throbber
US010106603B2
`
`( 12 ) United States Patent
`Cook et al .
`
`( 10 ) Patent No . : US 10 , 106 , 603 B2
`( 45 ) Date of Patent :
`Oct . 23 , 2018
`
`( 54 ) TREATMENT OF FIBROSIS
`( 71 ) Applicants : Singapore Health Services PTE LTD . ,
`Singapore ( SG ) ; National University of
`Singapore , Singapore ( SG )
`( 72 ) Inventors : Stuart Alexander Cook , Singapore
`( SG ) ; Sebastian Schaefer , Singapore
`( SG )
`( 73 ) Assignees : Singapore Health Services PTE LTD ,
`Singapore ( SG ) ; National University of
`Singapore , Singapore ( SG )
`Subject to any disclaimer , the term of this
`patent is extended or adjusted under 35
`U . S . C . 154 ( b ) by 0 days .
`( 21 ) Appl . No . : 15 / 988 , 463
`May 24 , 2018
`( 22 )
`Filed :
`Prior Publication Data
`( 65 )
`US 2018 / 0265579 A1 Sep . 20 , 2018
`
`( * ) Notice :
`
`Related U . S . Application Data
`( 62 ) Division of application No . 15 / 381 , 622 , filed on Dec .
`16 , 2016 , now Pat . No . 10 , 035 , 852 .
`Foreign Application Priority Data
`( 30 )
`Dec . 16 , 2015
`( GB ) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1522186 . 4
`( 51 ) Int . Ci .
`A61K 39 / 395
`COOK 16 / 24
`A61K 39 / 00
`( 52 ) U . S . CI .
`CPC . . . . . . CO7K 16 / 244 ( 2013 . 01 ) ; A61K 2039 / 505
`( 2013 . 01 ) ; A61K 2039 / 54 ( 2013 . 01 ) ; COOK
`2317 / 20 ( 2013 . 01 ) ; CO7K 2317 / 76 ( 2013 . 01 )
`( 58 ) Field of Classification Search
`. . . . A61K 2039 / 505
`CPC . . . . . . . . . . .
`See application file for complete search history .
`
`( 2006 . 01 )
`( 2006 . 01 )
`( 2006 . 01 )
`
`( 56 )
`
`References Cited
`U . S . PATENT DOCUMENTS
`5 , 679 , 339 A
`10 / 1997 Keith et al .
`6 , 126 , 933 A
`10 / 2000 Warne et al .
`6 , 540 , 993 B14 / 2003 Warne et al .
`6 , 846 , 907 B1
`1 / 2005 Shaughnessy et al .
`6 , 953 , 777 B2 10 / 2005 Keith et al .
`6 , 998 , 123 B1
`2 / 2006 Shaughnessy et al .
`7 , 993 , 637 B2
`8 / 2011 Baca
`8 , 182 , 814 B2
`5 / 2012 Baca et al .
`8 , 361 , 966 B2
`1 / 2013 Azuma et al .
`8 , 518 , 888 B2
`8 / 2013 Jenkins et al .
`8 , 540 , 977 B2
`9 / 2013 Baca
`9 , 340 , 618 B2
`5 / 2016 Edwards et al .
`2003 / 0147849 Al 8 / 2003 Warne et al .
`2004 / 0126358 AL
`7 / 2004 Warne et al .
`2004 / 0142871 Al
`7 / 2004 Shaughnessy et al .
`2006 / 0062760 A1
`3 / 2006 Keith et al .
`2007 / 0160577 A1 7 / 2007 Damle et al .
`
`7 / 2009 Keith et al .
`2009 / 0191147 A1
`8 / 2009 Baca et al .
`2009 / 0202533 Al
`3 / 2010 Warne et al .
`2010 / 0062058 A1
`4 / 2010 Azuma et al .
`2010 / 0093976 A1
`7 / 2010 Jenkins et al .
`2010 / 0183544 A1
`11 / 2013 Jenkins et al .
`2013 / 0302277 AL
`8 / 2014 Edwards et al .
`2014 / 02 19919 AL
`2 / 2016 Edwards et al .
`2016 / 0031999 A1
`2017 / 0174759 Al
`6 / 2017 Cook et al .
`FOREIGN PATENT DOCUMENTS
`1630232 A2
`3 / 2006
`20110047179 A
`5 / 2011
`WO 1996 / 019574 A
`6 / 1996
`WO 1998 / 36061 A2
`8 / 1998
`WO 1999 / 020755 A2
`4 / 1999
`WO 2000 / 078336 A112 / 2000
`WO 2002 / 020609 A2
`3 / 2002
`WO 2005 / 058956 A
`6 / 2005
`WO 2005 / 070446 A1
`8 / 2005
`WO 2005 / 098041 A2 10 / 2005
`WO 2009 / 052588 A1
`4 / 2009
`WO 2014 / 121325 Al 8 / 2014
`WO 2017 / 103108 AL
`6 / 2017
`
`EP
`KR
`wo
`Wo
`WO
`WO
`wo
`WO
`WO
`WO
`WO
`WO
`WO
`
`OTHER PUBLICATIONS
`International Search Report and Written Opinion for International
`Patent Application No . PCT / EP2016 / 081430 , dated Apr . 18 , 2017 .
`Chapter II Demand filed Aug . 14 , 2017 for International Patent
`Application No . PCT / EP2016 / 081430 .
`International Preliminary Report on Patentability ( Chapter II ) for
`International Patent Application No . PCT / EP2016 / 081430 , dated
`Nov . 6 , 2017
`Third Party Submission Under 37 C . F . R . $ 1 . 290 for U . S . Appl . No .
`15 / 381 , 622 , filed Apr . 30 , 2018
`Ancey et al . , A fusion protein of the gp130 and interleukin - 6Ralpha
`ligand - binding domains acts as a potent interleukin - 6 inhibitor . J
`Biol Chem . May 9 , 2003 ; 278 ( 19 ) : 16968 - 72
`Bravo et al . , Crystal structure of a cytokine - binding region of
`gp130 . EMBO J . Mar . 16 , 1998 ; 17 ( 6 ) : 1665 - 74 .
`Chen et al . , IL - 11 receptor alpha in the pathogenesis of IL - 13
`induced inflammation and remodeling . J Immunol . Feb . 15 ,
`2005 ; 174 ( 4 ) : 2305 - 13 .
`Du et al . , Interleukin - 11 : review of molecular , cell biology , and
`clinical use . Blood . Jun . 1 , 1997 ; 89 ( 11 ) : 3897 - 908 .
`Garbers et al . , Interleukin - 6 and interleukin - 11 : same same but
`different . Biol Chem . Sep . 2013 ; 394 ( 9 ) : 1145 - 61 . doi : 10 . 1515 / hsz
`2013 - 0166 .
`( Continued )
`
`Primary Examiner — Prema M Mertz
`( 74 ) Attorney , Agent , or Firm — Wolf , Greenfield &
`Sacks , P . C .
`
`ABSTRACT
`( 57 )
`Aspects of the disclosure relate to the treatment , prevention
`or alleviation of conditions such as fibrosis in a subject . In
`some embodiments , the treatment , prevention or alleviation
`of fibrosis in a subject through the administration of an agent
`capable of inhibiting the action of Interleukin 11 ( IL - 11 ) is
`disclosed .
`
`10 Claims , 66 Drawing Sheets
`Specification includes a Sequence Listing .
`
`Lassen - Exhibit 1001, p. 1
`
`

