`
`Therapeutic efficacy of Bifidobacterium longum‑mediated
`human interleukin‑2 with endostatin or TRAIL
`in transplanted tumors in mice
`YAN YIN1, LEI KOU1, JIAN-JUN WANG1 and GEN-XING XU2,3
`1Department of Biological Science and Technology and State Key Laboratory of Pharmaceutical Biotechnology,
`School of Life Sciences; 2Center for Public Health Research, Medical School, and State Key Laboratory
`of Analytical Chemistry for Life Science, Nanjing University, Nanjing 210093;
`3Jiangsu Research Center for Gene Pharmaceutical Engineering and Technology, Suzhou 215128, P.R. China
`Received October 2, 2011; Accepted November 28, 2011
`
`DOI: 10.3892/etm.2011.421
`
`Abstract. Interleukin-2 (IL-2), as an important cytokine in
`immune response, has been demonstrated to have therapeutic
`activity in several cancer models. In our previous study, we
`showed that the pBV22210 vector containing a chloram-
`phenicol resistance gene and the cryptic plasmid, pMB1,
`from the Bifidobacterium longum (B. longum) strain could
`stably replicate and did not significantly affect the biological
`characteristics of B. longum. In this study, B. longum was
`transfected by electroporation with pBV22210 containing IL-2
`(B. longum-pBV22210-IL-2), its growth curve was determined,
`and its inhibitory effect on tumor xenografts in mice was exam-
`ined. The results showed that B. longum-pBV22210-IL-2 reduced
`the tumor size and prolonged the survival time of H22 tumor-
`bearing mice. In addition, when cyclophosphamide (CTX), B.
`longum-pBV22210-endostatin, or B. longum-pBV22210-TRAIL
`was combined with B. longum-pBV22210-IL-2, the antitumor
`effect was significantly enhanced. The survival times of the mice
`in the combination groups of B. longum-pBV22210-endostatin
`or B. longum-pBV22210-TRAIL were longer than those of the
`mice in the B. longum-pBV22210-IL-2 alone group. However,
`when CTX was added, the survival times of the mice showed no
`statistically significant difference compared with those of the
`mice in the dextrose-saline solution group. These results suggest
`that B. longum-pBV22210-IL-2 has potent antitumor effects
`that could be enhanced when combined with chemotherapeutic
`drugs or other antitumor genes.
`
`Correspondence to: Professor Gen-Xing Xu, Center for Public
`Health Research, Medical School, Nanjing University, 22 Hankou
`Road, Nanjing 210093, P.R. China
`E-mail: genxingxu@nju.edu.cn
`Key words: Bifidobacterium longum, interleukin-2, endostatin,
`tumor necrosis factor-related apoptosis-inducing ligand, tumor, gene
`therapy, synergistic interactions
`
`Introduction
`Interleukin-2 (IL-2) was first identified in 1976 as a growth-
`promoting cytokine for bone marrow-derived T lymphocytes (1),
`and the major function of IL-2 is to promote proliferation of
`CD4+ and CD8+ T cells (2). IL-2 also has functions on natural
`killer (NK) cells, B cells, lymphokine-activated killer (LAK)
`cells, monocytes and neutrophils (3-7). Accordingly, IL-2
`plays a key role in the immune system, which has a close
`relationship with cancer. Although IL-2 has been used in the
`treatment of a number of different types of cancer, alone or
`in combination (8-10), it still has a number of limitations that
`restrict its full clinical use. Systemic injections, which are the
`most common routes for IL-2 used in cancer immunotherapy,
`have been reported to cause certain severe side-effects and
`toxicities including fever, nausea, capillary leak syndrome,
`diarrhea, chills, weight gain and hypotension (11,12). To reduce
`the side-effects of IL-2, different strategies have been explored.
`However, the majority of these strategies have so far, been
`disappointing. Safer and more effective routes of IL-2 treat-
`ment are still required.
`Hypoxic regions are characteristic of numerous types of
`solid tumors. As a non-pathogenic and anaerobic bacterium,
`Bifidobacterium longum (B. longum) is capable of selectively
`localizing and proliferating within the hypoxic regions of
`tumors (13,14). However, the fact that exogenous plasmids
`cannot replicate stably in B. longum limits its application as a
`specific gene delivery system for cancer gene therapy. Though
`some shuttle vectors have been constructed over the years, only
`some of them could express foreign genes in B. longum success-
`fully (15-18).
`In our previous studies, we constructed the plasmids
`pBV22210-endostatin and pBV22210-tumor necrosis
`factor-related apoptosis-inducing ligand (TRAIL), which were
`proven to express stably when electroporated into B. longum.
