`
`Contents lists available at ScienceDirect
`
`Early Human Development
`
`j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / e a r l h u m d ev
`
`The role of intestinal bifidobacteria on immune system development in young rats
`Ping Dong, Yi Yang, Wei-ping Wang ⁎
`Children's Hospital, Pediatrics Department of Shanghai Medical College, Fudan University, Shanghai, PR China.
`
`a r t i c l e
`
`i n f o
`
`a b s t r a c t
`
`Article history:
`Received 16 September 2009
`Received in revised form 28 December 2009
`Accepted 4 January 2010
`
`Keywords:
`Bifidobacteria
`Immune-system development
`Intestine
`Rats
`
`Aim: The effects of intestinal bifidobacteria on the development of immunity in early life were explored.
`Methods: Neonatal SD rats born and housed under strict barrier systems were fed from birth with sufficient
`antibiotics (bifidobacteria minimisation group) or supplemented daily with 1× 1010 colony-forming units of
`live Bifidobacterium longum (bifidobacteria supplementation group). Relevant indices of immune develop-
`ment were determined at one, three and six weeks old.
`Results: Compared to the control group, minimisation of the intestinal bifidobacteria delayed maturation of
`dendritic cells in Peyer's Patches and the development of T cells in the thymus, increased IL-4 secretion in the
`plasma, down-regulated IL-12, IL-10 mRNA and the interferon-γ/IL-4 mRNA ratio in intestinal mucosa,
`decreased interferon-γ mRNA in cultured peripheral blood mononuclear cells (PBMCs), and reduced
`immunoglobulin-M production in cultured PBMCs. Conversely, supplementation with bifidobacteria
`promoted dendritic cell maturation in Peyer's Patches, up-regulated IL-12, IL-10, interferon-γ mRNA and
`the interferon-γ/IL-4 ratio in intestinal mucosa, increased interferon-γ gene expression in cultured PBMCs,
`and raised immunoglobulin-M secretion in cultured PBMCs.
`Conclusions: Intestinal bifidobacteria could promote the maturation of dendritic cells and its expression of IL-
`12 locally in the gut, influence the development of T cells in the thymus, favour the development of T-helper
`cell type 1 response by increasing the local and systemic expression of interferon-γ and ensure the intestinal
`regulatory T cell response by promoting the local expression of IL-10. In addition, they enhance antibody
`synthesis by PBMCs, thereby affecting the development of both the gut and systemic immunity in early life.
`© 2010 Elsevier Ireland Ltd. All rights reserved.
`
`1. Introduction
`
`Comparative studies based on the germ-free animal have provided
`clear evidence that the body's cross-talk with commensal bacteria is
`essential for the development and maturation of the immune system
`in early life [1]. Because the gastrointestinal tract encompasses the
`largest surface of the human body, all kinds of colonising flora and the
`gut-associated lymphoid tissue (GALT) constitute the main elements
`that influence immune system development. Bifidobacteria, known as
`a kind of probiotic bacteria, represent up to 90% of the total intestinal
`flora in breast-fed infants [2]. Premature delivery, decreased breast-
`feeding, abuse of antibiotics and other factors have led to insufficient
`bifidobacteria colonisation of the gut in early infancy, which may be
`related to the increased future incidence of inflammatory, autoim-
`mune and atopic diseases [3]. Thus, the impact of bifidobacteria on the
`
`Abbreviations: DCs, dendritic cells; IFN, interferon; Ig, immunoglobulin; PPs, Peyer's
`Patches; PBMCs, peripheral blood mononuclear cells; Th1, T-helper cell type 1; Th2,
`T-helper cell type 2; Treg, regulatory T cell.
`⁎ Corresponding author. Children's Hospital, Pediatrics Department of Shanghai
`Medical College, Fudan University, 399 Wanyuan Road, Shanghai, 201102, PR China.
`Tel.: +86 21 64931990; fax: +86 21 65644937.
`E-mail address: wpwang@shmu.edu.cn (W. Wang).
`
`0378-3782/$ – see front matter © 2010 Elsevier Ireland Ltd. All rights reserved.
`doi:10.1016/j.earlhumdev.2010.01.002
`
`development of immunity and the precise mechanisms behind it
`require further elucidation.
`One principal character in immune system development in early
`life is the establishment of a balanced T-helper (Th) cell response
`(Th1/Th2). Th1 mainly secretes cytokines, such as interferon (IFN)-γ
`and IL-2, mediates cellular immunity and thus participates in anti-
`virus and intracellular bacterial infection responses. Th2 secretes
`cytokines, such as IL-4 and IL-5, mediates humoral immunity and is
`involved in the immune responses to bacterial infection, as well as
`immediate hypersensitivity reactions. An imbalanced Th1/Th2 may
`contribute, in part, to clinical diseases: e.g. excessive Th2 activity can
`lead to allergic disease, whereas Th1 predominance is found in
`inflammatory bowel disease. Adaptive responses of the newborn
`show a Th2 type and tend toward a Th1/Th2 balance as a result of the
`postnatal stimulation of initially colonising microbes on Th1 response.