`

`US 10 , 106 , 603 B2
`Page 2
`
`( 56 )
`
`References Cited
`
`OTHER PUBLICATIONS
`Gu et al . , Anti - gp130 transducer monoclonal antibodies specifically
`inhibiting ciliary neurotrophic factor , interleukin - 6 , interleukin - 11 ,
`leukemia inhibitory factor or oncostatin M J Immunol Methods .
`Mar . 28 , 1996 ; 190 ( 1 ) : 21 - 7 .
`Halwani et al . , Airway remodeling in asthma . Curr Opin Pharmacol .
`Jun . 2010 ; 10 ( 3 ) : 236 - 45 . doi : 10 . 1016 / j . coph . 2010 . 06 . 004 .
`Ham et al . , Critical role of interleukin - 11 in isoflurane - mediated
`protection against ischemic acute kidney injury in mice . Anesthe
`siology . Dec . 2013 ; 1 19 ( 6 ) : 1389 - 401 . doi : 10 . 1097 I ALN . ObO 1
`3e3 1 82a950da .
`Kapina et al . , Interleukin - 11 drives early lung inflammation during
`Mycobacterium tuberculosis infection in genetically susceptible
`mice . PLoS One . 2011 ; 6 ( 7 ) : e21878 . doi : 10 . 1371 / journal . pone .
`0021878 .
`Khan et al . , Fibrosis in heart disease : understanding the role of
`transforming growth factor - beta in cardiomyopathy , valvular dis
`ease and arrhythmia . Immunology . May 2006 ; 118 ( 1 ) : 10 - 24 .
`Kimura et al . , Identification of cardiac myocytes as the target of
`interleukin 11 , a cardioprotective cytokine . Cytokine . May
`2007 ; 38 ( 2 ) : 107 - 15 .
`Lee et al . , Cysteinyl leukotriene upregulates IL - 11 expression in
`allergic airway disease of mice . J Allergy Clin Immunol . Jan .
`2007 ; 119 ( 1 ) : 141 - 9 .
`Lee et al . , Endogenous IL - 11 signaling is essential in Th2 - and
`IL - 13 - induced inflammation and mucus production . Am J Respir
`Cell Mol Biol . Dec . 2008 ; 39 ( 6 ) : 739 - 46 . doi : 10 . 1165 / rcmb . 2008
`00530C . Epub Jul . 10 , 2008 .
`Lindahl et al . , Microarray profiling reveals suppressed interferon
`stimulated gene program in fibroblasts from scleroderma - associated
`interstitial lung disease . Respir Res . Aug . 2 , 2013 ; 14 : 80 . doi :
`10 . 1186 / 1465 - 9921 - 14 - 80 .
`Lokau et al . , Proteolytic Cleavage Governs Interleukin - 11 Trans
`signaling . Cell Rep . Feb . 23 , 2016 ; 14 ( 7 ) : 1761 - 1773 . doi : 10 . 1016 /
`j . celrep . 2016 . 01 . 053 . Epub Feb . 11 , 2016 .
`Lokau et al . , Signal transduction of Interleukin - 11 and Interleukin - 6
`a - Receptors . Recep Clin Investigation . 2016 ; 3 . 5 pages .
`Minshall et al . , IL - 11 expression is increased in severe asthma :
`association with epithelial cells and eosinophils . J Allergy Clin
`Immunol . Feb . 2000 ; 105 ( 2 Pt 1 ) : 232 - 8 .
`Molet et al . , IL - 11 and IL - 17 expression in nasal polyps : relation
`ship to collagen deposition and suppression by intranasal fluticasone
`propionate . Laryngoscope . Oct . 2003 ; 113 ( 10 ) : 1803 - 12 .
`Murray et al . , Targeting interleukin - 13 with tralokinumab attenuates
`lung fibrosis and epithelial damage in a humanized SCID idiopathic
`pulmonary fibrosis model . Am J Respir Cell Mol Biol . May
`2014 ; 50 ( 5 ) : 985 - 94 . doi : 10 . 1165 / rcmb . 2013 - 03420C .
`Obana et al . , Therapeutic activation of signal transducer and acti
`vator of transcription 3 by interleukin - 11 ameliorates cardiac fibro
`sis after myocardial infarction . Circulation . Feb . 9 , 2010 ; 121 ( 5 ) : 684
`91 . doi : 10 . 1161 / CIRCULATIONAHA . 109 . 893677 .
`Obana et al . , Therapeutic administration of IL - 11 exhibits the
`postconditioning effects against ischemia - reperfusion injury via
`STAT3 in the heart . Am J Physiol Heart Circ Physiol . Sep . 1 ,
`2012 ; 303 ( 5 ) : H569 - 77 . doi : 10 . 1152 / ajpheart . 00060 . 2012 .
`
`Ray et al . , Regulated overexpression of interleukin 11 in the lung .
`Use to dissociate development - dependent and - independent pheno
`types . J Clin Invest . Nov . 15 , 1997 ; 100 ( 10 ) : 2501 - 11 .
`Schafer et al . , IL - 11 is a crucial determinant of cardiovascular
`fibrosis . Nature . Dec . 7 , 2017 ; 552 ( 7683 ) : 110 - 115 . doi : 10 . 1038 /
`nature24676 . Epub Nov . 13 , 2017 .
`Shepelkova et al . , Therapeutic Effect of Recombinant Mutated
`Interleukin 11 in the Mouse Model of Tuberculosis . J Infect Dis .
`Aug . 1 , 2016 ; 214 ( 3 ) : 496 - 501 . doi : 10 . 1093 / infdis / jiw176 .
`Stangou et al . , Effect of IL - 11 on glomerular expression of TGF
`beta and extracellular matrix in nephrotoxic nephritis in Wistar
`Kyoto rats . J Nephrol . Jan . - Feb . 2011 ; 24 ( 1 ) : 106 - 11 .
`Tang et al . , Targeted expression of IL - 11 in the murine airway
`causes lymphocytic inflammation , bronchial remodeling , and air
`ways obstruction . J Clin Invest . Dec . 15 , 1996 ; 98 ( 12 ) : 2845 - 53 .
`Tang et al . , Transforming growth factor - beta stimulates interleukin
`11 transcription via complex activating protein - 1 - dependent path
`ways . J Biol Chem . Mar . 6 , 1998 ; 273 ( 10 ) : 5506 - 13 .
`Toda et al . , Polarized in vivo expression of IL - 11 and IL - 17 between
`acute and chronic skin lesions . J Allergy Clin Immunol . Apr .
`2003 ; 111 ( 4 ) : 875 - 81 .
`Trepicchio et al . , The therapeutic utility of Interleukin - 11 in the
`treatment of inflammatory disease . Expert Opin Investig Drugs .
`Sep . 1998 ; 7 ( 9 ) : 1501 - 4 .
`Wynn , Cellular and molecular mechanisms of fibrosis . J Pathol . Jan .
`2008 ; 214 ( 2 ) : 199 - 210 .
`Yashiro et al . , Transforming growth factor - beta stimulates interleukin
`11 production by human periodontal ligament and gingival fibroblasts .
`J Clin Periodontol . Mar . 2006 ; 33 ( 3 ) : 165 - 71 .
`Zhu et al . , IL - 11 Attenuates Liver Ischemia / Reperfusion Injury ( IRI )
`through STAT3 Signaling Pathway in Mice . PLoS One . May 6 ,
`2015 ; 10 ( 5 ) : e0126296 . doi : 10 . 1371 / journal . pone . 0126296 .
`U . S . Appl . No . 15 / 381 , 622 , filed Dec . 16 , 2016 , Cook et al .
`PCT / EP2016 / 081430 , Nov . 6 , 2017 , International Preliminary Report
`on Patentability .
`PCT / EP2016 / 081430 , Apr . 18 , 2017 , International Search Report
`and Written Opinion .
`Metz et al . , Characterization of the Interleukin ( IL ) - 6 Inhibitor
`IL - 6 - RFP : fused receptor domains act as high affinity cytokine
`binding proteins . J Biol Chem . Jan . 12 , 2007 ; 282 ( 2 ) : 1238 - 48 . Epub
`Nov . 3 , 2006 .
`Chow et al . , Structure of an extracellular gp130 cytokine receptor
`signaling complex . Science . Mar . 16 , 2001 ; 291 ( 5511 ) : 2150 - 5 .
`Johnstone et al . , Emerging roles for IL - 11 signaling in cancer
`development and progression : Focus on breast cancer . Cytokine
`Growth Factor Rev . Oct . 2015 ; 26 ( 5 ) : 489 - 98 . doi : 10 . 1016 / j . cytogfr .
`2015 . 07 . 015 . Epub Jul . 14 , 2015 .
`Lemoli et al . , Interleukin - 11 ( IL - 11 ) acts as a synergistic factor for
`the proliferation of human myeloid leukaemic cells . Br J Haematol .
`Oct . 1995 ; 91 ( 2 ) : 319 - 26 .
`[ No Author Listed ] Recombinant Human Anti - human I111 Anti
`body . Creative Biolabs . May 8 , 2018 .
`Putoczki et al . , Interleukin - 11 is the dominant IL - 6 family cytokine
`during gastrointestinal tumorigenesis and can be targeted therapeu
`tically . Cancer Cell . Aug . 12 , 2013 ; 24 ( 2 ) : 257 - 71 . doi : 10 . 1016 / j .
`ccr . 2013 . 06 . 017 .
`Sommer et al . , Constitutively active mutant gp130 receptor protein
`from inflammatory hepatocellular adenoma is inhibited by an anti
`gp130 antibody that specifically neutralizes interleukin 11 signaling .
`J Biol Chem . Apr . 20 , 2012 ; 287 ( 17 ) : 13743 - 51 . doi : 10 . 1074 / jbc .
`M111 . 349167 .
`
`Lassen - Exhibit 1001, p. 2
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 1 of 66
`
`US 10 , 106 , 603 B2
`
`* * *
`*
`
`*
`* * * *
`*
`* * *
`*
`
`* * * * * * * * * * * *
`* * * * * * * *
`
`* * * * * * * * *
`
`* * * * * * *
`* * * * * * *
`* *
`
`25 TGEBA
`
`20
`
`15
`
`???????????????????????????????????????????????? . 10
`
`?
`
`Figure 1B
`
`Figure ID
`
`N1
`
`TGF01
`
`
`
`Al Expressed Genes
`
`( sjundo OL
`
`L
`
`Figure 1A
`
`Figure 1C
`
`Lassen - Exhibit 1001, p. 3
`
`