`Furthermore, both B. longum-pBV22210-endostatin and
`B. longum-pBV22210-TRAIL showed a strong inhibitory
`effect on the growth of solid mouse tumors in vivo (19,20).
`In this study, B. longum was transfected by electroporation
`with pBV22210 containing IL-2 (B. longum-pBV22210-IL-2),
`
`Genome Ex. 1054
`Page 1 of 6
`
`
`
`482
`
`YIN et al: B. longum-pBV22210-IL-2 SHOWS ANTITUMOR EFFECTS
`
`its growth curve was determined and its inhibitory effect
`on tumor xenografts in mice was examined. Furthermore,
`B. longum-pBV22210-endostatin, B. longum-pBV22210-
`TRAIL or the chemotherapeutic drug cyclophosphamide (CTX)
`were combined with B. longum-pBV22210-IL-2 and their anti-
`tumor activity was also examined.
`Materials and methods
`Bacterial strains and plasmid. The Escherichia coli (E. coli)
`strain DH5α, wild-type (WT) B. longum, B. longum-
`pBV22210-endostatin, B. longum-pBV22210-TRAIL and
`plasmid pcDNA3.0-IL-2 were maintained in our laboratory.
`Reagents and enzymes. Primers were synthesized by Shanghai
`Shenergy Biocolor BioScience and Technology Company
`(Shanghai, China). CTX was purchased from Jiangsu Hengrui
`Medicine Co, Ltd. (Lianyungang, China). 2X Taqmix was
`purchased from Tiangen Biotech (Beijing, China), T4 DNA
`ligase and restriction endonucleases were purchased from
`Takara Bio (Dalian, China).
`Animals and tumors. Male Kunming mice (20±2 g) were
`obtained from the Qinglongshan Animal Center (Nanjing,
`China). The animal experiments performed in this study were
`approved by the Nanjing University Animal Care and Use
`Committee. The animals were stored in an animal room that
`was maintained at a constant temperature with a 12 h light/
`dark cycle and supplied with laboratory chow and water.
`Murine hepatoma cells (H22) were supplied by the Shanghai
`Academy of Medical Industry (Shanghai, China). The tumor
`model was established by subcutaneous injection of H22 tumor
`cells (1x106 cells/0.2 ml) into the right flank of each mouse.
`Construction of pBV22210-IL-2
`PCR amplification of IL-2 gene. The plasmid pcDNA3.0-IL-2
`was extracted following the instructions of the manufacturer
`and used as a template for PCR to amplify the IL-2 gene. The
`PCR primers and conditions were as follows: 5'-CCGGAATGT
`ACAGGATGCAACTCCTGTCTTG-3' (sense) and 5'-CGCG
`GATCCTTATCAAGTTAGTGTTGAGATGATG-3' (antisense),
`94˚C for 30 sec, 53˚C for 30 sec and 72˚C for 30 sec, for 30 cycles.
`PCR products were analyzed by electrophoresis on 1% agarose
`gels.
`Ligation of pBV22210 and IL-2. The PCR products and
`pBV22210-endostatin were digested by EcoRI/BamHI and
`then the gel-purified IL-2 and pBV22210 fragments were
`ligated at the EcoRI/BamHI site using T4 DNA ligase,
`yielding pBV22210-IL-2 (Fig. 1). The ligation solution was
`subsequently transferred into competent cells of DH5α, and
`pBV22210-IL-2 was detected on LB agar plates with 10 mg/ ml
`chloramphenicol.
`Identification of pBV22210-IL-2. Following 12-14 h of
`incubation at 37˚C under anaerobic conditions, positive clones
`of pBV22210-IL-2 with chloramphenicol resistance on LB agar
`were picked out and cultured overnight to extract the plasmids.
`The plasmid pBV22210-IL-2 was digested with EcoRI/BamHI
`and the digestion solution was analyzed by electrophoresis on
`1% agarose gels. The constructed pBV22210-IL-2 plasmid was
`confirmed by sequencing.
`
`Electroporation. Electrocompetent cells of B. longum were
`prepared according to the protocol of Rossi et al (21). Briefly,
`bacteria were resuspended in approximately 1/100 of the original
`culture volume of ice-cold 0.5 M sucrose plus 1 mM ammonium
`citrate (pH 6.0). The pBV22210-IL-2 plasmids were added to the
`bacteria suspension and incubated at 4˚C for 2-3 h. The mixture
`was stored in a pre-cooled sterile Gene Pulser disposable cuvette
`(interelectrode distance 0.2 cm; Bio-Rad, Hercules, CA, USA).
`The pBV22210-IL-2 plasmids were transferred directly into
`B. longum by electroporation in a Bio-Rad Gene-Pulser appa-
`ratus at 25 µF and 2.5 kV with the pulse controller set at 200 Ω.
