic evidence of increased synthetic ac-
`tivity with increased rough endoplasmic reticulum and promi-
`nent Golgi (Fig. 10). Thus. the subepithelial response in the
`airways of the CC10-IL-11 transgene (+) animals occurs in the
`absence of basement membrane thickening and is character-
`ized by increased interstitial collagen deposition and height-
`ened stromal cellularity with the local accumulation of fibro-
`blasts. myofibroblasts. and smooth muscle cells.
`Effect of IL-1 1 on airway physiology. Airways obstruction
`and hyperresponsiveness to nonspecific stimuli such as MCh
`are prominent features of asthma. COPD. and a variety of dis-
`eases characterized by chronic airways inflammation and/or
`
`2850
`
`Tang et al.
`
`
`
`fibrosis, Thus. studies were undertaken to characterize the
`physiologic profile of IL-11 transgene (+) and (—) animals.
`Overall. 18 age. sex. and weight matched littermate pairs were
`evaluated. The baseline airways resistance of IL-11 transgene
`(--) animals greatly exceeded that of IL-11 transgene (—) ani-
`mals. At 2 mo of age. the airways resistance of the transgene
`(--) animals was approximately threefold greater than the
`resistance of the transgene (—) animals (7453:2275 vs.
`227.5:64 cm HzO/liters per s; P < 0.05). In addition. 1.5—2-
`mo-old transgene (+) animals manifest exaggerated sensitivity
`to methacholine since they achieved a 100% increase in air-
`ways resistance at 1/10 to 1/100 the dose of methacholine re-
`quired by their transgene (—) littermate controls (Fig. 11).
`When viewed in combination. these studies demonstrate that
`IL-11 transgene (+) animals manifest increased airways resis-
`tance and airways hyperresponsiveness to MCh when com-
`pared with transgene (—) littermate controls.
`
`Discussion
`
`Airway inflammation and fibrosis are prominent features of a
`variety of disorders including asthma. COPD. bronchiectasis.
`and bronchiolitis (3—11). In these disorders. the relationship(s)
`between inflammation. fibrosis, and physiologic dysregulation.
`and the contribution that individual mediators make to the
`
`pathogenesis of these abnormalities are poorly understood.
`
`Lassen — Exhibit 1009, p. 6
`
`Lassen - Exhibit 1009, p. 6
`
`

`

`300'
`
`200'
`
`baseline)
`
`RespiratoryResistance(%Increaseover
`
`100‘
`
`0
`
`1
`
`V
`
`'
`
`1'0
`
`1 00
`
`log MCh Dose (mg/ml)
`
`Figure 11. Methacholine sensitivity of transgene (—) and (+) mice.
`The effect of varying concentrations of methacholine on the airways
`resistance of paired transgene (+) (O) and transgene (—) (I) litter—
`mates were evaluated as described in Methods. Values represent the
`mean: SEM of six age and sex matched littermates evaluated on the
`same day (*P < 0.05, **P < 0.01, ttest).
`
`This is due. in great extent. to the complexity of the inflamma-
`tory and fibrotic responses in these disorders. which precludes
`the clear attribution of cause and effect. It is also the result of
`
`our need to rely on in Vitro and acute challenge in Vivo proto-
`cols in our modeling of these disorders. The limitations of our
`present approach are nicely illustrated with IL-11. In Vitro
`studies from our laboratory and others have clearly demon-
`strated that this cytokine is produced by a