`

`U . S . Patent
`
`atent
`
`Oct . 23 , 2018
`
`Sheet 2 of 66
`
`US 10 , 106 , 603 B2
`
`Figure 2B
`
`W
`
`Figure 2D
`
`w
`
`Tofen
`
`-
`
`Figure 2A
`
`Figure 20
`
`Lassen - Exhibit 1001, p. 4
`
`

`

`U . S . Patent
`
`atent
`
`Oct . 2
`
`Oct . 23 , 2018
`
`Sheet 3 of 66
`
`US 10 , 106 , 603 B2
`
`
`
`PCS BOLA
`
`* * * * * *
`
`* * *
`
`* * * * * * * * * * * * * * *
`
`Figure 3B
`
`Figure 3A
`
`88
`
`+ 1 +
`
`-
`
`TOFB1 * 196
`
`Lassen - Exhibit 1001, p. 5
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 4 of 66
`
`US 10 , 106 , 603 B2
`
`Figure 30
`
`Figure 3D
`
`Lassen - Exhibit 1001, p. 6
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 5 of 66
`
`US 10 , 106 , 603 B2
`
`. 4 . 4 . 4 . 5 . 6 . 6 . 0 . 1
`
`. .
`
`,
`
`22
`TA
`
`W
`
`.
`
`. - .
`
`- . - . -
`
`Upregulated in Fibrosis
`
`. . .
`
`.
`
`0002
`
`*
`
`*
`
`*
`
`00000000000
`
`
`
`Fold Change
`
`Figure 4A
`
`. - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . - . Downregulated in Fibrosis
`
`TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
`
`Lassen - Exhibit 1001, p. 7
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 6 of 66
`
`US 10 , 106 , 603 B2
`
`?t ?xn811
`
`mo
`
`n tat
`
`tdessenwiewirawwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwdown
`
`*
`
`
`
`IL11 Expression
`
`Lassen - Exhibit 1001, p. 8
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 7 of 66
`
`US 10 , 106 , 603 B2
`
`Figure 5B
`
`Figure 5D
`
`241
`
`ah
`# I
`zh
`
`* * * * *
`
`11212121
`
`.
`
`
`
` ( pg IL11 protein ' m
`
`
`
`
`
`* * *
`
`11 . 11
`
`What
`wowowerererer
`
`Figure 5A
`
`VNY LL LLON
`
`Figure 5C
`
`Lassen - Exhibit 1001, p. 9
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 8 of 66
`
`US 10 , 106 , 603 B2
`
`??????io ??? "
`
`Figure 6B
`
`Figure 6A
`
`Lassen - Exhibit 1001, p. 10
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 9 of 66
`
`US 10 , 106 , 603 B2
`
`Figure 6D
`
`Figure 6F
`
`monologen
`
`w
`
`* * * *
`
`* *
`
`* *
`
`* *
`
`* *
`
`* *
`
`woor
`
`VVV
`
`Figure 6C
`
`Figure 6E
`
`Lassen - Exhibit 1001, p. 11
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 10 of 66
`
`US 10 , 106 , 603 B2
`
`w
`
`Figure 7A
`
`Figure 7B
`
`.
`
`Figure 70
`
`???????
`
`rrrrrrrrryce
`
`Lassen - Exhibit 1001, p. 12
`
`