`Subsequently, the mixture was inoculated in trypticase-peptone-
`yeast (TPY) culture and anaerobically cultivated overnight at
`37˚C. Diluted overnight culture was plated on TPY agar plates
`and monoclones were cultivated alternately in TPY culture with
`and without 5 µg/ml chloramphenicol for at least 10 generations.
`Then stable B. longum-pBV22210-IL-2 with chloramphenicol
`resistance could be obtained.
`Growth assay of B. longum-pBV22210-IL-2. Overnight culture
`of B. longum-pBV22210-IL-2 in TPY medium was inoculated
`into fresh medium with or without 5 µg/ml chloramphenicol
`to an initial optical density (OD) value of 0.010 at 600 nm
`(OD 600). The cultures were grown under anaerobic condi-
`tions at 37˚C for 20 h and OD values were measured every
`hour. WT B. longum cells were used as the control.
`Antitumor activity of B. longum-pBV22210-IL-2. Mice were
`weighed and randomly divided into seven experimental groups
`(six per group) following hypodermic inoculation of H22
`cells for 24 h. One negative control group was injected with
`dextrose-saline solution (0.4 ml/day, i.v., on days 1-10), and six
`treated groups were injected with WT B. longum (0.4 ml/ day,
`i.v., on days 1-10), B. longum-pBV22210-IL-2 (0.4 ml/ day,
`i.v, on days 1-10), CTX (30 mg/kg, i.p., on days 1, 3, 5, 7 and
`9), B. longum-pBV22210-IL-2 (0.4 ml/day, i.v., on days 1, 3,
`5, 7 and 9) plus B. longum-pBV22210-TRAIL (0.4 ml/day,
`i.v., on days 2, 4, 6, 8 and 10), B. longum-pBV22210-IL-2
`(0.4 ml/day, i.v, on days 1, 3, 5, 7 and 9) plus B. longum-
`pBV22210-endostatin (0.4 ml/day, i.v., on days 2, 4, 6, 8 and 10),
`and B. longum-pBV22210-IL-2 (0.4 ml/day, i.v., on days 1,3, 5, 7
`and 9) plus CTX (30 mg/kg, i.p., on days 1, 3, 5, 7 and 9), respec-
`tively. All B. longum cells were washed and resuspended with
`dextrose-saline solution at a concentration of 2.5x108 cells/ml
`prior to injection. CTX was suspended with dextrose-saline solu-
`tion and 0.2 ml of the solution was injected each time per mouse.
`The mice were sacrificed 72 h following the last administration.
`The tumors were excised and weighed. The level of inhibition of
`tumor growth was determined by the following formula:
` tumor weight of control group - tumor weight of treatment group
` -------------------------------------------------------------------------------------------------------------------- x100%
`
`tumor weight of control group
`
`Effect of B. longum-pBV22210-IL-2 on the survival time of
`H22 tumor-bearing mice. Mice were randomly divided into
`seven experimental groups (10 per group) and mice in each
`group were injected respectively, as mentioned above. The
`mice were kept after the last administration and their survival
`time was recorded until day 70. All mice were sacrificed on
`day 71 and the survival data were analyzed.
`
`Genome Ex. 1054
`Page 2 of 6
`
`
`
`EXPERIMENTAL AND THERAPEUTIC MEDICINE 3: 481-486, 2012
`
`483
`
`Figure 1. Construction of the expression vector, pBV22210-IL-2.
`
`The sequencing result showed that the recombinant
`plasmid pBV22210-IL-2 was successfully constructed. The
`sequence of the IL-2 gene between the EcoRI and BamHI sites
`was consistent with the GenBank report.
`Growth characteristics. The growth curves of B. longum-
`pBV22210-IL-2 and WT B. longum were similar in the TPY
`medium without selective pressure, whereas the lag phase of
`B. longum-pBV22210-IL-2 in the selective medium was statis-
`tically longer than that in the non-selective medium as shown
`in Fig. 2. Both B. longum-pBV22210-IL-2 and WT B. longum
`in the TPY medium without chloramphenicol grew to an expo-
`nential phase after 3 h and a stationary phase (OD 600=1.1)
`after 8 h of incubation. However, B. longum-pBV22210-IL-2
`cells in the TPY medium with chloramphenicol (5 µg/ml)
`grew to an exponential phase after 7 h and a stationary phase
`after 11 h of incubation.
`Effect of B. longum-pBV22210-IL-2 on growth of H22 tumors.