`

`U . S . Patent
`
`atent
`
`Oct . 23 , 2018
`
`Sheet 11 of 66
`
`US 10 , 106 , 603 B2
`
`Figure 8B
`
`VAAN
`
`914
`
`Figure 8A
`
`Figure 8D
`
`Fibroblasts
`
`.
`
`VE
`
`Dermal Fibroblasts
`
`
`Hepatic Renal Pulmonary
`VY
`
`PA
`
`image
`
`Control
`
`Figure 8C
`
`1000
`
`Heart
`Lund
`Kidney
`60
`
`mesmo .
`Liver
`
`wandernemendamentelor
`wa
`. Collagen
`Norm
`
`
`
`
`
`
`Dermal Fibroblasts Renal Pulmonary
`Hepatic
`
`Lassen - Exhibit 1001, p. 13
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 12 of 66
`
`US 10 , 106 , 603 B2
`
`Kidney
`
`Heart
`
`WWWWWWWWWWW
`
`wwwwww
`
`wwwwwwwwwwwwwwwwwwwwwww
`
`XXX XXXXXX
`
`Figure 8E
`
`Lassen - Exhibit 1001, p. 14
`
`

`

`U . S . Patent
`
`
`
`Tissue Injury
`
`21
`
`2838
`
`Opholog1010101010101010100101011000000101010
`
`Oct . 23 , 2018
`
`Sheet 13 of 66
`
`US 10 , 106 , 603 B2
`
`* * *
`
`V
`
`.
`
`1
`
`. 29
`
`de
`
`27 .
`
`
`
`Fibrotic Response
`
`Figure 9
`
`erse
`
`3
`
`???? ??
`
`Lassen - Exhibit 1001, p. 15
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 14 of 66
`
`US 10 , 106 , 603 B2
`
`
`
`Collagen Production
`
`OOOOO
`
`PDGF -
`ET - 1 ww
`anti - L11 -
`
`Foto 1
`-
`
`OOOO
`
`1
`
`ogle
`
`AVALUORUUUUU
`
`* * Filt !
`
`????????
`
`.
`
`VALUUUUUU
`
`+
`-
`
`+
`we
`o
`
`Figure 10
`
`Lassen - Exhibit 1001, p. 16
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 15 of 66
`
`US 10 , 106 , 603 B2
`
`mmmm .
`
`ACTGCCGCGGCCCTGCTGCICAGGGCACATGCCTCCCCTCCCCAGGCCGCGCCCCAGCIGACCCICGGGG
`CICCCCCGGCAGCGGACAGGGAAGGGTTAAAGGCCCCCGGCTCCCTGCCCCCTGCCCIGGGGAACCCCIG
`GCCCTGTGGGGACATGAACTGTGTTTGCCGCCTGGTCCTGGTCGTGCIGAGCCTGTGGCCAGATACAGCT
`GTCGCCCCTGGGCCACCACCTGGCCCCCCTCGAGTITCOCCAGACCCICGGGCCGAGCIGGACAGCACCG
`TGCICCTGACCCGCICICICCIGGCGGACACGCGGCAGCTGGCTGCACAGCIGAGGGACAAATTCCCAGO
`TGACGGGGACCACAACCTGGATTCCCTGCCCACCCTGGCCATGAGTGCGGGGGCACTGGGAGCTCTACAG
`CICCCAGGTGIGCTGACAAGGCTGCGAGCGGACCTACTGTCCTACCTGCGGCACGTGCAGTGGCTGCGCC
`GGGCAGGTGGCTCTTCCCTGAAGACCCTGGAGCCCGAGCTGGGCACCCTGCAGGCCCGACTGGACCGGCT
`GCTGCGCCGGCTGCAGCICCIGATGTOCCGCCTGGCCCTGCCCCAGCCACCCCCGGACCCGCCGGCGCCO
`CCGCTGGCGCCCCCCTCCTCAGCCIGGGGGGGCATCAGGGCCGCCCACGCCATCCTGGGGGGGCTGCACC
`TGACACTIGACIGGGCCGTGAGGGGACTGCTGCTGCTGAAGACTCGGCIGTGACCCGGGGCCCAAAGCCA
`CCACCGTBOLO AANGOUAGA OODATTTATTTATTTATTICAGTACTGGGGGCGAAACAGCCAGGIGA
`TCCCCCCGCCATTATCTCCCCCTAGTTAGAGACAGTCCTTCCGTGAGGCCTGGGGGGCATCTGTGCCTTA
`TITATACTTATITATTICAGGAGCAGGGGTGGGAGGCAGGTGGACTCCTGGGTCCCCGAGGAGGAGGGGA
`CIGGGGTCCCGGATTCTTGGGICTCCAAGAAGTCTGTCCACAGACTTCTGCCCIGGCICTTCCCCAICTA
`GECSKEGGUAEGLAGAHAR TATTTATTTAAGCAATTACTTTTCATGTTGGGGTGGGGACGGAGGGGAA
`AGGGAAGCCTGGGTTITIGTACAAAAATGTGAGAAACCITIGTGAGACAGAGAACAGGGAATTAAATGIG
`TCATACATATCCACTTGAGGGCGATTTGTCTGAGAGCTGGGGCIGGATGCTTGGGTAACTGGGGCAGGGO
`AGGTGGAGGGGAGACCTCCATICAGGTGGAGGICCCGAGIGGGCGGGGCAGCGACTGGGAGATGGGICGG
`ICACCCAGACAGCICTGIGGAGGCAGGGTCTGAGCCTIGCCTGGGGCCCCGCACIGCATAGGGCCTTTTG
`GAGGCAATCTGA GGTCAC
`GUICIGIT G
`TY 11 AY !
`CAACCTCCACCICCCGGGTTCAAGCAATTCTCCTGCCTCAGCCPCCCGATTAGCTGGGATCACAGGIGTG
`CACCACCATGCCCAGCTAATTATTTATTTCTTTTGTATTTTTAGTAGAGACAGGGTTTCACCATGTTGGC
`CAGGCTGGITTCGAACICCIGACCTCAGGTGATCCTCCTGCCICGGCCTCCCAAAGTGCIGGGATTACAG
`GTGTGAGCCACCACACCTGACCCATAGGTCTTCAATAAATATTTAATGGAAGGTTCCACAAGTCACCCTG
`TGATCAACAGTACCCGTATGGGACAÄAGCTGCAAGGICAAGATOG MANGOCHRXACCATAG
`CAAACIGGAAACAATCTAGATATCCAACAGTGAGGGTTAAGCAACATGGTGCATCTGTGGATAGAACGCC
`ACCCAGCCGCCCGGAGCAGGGACIGTCATICAGGGAGGOTAAGGAGAGAGGCTTGCTTGGGATATAGAAA
`GATATCCTGACATTGGCCAGGCATGGTGGCTCACGCCTGTAATCCTGGCACTTTGGGAGGACGAAGCGAG
`TGGATCACTGAAGTCCAAGAGITCGAGACCGGCCIGCGAGACAIGGCAAAACCCTGICICAAAAAAGAAA
`GAATGATGTCCTGACATGAAACAGCAGGCTACAAAACCACTGCATCCTGTGATCCCAATTTTGTGTTTTT
`CTTTCTATATATGGATTAAAACAAAAATCCTAAAGGGAAATACGCCAAAATGTTGACAATGACIGICICO
`AGGTCAAAGGAGAGAGGTGGGATTGTGGGTGACTTTTAATGTGTATGATTGTCTGTATTTTACAGAATIT
`CTGCCAIGACIGTGTATTTIGCATGACACATTTTAAAAATAATAAACACTATTITTAGAATAACAGAAAA
`( SEO ID NO : 11
`CCTTCCAAAGCCAGATCTT ( SEQ ID NO : 21
`GCCTGGGCAGGAACATATA ( SED ID NO : 3 )
`CCTGGGCAGGAACATATAT ( SEQ ID NO : 4 ]
`GETTCATTATGGCTGTGTT [ SEO ID NO : 51
`
`e 11
`
`Lassen - Exhibit 1001, p. 17
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 16 of 66
`
`US 10 , 106 , 603 B2
`
`* *
`
`* *
`
`IKKIL
`
`UVYVINVIVILLILLLLLL
`
`horrory vybrydory vybrydororoorderprooroordoor
`
`order to order torr
`
`GCIGPAGCTGGTGAGAGGAAGTCCIAGAGGCTATGGACACICTGCIGCIGGGAICACCGAGATGAGCAGO
`AGCIGCICAGGGCIGAGCAGGGTCCTGGTGGCCGIGGOTACAGCCCIGGTGTCTGCCTCCICCCCCIGCC
`CCCAGGCCTGGGGOCCCCCAGGGGTCCAGTATGGGCAGCCAGGGAGGTCCGTGAAGCTGTGTTGTCCTGG
`AGTGACTCCCGGGGACCCAGTGTCCTGGTTICCGGATGGGGAGCCAAAGCTGCTCCAGGGACCIGACICT
`GGGCIAGGGCAIGAACTGGICCIGGCCCAGGCAGACAGCACTGATGAGGGCACCTACATCIGCCAGACCC
`TGGATGGTGCACTTGGGGGCACAGTGACCCTGCAGCIGGGCTACCCICCACCCCGCCCIGTIGTCTCCTG
`CCAAGCAGCCGACTATGAGAACTTCTCTTGCACTTGGAGTCCCAGCCAGATCAGCGGTTTACCCACCCGC
`TACCICACCTCCTACAGGAAGAAGACAGTCCTAGGAGCIGATAGCCAGAGGAGGAGTCCATCCACAGGGO
`CCIGGCCATGCCCACAGGATCCCCTAGGGGCTGCCCGCIGTGTTGICCACGGGGCTGAGITCIGGAGCCA
`GTACCGGATPAAIGTGACTGAGGIGAACCCACTGGGIGCCAGCACACGCCIGCTGGATGIGAGCTTGCAG
`AGCATCTTGCGCCCTGACCCACCCCAGGGCCTGCGGGPAGAGTCAGTACCAGGTTACCCCCGACGCCTGC
`GAGCCAGCTGGACATACCCTGCCTCCTGGCCGTGCCAGCOCCACITCCTGCTCAAGTTCCSITTGCAGTA
`CCGTCCGGCGCAGCATOCAGCCTGGTCCACGGTGGAGCCAGCIGGACTGGAGGAGGTGATCACAGATGCI
`GIGGCIGGGCIGCCCCATGCTGIACGAGICAGTGCCCGGGACITICTAGAIGCIGGCACCIGGAGCACCI
`GGAGCCCGGAGGCCTGGGGAACTCCGAGCACTGE
`ACCAGCATGGGGCCAGCT
`CAGGIGG
`ACACACGCACCCAGAGGIG
`CCTV
`! " VIVIA ILIOHUDHULI
`TCCTGGGACTGGIGGCTGGGGCCCTGGCACIGGGGCTCTGGCTGAGGCIGAGACGGGGIGGGAAGGATGG
`ATCCCCAAAGCCTGGGTTCTTGGCCTCAGTGATTCCAGTGGACAGGCGTCCAGGAGCTCCAAACCTGTAG
`AGGACCCAGGAGGGCTTCGGCAGATTCCACCIATAATTCTGTCTTGCTGGIGTGGATAGAAACCAGO
`A
`TGGITGGATCICAGCOGGAAGIICIGTITGGAGCCCATTICIGIGAGACCCIGTA
`TTTCAAATTIGCAGCTGAAAGGIGCITGIACCICIGATITCACCCCAGAGTTGGAGTICIAS
`STGTGTACATCTGTGTCCATGTGTGACCATGTGTCTGTGAAGGCCAGGGAACATGTATTCCT
`C
`TTCCCTIGCAGGGTIG
`CPGO ATGCATGTATGTAGGTG
`TiTAO
`GAGIGTG
`GTC
`1
`( SEQ ID NO : 6 )
`IGCAGGIGTGAATAAA
`
`y
`
`yyyyyyyyyyyyyyyyyyyhhhhhhhhhhhhhhhhhhhh ththith
`
`Triin
`
`TITUTO
`
`?????
`
`h
`
`S
`
`GGACCATACCAAAGGAGAT ( SEO ID NO : 7 )
`GCGTCTTTGGGAATCCTTT [ SEQ ID NO : 8 )
`GCAGGACAGTAGATCCCT
`( SEO ID NO : 91
`
`GCTCAAGGAACGTGTGTAA ( SEQ ID NO : 101
`
`Figure 12
`
`Lassen - Exhibit 1001, p. 18
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 17 of 66
`
`US 10 , 106 , 603 B2
`
`SEQ ID NO :
`
`12
`
`
`
`siRNA sequence ( 593 )
`
`siRNA 1 AAGAUCUGGCUUUGGAAGGATIT
`CCUUCCAAAGCCAGAUCUUSTAT
`
`GCCUGGGCAGGAACAUAUALTAT
`SiRNA 2 UAUAUGUUCCUGCCCAGGCDTIT
`
`CCUGGGCAGGAACAUAUAUITAT
`
`AUAUAUGUUCCUGCCCAGGSTAT
`
`SiRNA 3
`
`ACCESSION
`
`NM 000641 . 3
`
`NM 0006413
`
`NM 000641 . 3
`
`IL - 11
`
`GGUUCAUUAUGGCUGUGUUSTAT
`SiRNA 4 AACACAGCCAUAAUGAACCITAT
`
`NM 0006413
`
`Figure 13
`
`Lassen - Exhibit 1001, p. 19
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 18 of 66
`
`US 10 , 106 , 603 B2
`
`SEQ I NO :
`
`15
`
`16
`
`
`
`SiRNA sCuence ( 33 )
`
`GGACCAUACCAAAGGAGAULTIT
`SiRNAS AUCUCCUUUGGUAUGGUCCITAT
`
`GCGUCUUUGGGAAUCCUUUSTOT
`
`AAAGGAUUCCCAAAGACGCDTIT
`
`SiRNA 6
`
`GCAGGACAGUAGAUCCCUANTAT
`
`UAGGGAUCUACUGUCCUCCITAT
`
`siRNA 7
`
`GCUCAAGGAACGUGUGUAASTAT
`
`siRNAS UUACACACGUUCCUUGAGCITAT
`
`Figure 14
`
`032324 . 1
`
`U32324 . 1
`
`U32324 . 1
`
`U32324 . 1
`
`IL - IR
`
`IL - IIR
`
`IL - UIR
`
`IL - IR
`
`Lassen - Exhibit 1001, p. 20
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 19 of 66
`
`US 10 , 106 , 603 B2
`
`????? Figure 15
`
`Lassen - Exhibit 1001, p. 21
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 20 of 66
`
`US 10 , 106 , 603 B2
`
`200
`
`160
`Reads ( M )
`
`Total Reads
`mapped
`unique
`
`.
`
`.
`
`cocoon
`
`Wooooooo
`wo
`
`00000000000000
`accoccoccocco
`Woooooooooooo
`Www
`
`Figure 16
`
`PECAM1 - CD31
`
`. . . .
`
`. .
`
`. . . . . . .
`
`. . . . . . . . . .
`
`. . .
`
`. .
`
`. .
`
`. .
`
`. .
`
`. .
`
`. . . .
`
`.
`
`FPKM
`
`100004
`
`Figure 17A
`
`Lassen - Exhibit 1001, p. 22
`
`