`We established an H22 tumor xenograft model to assess the
`antitumor efficacy of B. longum-pBV22210-IL-2 alone and
`in combination with CTX, B. longum-pBV22210-endostatin
`or B. longum-pBV22210-TRAIL in vivo. The tumors excised
`from each group are shown in Fig. 3A. The average tumor
`weight of each group is shown in Fig. 3B. Compared with the
`dextrose-saline solution group, the tumor inhibition rate of the
`B. longum-pBV22210-IL-2 group was 56.2% (p<0.05), which
`was higher than that of the WT B. longum group (32%) (p>0.05),
`but lower than that of the CTX group (62.2%) (p<0.05).
`Compared with the dextrose-saline solution group, the inhibi-
`tory rate of the co-injection of B. longum-pBV22210-IL-2
`with B. longum-pBV22210-TRAIL reached 74% (p<0.05),
`while that of B. longum-pBV22210-IL-2 with B. longum-
`pBV22210-endostatin was 77.5% (p<0.05) and that of
`B. longum-pBV22210-IL-2 with CTX was 82.7% (p<0.05).
`Compared with the B. longum-pBV22210-IL-2 alone group,
`the tumor inhibition rate of the B. longum-pBV22210-IL-2
`plus B. longum-pBV22210-TRAIL group was 17.8% (p<0.05)
`higher, whereas that of the B. longum-pBV22210-IL-2 plus
`B. longum-pBV22210-endostatin group was 21.3% (p<0.05)
`higher and the B. longum-pBV22210-IL-2 plus CTX group
`was 26.5% (p<0.05) higher. These results suggest that
`B. longum-pBV22210-IL-2 alone can inhibit tumor growth
`significantly, and when combined with other drugs, the
`inhibitory efficacy is even greater.
`
`Figure 2. The growth curves of B. longum-pBV22210-IL-2 and wild-type
`(WT) B. longum cells. B. longum-pBV22210-IL-2 cells were incubated anaer-
`obically at 37˚C in trypticase-peptone-yeast (TPY) medium with or without
`chloramphenicol. WT B. longum cells were incubated anaerobically at 37˚C in
`TPY medium without selective pressure. OD 600, optical density at 600 nm.
`
`Statistical analysis. The results were expressed as the means ± SD
`value. The data were statistically analyzed using the Student's
`t-test in both groups and the ANOVA test in multiple groups.
`The comparisons among multiple groups were performed using
`Student-Newman-Keuls q-test. Survival analysis was performed
`using SPSS 15.0. P<0.05 was considered to indicate a statistically
`significant difference.
`Results
`Identification of the pBV22210-IL-2 plasmid. The constructed
`pBV22210-IL-2 plasmid (Fig. 1) was confirmed by sequencing,
`and the sequencing result was as follows: GAATTCCAAA
`TGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAG
`TCTTGCACTTGTCACAAACAGTGCACCTACTTCAAGT
`TCTACAAAGAAAACACAGCTACAACTGGAGCATTTA
`CTGCTGGATTTACAGATGATTTTGAATGGAATTAATA
`ATTACAAGAATCCCAAACTCACCAGGATGCTCACATT
`TAAGTTTTACATGCCCAAGAAGGCCACAGAACTGAA
`ACATCTTCAGTGTCTAGAAGAAGAACTCAAACCTCT
`GGAGGAAGTGCTAAATTTAGCTCAAAGCAAAAACT
`TTCACTTAAGACCCAGGGACTTAATCAGCAATATCAA
`CGTAATAGTTCTGGAACTAAAGGGATCTGAAACAAC
`ATTCATGTGTGAATATGCTGATGAGACAGCAACCATT
`GTAGAATTTCTGAACAGATGGATTACCTTTTGTCAAA
`GCATCATCTCAACACTAACTTGATAAGGATCC. Restri-
`ction site: EcoRI GAATTC; BamHI GGATCC.
`
`Genome Ex. 1054
`Page 3 of 6
`
`
`
`484
`
` A
`
`YIN et al: B. longum-pBV22210-IL-2 SHOWS ANTITUMOR EFFECTS
`
` B
`
`Figure 3. The suppression effects of B. longum-pBV22210-IL-2 on H22 cell tumor growth. There were six mice in each group. The tumor weight was
`measured for each mouse. (A) Tumors excised from different groups. (B) The average tumor weight of different groups. Numbers 1-7 in the X axis correspond
`to the dextrose-saline solution group, wild-type B. longum group, B. longum-pBV22210-IL-2 group, CTX (30 mg/kg) group, B. longum-pBV22210-IL-2
`plus B. longum-pBV22210-TRAIL group, B. longum-pBV22210-IL-2 plus B. longum-pBV22210-endostatin group and B. longum-pBV22210-IL-2 plus CTX
`(30 mg/kg) group, respectively. *P<0.05 versus dextrose-saline solution group. IL-2, interleukin-2; CTX, cyclophosphamide.