`

`U . S . Patent
`
`atent
`
`Oct . 23 , 2018
`
`US 10 , 106 , 603 B2
`
`Sheet 21 of 6
`
`Sheet 21 of 66
`
`MYH6
`
`20
`
`WWWWWWWWWWWWWWWWWWWWWW
`
`Atrium
`
`1500m
`
`Figure 17B
`
`TNNT2
`
`I
`
`1994
`
`Figure 170
`
`Lassen - Exhibit 1001, p. 23
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 22 of 66
`
`US 10 , 106 , 603 B2
`
`2500
`
`COL1A2
`
`Figure 17D
`
`ACTA2
`
`500
`
`2000
`
`Figure 17E
`
`Lassen - Exhibit 1001, p. 24
`
`

`

`U . S . Patent
`
`atent
`
`Oct . 23 , 2018
`
`Sheet 23 of 66
`
`US 10 , 106 , 603 B2
`
`
`
`
`
`
`
`DEseq2 corrected Fold Change
`
`l wall
`
`l ' al
`
`lalal
`
`alal
`
`l
`
`
`
`wala lalalalalala
`
`Upregulated in Fibrosis
`
`
`
`. ya €
`361 WWW
`
`.
`
`wwwww
`
`* * * * *
`
`.
`
`1 X . XXX
`
`* * * * *
`
`.
`
`.
`.
`
`. . .
`1 .
`
`3
`
`Downregulated in Fibrosis
`
`Figure 18A
`
`Figure 18B
`
`Lassen - Exhibit 1001, p. 25
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 24 of 66
`
`US 10 , 106 , 603 B2
`
`TGFB1m
`Figure 18C
`
`w
`
`24h
`
`Lassen - Exhibit 1001, p. 26
`
`

`

`U . S . Patent
`
`Oct . 23 , 2018
`
`Sheet 25 of 66
`
`US 10 , 106 , 603 B2
`
`
`
`Figure 18D
`
`wiiiniintindinini
`
`intiimiin niiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiin
`
`1251
`
`
`
`IL11 Expression
`
`Lassen - Exhibit 1001, p. 27
`
`

`

`U . S . Patent
`
`Oct . 23 , 2018
`
`Sheet 26 of 66
`
`US 10 , 106 , 603 B2
`
`1L11 FC ( qPCR )
`
`?L11 FC ( RNA - seq )
`
`Figure 18E
`
`12111
`
`12 41
`
`OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO
`
`
`
`rel . IL11 protein
`
`0 . 0 . 0 . 0 . 0 . . .
`
`ET - 11 PDGF TIL11
`IL13
`OSM
`No stimulus
`
`be
`
`Figure 19A
`
`Lassen - Exhibit 1001, p. 28
`
`

`

`U . S . Patent
`
`Oct . 23 , 2018
`
`Sheet 27 of 66
`
`US 10 , 106 , 603 B2
`
`2000
`
`Measure ( pg / ml )
`
`V
`
`Added ( pg / ml
`
`Figure 19B
`
`( wod ) 1171
`
`16
`
`•HH . TAMAA
`
`Figure 19C
`
`Lassen - Exhibit 1001, p. 29
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 28 of 66
`
`US 10 , 106 , 603 B2
`
`Protein
`
`* *
`
`*
`
`doo
`
`Figure 19D
`
`Lassen - Exhibit 1001, p. 30
`
`

`

`U . S . Patent
`
`Oct . 23 , 2018
`
`Sheet 29 of 66
`
`US 10 , 106 , 603 B2
`
`ttttttttttttttttttttttttttt
`
`. .
`
`. .
`
`.
`
`.
`
`.
`
`.
`
`* *
`
`Stimulus
`
`SMA
`
`TGFB1H
`1111
`Stimulus Collagen
`
`TGFB1
`
`Stimulus Periostin
`
`TGFB1
`
`Figure 20A
`
`Lassen - Exhibit 1001, p. 31
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 30 of 66
`
`US 10 , 106 , 603 B2
`
`
`
`Collagen Protein ( Sirius Red )
`
`Control TGFB1 1111
`
`Figure 20B
`
`IL6 ( pg / mL )
`
`W
`
`WA
`
`Control TGFB1 1L11
`
`Figure 20C
`
`Lassen - Exhibit 1001, p. 32
`
`

`

`U . S . Pater
`
`atent
`
`Oct . 23 , 2018
`
`Sheet 31 of 66
`
`US 10 , 106 , 603 B2
`
`"
`
`e n router une
`
`
`?
`
`' LL
`
`vvv
`
`AT Control TGFB1 L11 1
`
`Figure 20D
`
`MMP2 ( ng / ml )
`2 LYS
`
`Control TGFB1 L11
`
`Figure 20E
`
`Lassen - Exhibit 1001, p. 33
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 32 of 66
`
`US 10 , 106 , 603 B2
`
`
`
`Activated Fibroblasts
`
`Figure 20F
`
`Lassen - Exhibit 1001, p. 34
`
`

`

`U . S . Patent
`
`Oct . 23 , 2018
`
`Sheet 33 of 66
`
`US 10 , 106 , 603 B2
`
`yo .
`HH . .
`
`OU
`
`VYYYYYYYYYYYYYYYYY
`
`w
`
`VVV
`
`w
`
`H W Merve
`
`Villalba
`
`Figure 21A
`
`1
`
`ECM ( Periostin )
`MAMA
`
`MA
`
`ECM ( Collagen )
`
`MAAVAA
`
`
`
`Activated Fibroblasts
`
`* 3 : 2 H
`Ventricular
`
`Lung
`
`Renal
`
`Fibroblast
`
`Lassen - Exhibit 1001, p. 35
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 34 of 66
`
`US 10 , 106 , 603 B2
`
`• Mouse L11 ( 100ug / kg )
`Ang | | ( 2mg / kg / day )
`o Saline - Control
`
`Ha
`
`Figure 21B
`
`w Lung
`Kidney
`
`Heart
`
`.
`
`Lassen - Exhibit 1001, p. 36
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 35 of 66
`
`| US 10 , 106 , 603 B2
`
`Liver
`buny
`Kidney
`
`LV
`
`Atrium
`
`Figure 210 .
`
`.
`
`AAAAA
`
`?? HE
`
`11 -
`
`P 0 . 0225
`
`P00268
`
`P0 , 0002
`I
`
`P00337
`
`1
`
`? ? .
`
`????
`2 P00365
`Collagen Content
`
`
`
`Lassen - Exhibit 1001, p. 37
`
`

`

`U . S . Patent
`
`atent
`
`Oct . 23 , 2018
`
`Oct . 3
`
`Sheet 36 of 66
`
`US 10 , 106 , 603 B2
`
`aSMA
`
`wymiana
`
`ma soe .
`
`Figure 22A
`
`
`
`Call Proliferation
`
`wwwwwwwwww
`
`anti - 2 . 11 * * * *
`
`1
`
`Figure 22B
`
`Lassen - Exhibit 1001, p. 38
`
`

`

`U . S . Patent
`
`atent
`
`Oct . 23 , 2018
`
`Sheet 37 of 66
`
`US 10 , 106 , 603 B2
`
`S .
`
`anti - tL . 19
`
`*
`-
`Figure 22C
`
`mainonnaniamising
`
`I
`
`82004 I
`
`anti - IL 11
`
`-
`Figure 22D
`
`I
`
`Lassen - Exhibit 1001, p. 39
`
`

`

`U . S . Patent
`
`Oct . 23 , 2018
`
`Sheet 38 of 66
`
`US 10 , 106 , 603 B2
`
`ng / ml
`
`LLLL
`
`wwwwwwanan
`
`YYYYY
`
`Figure 22E
`
`ng / ml
`
`TGFB1
`
`Figure 22F
`
`Lassen - Exhibit 1001, p. 40
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 39 of 66
`
`US 10 , 106 , 603 B2
`
`
`
`Collagenl Protein ( Operetta )
`
`manasan
`
`
`
`
`
`Collagen Protein ( Sirius Red )
`
`ede
`
`delete
`
`+ 1 +
`
`en gure 23A
`
`* * *
`
`1674
`
`+ 11
`
`Figure 23B
`
`Lassen - Exhibit 1001, p. 41
`
`

`

`och om man sm
`
`Sheet 40 of 66
`
`US 10 , 106 , 603 B2
`
`E
`
`E
`
`U . S . Patent
`
`Oct . 23 , 2018
`
`AIRA ,
`
`LARA
`
`I
`
`
`
`
`
`
`
`?????? ??? ? ??? ???? ?? ?? ?? ?? ??? ??? ??? ??? ??? ??? ??? ??? ????
`
`
`
`
`
`111111111
`
`Figure 24
`
`wwwww . mow e donne . . . . . . . . . .
`
`mempen
`
`Lassen - Exhibit 1001, p. 42
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 41 of 66
`
`US 10 , 106 , 603 B2
`
`Myofibroblasts [ % ]
`
`M
`
`DBaseline
`OTGFB1
`
`T DANG2
`
`frentemente
`
`+ )
`IL11RA ( + + )
`Figure 25A
`
`- )
`
`
`
`Proliferating cells [ % ]
`
`C Baseline
`DTGFB1
`O ANG2
`TLT
`
`IL11RA ( + / + )
`
`( + )
`Figure 25B
`
`( m )
`
`Lassen - Exhibit 1001, p. 43
`
`

`

`U . S . Patent
`
`atent
`
`Oct . 23 , 2018
`
`Sheet 42 of 66
`
`US 10 , 106 , 603 B2
`
`Collagen l ( intensity / area )
`
`ITT I
`ULEIULUULUULUU
`
`. . .
`
`C . Baseline
`DTGFB1
`
`O ANG2
`
`* 111111111111111
`
`* * *
`
`IL11RA ( + + )
`
`XXXX
`
`( + )
`Wigs
`Figure 25C
`
`I - in }
`
`C . Baseline
`DTGFB1
`DL11
`O ANG2
`
`wwwkkiinnittihakikisha hahhahahahahahaha
`
`IL11RA ( + / + )
`
`.
`
`YYYYYYYYYYYYY
`
`( - : - )
`
`( - + )
`
`Figure 250
`
`Lassen - Exhibit 1001, p. 44
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 43 of 66
`
`US 10 , 106 , 603 B2
`
`e
`
`lan
`
`ex
`
`wana
`
`w
`
`ANG2 others
`
`doen
`
`anti - L11 w
`
`W
`
`doelen
`
`online
`we
`Figure 26A
`
`com
`
`ww
`
`w it .
`
`*
`
`*
`
`Ang ! -
`L11ab
`
`Figure 26B
`
`Lassen - Exhibit 1001, p. 45
`
`

`

`U . S . Patent
`
`atent
`
`Oct . 23 , 2018
`
`Sheet 44 of 66
`
`US 10 , 106 , 603 B2
`
`Collagen - HPA
`P = 0 . 019
`P 0 . 002
`
`Q Saline
`D Angil
`
`KO Saline
`Figure 27A
`Col1A2
`
`wwwwwwwwwwwwwwwww
`
`D
`
`Saline
`Angll
`
`
`
`Protein Expression
`
`wy
`
`
`
`RNA Expression
`
`tutto
`
`2
`
`CA
`ml
`
`KO Saline KO Angli
`Figure 27B
`
`Lassen - Exhibit 1001, p. 46
`
`

`

`U . S . Patent
`
`atent
`
`Oct . 23 , 2018
`
`Sheet 45 of 66
`
`US 10 , 106 , 603 B2
`
`OSMA
`
`Wh
`
`w
`
`(
`
`Saline
`Angil
`
`1
`
`2 En
`
`WT Angit
`Figure 270
`
`Fibronectin
`
`Saline
`O
`DAngli
`
`
`
`RNA Expression
`
`
`
`RNA Expression
`
`tar
`
`WT Saline WT Angli KO Saline
`
`.
`
`S
`
`Figure 27D
`
`Lassen - Exhibit 1001, p. 47
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 46 of 66
`
`US 10 , 106 , 603 B2
`
`L11RA ( - - )
`IL11RA ( + / + )
`. . . P0 . 022
`P = 0 . 005
`
`M
`
`mi
`
`2012
`
`M
`
`12 / 04
`
`-
`
`WWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWW
`
`ot
`Figure 28
`
`t
`
`Lassen - Exhibit 1001, p. 48
`
`