`
`Effect of B. longum-pBV22210-IL-2 on survival time of H22
`tumor-bearing mice. To examine the effect of B. longum-
`pBV22210-IL-2 on the survival time of tumor-bearing mice,
`we developed a xenograft model in which H22 cells were
`injected subcutaneously into Kunming mice. The survival
`curves of four single administration groups are shown in
`Fig. 4A. The mean survival time of the dextrose-saline solution
`group was 20.4±1.2 days, and that of the CTX group extended
`to 23.1±1.6 days, but the difference was not statistically signi-
`ficant (p>0.05). The mean survival time of the WT B. longum
`and B. longum-pBV22210-IL-2 groups extended to 26.8±2.1
`(p<0.01) and 31.8±3.1 days (p<0.01), respectively. The survival
`curves of the co-administration groups are shown in Fig. 4B.
`The mean survival time of the B. longum-pBV22210-IL-2 plus
`CTX group, the B. longum-pBV22210-IL-2 plus B. longum-
`pBV22210-endostatin group and the B. longum-pBV22210-
`IL-2 plus B. longum-pBV22210-TRAIL group was 28.4±2.4,
`34.7±3.6 and 35.6±3.4 days, respectively. The H22 tumor-
`bearing mice co-administered B. longum-pBV22210-IL-2
`with B. longum-pBV22210-endostatin or B. longum- pBV22210-
`TRAIL had significantly improved survival compared with
`the mice administered dextrose-saline solution (p<0.05).
`However, the survival time of the mice in the B. longum-
`pBV22210-IL-2 plus CTX group was not statistically significant
`compared with the mice in the dextrose-saline solution group
`(p>0.05). Compared with the WT B. longum group, the
`B. longum-pBV22210-IL-2 plus B. longum-pBV22210-
`endostatin group and the B. longum-pBV22210-IL-2 plus
`B. longum-pBV22210-TRAIL group showed statistical
`significance (p<0.05), while the B. longum-IL-2 plus CTX
`group showed no statistical significance (p>0.05).
`Discussion
`The immune system plays a major role in tumorigenesis and
`metastasis. As a cytokine closely related to the immune system,
`IL-2 has been used in the treatment of a number of different
`
` A
`
` B
`
`Figure 4. Kaplan-Meier survival curves of H22 tumor-bearing mice. (A) A
`Kaplan-Meier survival curve of mice treated with dextrose-saline solution,
`wild-type B. longum, B. longum-pBV22210-IL-2 and CTX (30 mg/kg),
`respectively. (B) A Kaplan-Meier survival curve of mice treated with dex-
`trose-saline solution, B. longum-pBV22210-IL-2, B. longum-pBV22210-IL-2
`plus B. longum-pBV22210-TRAIL, B. longum-pBV22210-IL2 plus
`B. longum-pBV22210-endostasin and B. longum-pBV22210-IL2 plus CTX
`(30 mg/kg), respectively. IL-2, interleukin-2; CTX, cyclophosphamide.
`
`types of cancer, including metastatic melanoma (8), mesothe-
`lioma (9), lymphoma (10), kidney carcinoma (22), hepatocellular
`carcinoma (23), lung cancer (24) and bladder carcinoma (25).
`
`Genome Ex. 1054
`Page 4 of 6
`
`
`
`EXPERIMENTAL AND THERAPEUTIC MEDICINE 3: 481-486, 2012
`
`485
`
`However, toxicity and side-effects remain the major drawbacks
`of IL-2 therapy. To maximize the therapeutic efficacy and mini-
`mize the systemic side-effects of IL-2, several delivery systems
`have been used. These delivery systems have included gene
`therapy, and liposome and polymeric microspheres (26-28),
`among which safety and efficacy remain a problem.
`As an important non-pathogenic anaerobic bacterium
`in the human colon, Bifidobacterium has been used as a
`delivery system for a number of functional genes in cancer
`gene therapy (29). In a previous study, Li et al (30) used
`Bifidobacterium adolescentis (B. adolescentis) as the delivery
`system to transport the endostatin gene to solid tumors. When
`B. adolescentis with the endostatin gene was injected into
`tumor-bearing mice through the tail vein, they were only
`found in the tumors and no bacilli were found in other normal
`tissues. These results further prove that Bifidobacterium only
`germinates and proliferates in solid tumors and might be a
`highly specific and efficient vector for anticancer genes in
`cancer gene therapy. Furthermore, Bifidobacterium itself has
`been proven to have anticancer functions (31). Bifidobacterium
`has anticancer effects as not only has it been shown to inhibit
`cancer growth directly but it also to increase the activity of a
`number of immune cells and factors including IL-2 (32). In
`view of the properties above, B. longum may be used as a non-
`toxic, efficient and targeted delivery system of IL-2.
`A main obstacle in the application of B. longum as a gene
`delivery system is the instability of exogenous plasmids and the
`low level expression of the exogenous gene. A number of attempts
`have been made to solve this problem. Nakamura et al (33)
`constructed the plasmid, pBLES100-S-eCD, which included the
`histone-like protein (HU) gene promoter and the gene encoding
`the cytosine deaminase (CD) of E. coli in the pBLES100 vector.
`Using this vector, the expression of cytosine deaminase in
`B. longum successfully converted 5-fluorocytosine (5-FC) to
`5-fluorouracil (5-FU). Yi et al (34) successfully constructed a
`Bifidobacterium infantis/CD targeting gene therapy system with
`a recombinant CD/pGEX-1λT plasmid, which was used in the
`inhibition of melanoma in vitro and in vivo. In our laboratory, Xu
`et al (35) constructed a pBV22210-endostatin vector combining
`a chloramphenicol resistance gene (Cmr) from a pBCSK (t)
`plasmid and a cryptic plasmid pMB1 from the WT B. longum
`strain. When electroporated into B. longum, the plasmid could be
`stably expressed and B. longum-pBV22210-endostatin exhibited
`a strong inhibitory effect on H22 tumor growth. Hu et al (20)
`constructed a B. longum strain with pBV22210 encoding the
`extracellular domain of TRAIL (B. longum-pBV22210-TRAIL),
`and it selectively proliferated in the tumor tissue and exhibited a
`definite antitumor effect on S180 osteosarcoma. In this study, we
`constructed the plasmid, pBV22210-IL-2, based on the plasmid,
`pBV22210-endostatin. The results showed that the growth
`curves of B. longum-pBV22210-IL-2 and WT B. longum were
`similar, which suggested that the biological characteristics of
`B. longum were not affected after the plasmid was electropor-
`ated. The result that B. longum-pBV22210-IL-2 could grow in
`TPY medium with chloramphenicol for at least 10 generations
`further proved that pBV22210-IL-2 was constructed success-
`fully and could be stably expressed in B. longum.
`The antitumor effect of B. longum-pBV22210-IL-2 was
`evaluated in H22 tumor-bearing mice in vivo. B. longum-
`pBV22210-IL-2 inhibited tumor growth by 56.2% (p<0.05),
`
`and extended the mean survival time of tumor-bearing
`mice to 31.8±3.1 days (p<0.01). These results suggest that
`B. longum-pBV22210-IL-2 has a significant effect on
`H22 tumor cells. As B. longum-pBV22210-TRAIL and
`B. longum-pBV22210-endostatin were also proven to have
`an antitumor effect in our previous studies, we assessed
`the synergistic effect of a combination of B. longum-
`pBV22210-IL-2 and B. longum-pBV22210-TRAIL or
`B. longum-pBV22210-endostatin on H22 tumors. IL-2,
`TRAIL and endostatin are tumor suppressor genes with
`different mechanisms. IL-2 activates immune cells and regu-
`lated the body's immune function, TRAIL activates related
`apoptotic pathways of tumor cells and induces apoptosis, and
`endostatin inhibits angiogenesis and reduces nutrient supply
`to the tumor. Our results showed that the tumor growth
`inhibition was enhanced and survival time was prolonged
`in the combination treatment groups, which further proved
`that co-administration of drugs with different mechanisms
`could be a feasible method in cancer therapy. In addition, as
`chemotherapy remains the major approach to treat tumors in
`clinical practice, we used the chemotherapeutic drug, CTX,
`combined with B. longum-pBV22210-IL-2 and assessed their
`synergistic effect on H22 tumors. The results showed that the
`combination of CTX and B. longum-pBV22210-IL-2 signifi-
`cantly inhibited tumor growth; however, the survival time of
`the tumor-bearing mice administered this combination was
`not extended. In our previous studies, we combined CTX with
`B. longum-pBV22210-granulocyte colony-stimulating factor
`(GCSF) to observe the effects on H22 and S180 tumor-bearing
`mice, and similar results were obtained (36). These results were
`attributed to the toxicity of CTX. Lower dose and a combina-
`tion of targeted gene therapy may solve the severe side-effects
`of chemotherapeutic drugs.