`

`U . S . Patent
`
`Oct . 23 , 2018
`
`Sheet 47 of 66
`
`US 10 , 106 , 603 B2
`
`. . .
`
`. .
`
`* * * *
`* * * *
`
`* *
`
`*
`
`* * *
`
`2
`
`Pa '
`
`' .
`
`KO nou ( = 12 ) * * * * * * * * * *
`
`* * * * * * * * *
`
`Figure 29A
`
`Dermai fibrosis
`
`Contot muce ( 13103 * 0 *
`
`100 % * XXXXV
`
`W
`
`* *
`
`00000000000000000
`
`Figure 29B
`
`Lassen - Exhibit 1001, p. 49
`
`

`

`atent
`
`Oct . 23 , 2018
`
`Sheet 48 of 66
`
`US 10 , 106 , 603 B2
`
`Gain - of - function
`
`Y
`
`.
`
`.
`
`. YYYY
`
`. .
`
`. .
`
`Figure 290
`
`Lassen - Exhibit 1001, p. 50
`
`

`

`U . S . Patent
`
`Oct . 23 , 2018
`
`Sheet 49 of 66
`
`US 10 , 106 , 603 B2
`
`viwiivi
`
`Figure 30A
`
`# # #
`
`Figure 30B
`
`Lassen - Exhibit 1001, p. 51
`
`

`

`U . S . Patent
`
`Oct . 23 , 2018
`
`Sheet 50 of 66
`
`US 10 , 106 , 603 B2
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`OS
`
`* *
`* *
`* * *
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`. . . .
`. . .
`.
`.
`.
`.
`.
`
`. . .
`.
`.
`.
`
`. .
`.
`.
`.
`.
`
`.
`. .
`.
`.
`
`. . .
`.
`
`. . . . . .
`
`. . . . . . . . .
`. . . .
`
`. .
`. .
`
`. .
`.
`
`. .
`. .
`. . . . .
`
`. .
`
`.
`
`. . . . . .
`
`. . .
`
`.
`
`WA WWW
`
`Figure 31A
`Control
`
`WWW
`WWW
`
`WOW
`
`Figure 31B
`
`WT
`
`KO
`
`Lassen - Exhibit 1001, p. 52
`
`

`

`U . S . Patent
`
`Oct . 23 , 2018
`
`Sheet 51 of 66
`
`US 10 , 106 , 603 B2
`
`Decoy Receptor 50aa linker
`
`Myofibroblasts [ % ]
`
`}
`
`TGFB1 mm
`Decoy Ing / ml ] -
`
`Figure 32A
`
`•6H4 : + 8
`
`Decoy Receptor 33aa linker
`
`117
`
`1 1111111111 . 4444
`
`Activ . Fibroblasts [ % ]
`
`•Hit
`
`TGFB1 -
`Decoy ( ng / mi )
`we
`
`+ w + s 50
`
`Figure 32B
`
`Lassen - Exhibit 1001, p. 53
`
`

`

`U . S . Patent
`
`Oct . 23 , 2018
`
`Sheet 52 of 66
`
`US 10 , 106 , 603 B2
`
`SEQD
`
`Sequence
`
`
`
`Genotype Minor Allele
`
`GIGTGATTGCTTAAAAAAAACTACTIC / TACATTGTTT TGAATCACACCTCACA
`
`GCTCAGCTAATCAATGACCAGTCTC / C / TITTAATTCTT CTAATGCCTATATGGT
`
`GTAAGOGATGTGAATCOGGTACTGA { A / GIGAAAGAG CCTGGATGCAGAGCCAGC
`
`TTGATAACTTCAGCATCTGGATCACICIT ] GTGGGATT AGCATCTGTTTGTATTT
`
`. . . . . . . . . . . . .
`
`. . . . . . . .
`
`A
`
`T
`
`. . . . . . .
`
`. . . . . . . . .
`
`GACATT
`
`. . . . . . . . .
`
`. . . . . . . . .
`
`. . . . . . . . .
`
`. . . . . . . . .
`
`. . . . . . . . .
`
`. . . . . . . . .
`
`. . . . . . . . .
`
`. . . . . . . . .
`
`. . . . . . . .
`
`. . . . . . . . .
`
`. . . . . . . . . .
`
`. . . . . . .
`
`21
`
`TTGGGGCTATAAGAGGTA
`
`Figure 33
`
`GIA
`
`TIC
`
`GIA
`
`0 . 0248
`
`07
`1 . 765
`
`FOR
`P value
`Position ( hg19 )
`SNPD
`rs 10831850
`
`11 - 12566917
`
`0 . 0248
`
`07
`1 . 76E -
`
`- - - - - - - - - - - - - - -
`
`- - - - - - - - - - -
`
`11 - 72599138
`
`-
`
`- - - - - - - - - - - - - - - - - - - -
`
`rs4756936
`
`0 . 0248
`
`0 . 0306
`
`11 - 12578182 1 . 76E - 0 . 0248
`
`1 . 44
`
`07
`
`2 - 223621273 2 . 70€
`
`11 - 12581045
`
`rs7120273
`
`- - - - - - - - - - - - - - - - - - -
`
`18895468
`
`r56485827
`
`Lassen - Exhibit 1001, p. 54
`
`

`

`U . S . Patent
`
`Oct . 23 , 2018
`
`Sheet 53 of 66
`
`US 10 , 106 , 603 B2
`
`-
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.

This document is available on Docket Alarm but you must sign up to view it.


Or .

Accessing this document will incur an additional charge of $.

After purchase, you can access this document again without charge.

Accept $ Charge
throbber

Still Working On It

This document is taking longer than usual to download. This can happen if we need to contact the court directly to obtain the document and their servers are running slowly.

Give it another minute or two to complete, and then try the refresh button.

throbber

A few More Minutes ... Still Working

It can take up to 5 minutes for us to download a document if the court servers are running slowly.

Thank you for your continued patience.

This document could not be displayed.

We could not find this document within its docket. Please go back to the docket page and check the link. If that does not work, go back to the docket and refresh it to pull the newest information.

Your account does not support viewing this document.

You need a Paid Account to view this document. Click here to change your account type.

Your account does not support viewing this document.

Set your membership status to view this document.

With a Docket Alarm membership, you'll get a whole lot more, including:

  • Up-to-date information for this case.
  • Email alerts whenever there is an update.
  • Full text search for other cases.
  • Get email alerts whenever a new case matches your search.

Become a Member

One Moment Please

The filing “” is large (MB) and is being downloaded.

Please refresh this page in a few minutes to see if the filing has been downloaded. The filing will also be emailed to you when the download completes.

Your document is on its way!

If you do not receive the document in five minutes, contact support at support@docketalarm.com.

Sealed Document

We are unable to display this document, it may be under a court ordered seal.

If you have proper credentials to access the file, you may proceed directly to the court's system using your government issued username and password.


Access Government Site

We are redirecting you
to a mobile optimized page.





Document Unreadable or Corrupt

Refresh this Document
Go to the Docket

We are unable to display this document.

Refresh this Document
Go to the Docket