`In conclusion, we established a new delivery system of
`IL-2 by B. longum and developed a strategy of combining IL-2
`with other antitumor genes or chemotherapeutic drugs for
`tumor treatment. Treatment with B. longum-pBV22210-IL-2
`resulted in significant inhibition of tumor growth and longer
`survival time in tumor-bearing mice. The combination treat-
`ments had much greater antitumor effects. Our results support
`the potential of B. longum as a gene delivery system and the
`combination of chemotherapy and target gene therapy for
`advancing the treatment of cancer.
`Acknowledgements
`This study was supported by a grant (BK2009109,
`SBK201123046) from the Natural Science Fund of Jiangsu
`Province to G.-X. X. and Y. Y.
`
`References
` 1. Morgan DA, Ruscetti FW and Gallo R: Selective in vitro
`growth of T lymphocytes from normal human bone marrows.
`Science 193: 1007-1008, 1976.
` 2. Gaffen SL and Liu KD: Overview of interleukin-2 function,
`production and clinical applications. Cytokine 28: 109-123, 2004.
` 3. Robertson MJ and Ritz J. Biology and clinical relevance of
`human natural killer cells. Blood 76: 2421-2438, 1990.
` 4. Mingari MC, Gerosa F, Carra G, et al: Human interleukin-2
`promotes proliferation of activated B cells via surface receptors
`similar to those of activated T cells. Nature 312: 641-643, 1984.
`
`Genome Ex. 1054
`Page 5 of 6
`
`
`
`486
`
`YIN et al: B. longum-pBV22210-IL-2 SHOWS ANTITUMOR EFFECTS
`
` 5. Grimm EA, Mazumder A, Zhang HZ and Rosenberg SA:
`Lymphokine-activated killer cell phenomenon-Lysis of natural
`killer-resistant fresh solid tumor cells by interleukin 2-activated
`autologous human peripheral blood lymphocytes. J Exp Med 155:
`1823-1841, 1982.
` 6. Espinoza-Delgado I, Bosco MC, Musso T, Gusella GL, Longo DL
`and Varesio L: Interleukin-2 and human monocyte activation.
`J Leukoc Biol 57: 13-19, 1995.
` 7. Ferrante A: Activation of neutrophils by interleukins-1 and -2
`and tumor necrosis factors. Immunol Ser 57: 417-436, 1992.
` 8. Radny P, Caroli UM, Bauer J, et al: Phase II trial of intralesional
`therapy with interleukin-2 in soft tissue melanoma metastases.
`Brit J Cancer 89: 1620-1626, 2003.
` 9. Astoul P, Picat-Joossen D, Viallat JR and Boutin C: Intrapleural
`administration of interleukin-2 for the treatment of patients with
`malignant pleural mesothelioma: A Phase II study. Cancer 83:
`2099-2104, 1998.
`10. Gisselbrecht C, Maraninchi D, Pico JL, et al: Interleukin-2
`treatment in lymphoma: A phase II multicenter study. Blood 83:
`2081-2085, 1994.
`11. Rosenberg SA, Lotze MT, Muul LM, et al: A progress report
`on the treatment of 157 patients with advanced cancer using
`lymphokine-activated killer cells and interleukin-2 or high-dose
`interleukin-2 alone. N Engl J Med 316: 889-897, 1987.
`12. Lotze MT, Matory YL, Rayner AA, et al: Clinical effects and
`toxicity of interleukin-2 in patients with cancer. Cancer 58:
`2764-2772, 1986.
`13. Kimura NT, Taniguchi S, Aoki K and Baba T: Selective local-
`ization and growth of Bifidobacterium bifidum in mouse tumors
`following intravenous administration. Cancer Res 40: 2061-2068,
`1980.
`14. Yazawa K, Fujimori M, Amano J, Kano Y and Taniguchi S:
`Bifidobacterium longum as a delivery system for cancer gene
`therapy: selective location and growth in hypoxic tumors. Cancer
`Gene Ther 7: 269-274, 2000.
`15. Rossi M, Brigidi P, Rodriguez AGVY and Matteuzzi D:
`Characterization of the plasmid pMB1 from Bifidobacterium
`longum and its use for shuttle vector construction. Res
`Microbiol 147: 133-143, 1996.
`16. Rossi M, Brigidi P and Matteuzzi D: Improved cloning vectors
`for Bifidobacterium spp. Lett Appl Microbiol 26: 101-104, 1998.
`17. Lee JH and O'Sullivan DJ: Sequence analysis of two cryptic
`plasmids from Bifidobacterium longum DJO10A and construction
`of a shuttle cloning vector. Appl Eeviron Microbiol 72: 527-535,
`2006.
`18. Matsumura H, Takeuchi A and Kano Y: Construction of
`Escherichia coli Bifidobacterium longum shuttle vector trans-
`forming B-longum 105-A and 108-A. Biosci Biotech Biochem 61:
`1211-1212, 1997.
`19. Fu GF, Li X, Hou YY, Fan YR, Liu WH and Xu GX:
`Bifidobacterium longum as an oral delivery system of endostatin
`for gene therapy on solid liver cancer. Cancer Gene Ther 12:
`133-140, 2005.
`20. Hu B, Kou L, Li C, et al: Bifidobacterium longum as a delivery
`system of TRAIL and endostatin cooperates with chemo-
`therapeutic drugs to inhibit hypoxic tumor growth. Cancer Gene
`Ther 16: 655-663, 2009.
`
`21. Rossi M, Brigidi P and Matteuzzi D: An efficient transformation
`system for Bifidobacterium spp. Lett Appl Microbiol 24: 33-36,
`1997.
`22. Sosman JA, Kohler PC, Hank J, et al: Repetitive weekly cycles of
`recombinant human interleukin 2: Responses of renal carcinoma
`with acceptable toxicity. J Nat Cancer Inst 80: 60-63, 1988.
`23. Shirai M, Watanabe S and Nishioka M: Antitumour effect of
`intratumoral injection of human recombinant interleukin-2 in
`patients with hepatocellular carcinoma: A preliminary report.
`Eur J Cancer 26: 1045-1048, 1990.
`24. Yasumoto K, Mivazaki K, Nagashima A, et al: Induction of
`lymphokine-activated killer cells by intrapleural instillations of
`recombinant interleukin-2 in patients with malignant pleurisy
`due to lung cancer. Cancer Res 47: 2184-2187, 1987.
`25. Ferlazzo G, Magno C, Lupo G, et al: A phase I study of intra-
`vesical continuous perfusion of recombinant interleukin-2 in
`patients with superficial bladder cancer. Am J Clin Oncol 18:
`100-104, 1995.
`26. Hoffman DMJ and Figlin RA: Intratumoral interleukin 2 for
`renal-cell carcinoma by direct gene transfer of a plasmid DNA/
`DMRIE/DOPE lipid complex. World J Urol 18: 152-156, 2000.
`27. Johnston D, Reynolds SR and Bystryn JC: Interleukin-2/
`liposomes potentiate immune responses to a soluble protein
`cancer vaccine in mice. Cancer Immunol Immunother 55:
`412-419, 2006.
`28. Hsu W, Lesniak MS, Tyler B and Brem H: Local delivery of
`interleukin-2 and adriamycin is synergistic in the treatment of
`experimental malignant glioma. J Neurooncol 74: 135-140, 2005.
`29. Fu GF, Yin Y, Hu B and Xu GX: Bifidobacterium as a delivery
`system of functional genes for cancer gene therapy. In: Emerging
`Cancer Therapy: Microbial Approaches and Biotechnological
`Tools. Fialho A and Chakrabarty A (eds). John Wiley & Sons,
`Inc., Hoboken, NJ, pp99-117, 2010.
`30. Li X, Fu GF, Fan YR, et al: Bifidobacterium adolescentis as a
`delivery system of endostatin for cancer gene therapy: selective
`inhibitor of angiogenesis and hypoxic tumor growth. Cancer
`Gene Ther 10: 105-111, 2003.
`31. Kohwi Y, Imai K, Tamura Z and Hashimoto Y: Antitumor effect
`of Bifidobacterium infantis in mice. Gann 69: 613-618, 1978.
`32. Lopez P, Gueimonde M, Margolles A and Suárez A: Distinct
`Bifidobacterium strains drive different immune responses
`in vitro. Int J Food Microbiol 138: 157-165, 2010.
`33. Nakamura T, Sasaki T., Fujimori M, et al: Cloned cytosine
`deaminase gene expression of Bifidobacterium longum and
`application to enzyme/pro-drug therapy of hypoxic solid tumors.
`Biosci Biotechnol Biochem 66: 2362-2366, 2002.
`34. Yi C, Huang Y, Guo Z and Wang S: Construction of
`Bifidobacterium infantis/CD targeting gene therapy system.
`Chin-Germ J Clin Oncol 4: 244-247, 2005.
`35. Xu YF, Zhu LP, Hu B, et al: A new expression plasmid in
`Bifidobacterium longum as a delivery system of endostatin for
`cancer gene therapy. Cancer Gene Ther 14: 151-157, 2007.
`36. Zhu LP, Yin Y, Xing J, et al: Therapeutic efficacy of Bifidobacterium
`longum-mediated human granulocyte colony-stimulating factor
`and/or endostatin combined with cyclophosphamide in mouse-
`transplanted tumors. Cancer Sci 100: 1986-1990, 2009.
`
`Genome Ex. 1054
`Page 6 of 6
`
`