`Additionally, the development of regulatory T (Treg) cell response
`is critical in inducing the tolerance to ‘self’ and in controlling in-
`flammatory diseases, including atopic disorders [4]. A retrospective
`study indicated that a preventive colonisation of high-risk infants with
`probiotics after birth decreased the incidence of allergies and repeated
`infections later in life [5], but its mechanism remains unclear.
`Dendritic cells (DCs), the most potent antigen-presenting cells
`(APCs), possess potent T-cell stimulatory capacities and are important
`in initiating the immune response [6]. Immature DCs reside in various
`
`Genome Ex. 1005
`Page 1 of 8
`
`
`
`52
`
`P. Dong et al. / Early Human Development 86 (2010) 51–58
`
`portals of the microorganism entry, such as skin and mucosa, where
`they guard sites of potential pathogen entry in to the host and capture
`invading microorganisms, and then migrate to nearby lymphoid
`organs, with gradual maturation. Mature DCs initiate a primary cell-
`mediated immune response through the expression of major
`histocompatibility complex (MHC) and costimulatory molecules.
`Moreover, DCs are critical in directing the differentiation of naive
`T cells into Th1, Th2 or Treg cells, thus, controlling the type, amplitude
`and intensity of the response [7]. The modulation of probiotics on
`T-cell responses may occur primarily through its action on the
`differentiation, maturation and functional activities of DCs. Recent in
`vitro studies have shown that certain probiotic interactions with DCs
`lead to the polarisation of naive T cells to a Th1 or Treg direction [8,9],
`however, to date, there are no relevant reports in vivo.
`The aim of the present study was to clarify how intestinal
`bifidobacteria affect the development of both the gut and systemic
`immunity in early life, especially its modulation on the differentiation,
`maturation and function of DCs, T-cell development, T-cell responses
`(Th1, Th2 and Treg) and immunoglobulin synthesis. Thus, the SD rats
`used in the study were fed from birth with sufficient antibiotics per
`day (bifidobacteria minimisation group) or administrated a daily dose
`of Bifidobacterium longum (bifidobacteria supplementation group)
`until one, three and six weeks of age, which are equivalent to the
`neonatal, infant and adolescent period of childhood, respectively.
`Various immunological parameters were assessed to study the impact
`of both bifidobacteria minimisation and supplementation on immune
`development.
`It is expected that the research will provide an
`experimental basis for the proper usage of bifidobacteria to improve
`the immunity of children in reality.
`
`2. Materials and methods
`
`2.1. Animals
`
`All experimental procedures involving animals were approved by the
`Ethics Committee of Shanghai Medical Collage of Fudan University and
`the care of animals was in accordance with institution guidelines.
`Newborn specific pathogen-free Sprague–Dawley (SD) rats were used.
`The rat pups were reared in plastic cages in a room kept at 22±3 °C and
`55±5% humidity, on a 12 h light/dark cycle under strict barrier systems
`with the water, diet and bedding material sterilized and high level air
`purity (Animal Centre of Public Health, Clinical Centre Affiliated to Fudan
`University). They were breast fed first and subsequently consume diet
`and water freely throughout the experimental period. The pups were
`divided into three groups, bifidobacteria minimisation (BM) group was
`fed from birth with gentamicin sulphate injection (100 mg/kg) and
`metronidazole injection (80 mg/kg) per day to minimise the amount of
`resident bifidobacteria in intestinal tract, while bifidobacteria supple-
`mentation (BS) group supplemented from birth with live B. longum
`(BL-11) 1×1010 colony-forming units (CFU) per day. The BL-11 (kindly
`provided by George Food Industries, Shanghai, China) were supplied as
`freeze-dried powder in sealed packets containing about 1.5×1011 CFU/g
`and stored at a temperature of −20 °C until dissolved in warm water for
`use. Both antibiotic injections and BL-11 suspension were given to the
`rats through orogastric gavage, which performed in a clean bench placed
`in the room. A third group of non-intervened rats was used as control. Ten
`rats of each group were anaesthetised by intra-peritoneal injection of 7%
`chloral hydrate (5 ml/kg) at one, three and six weeks old respectively.
`Blood was collected from the carotid artery into a heparinised tube, and
`the thymus, spleen and the whole length of the small intestine were
`removed and placed in sterile Petri dishes containing medium.
`
`2.2. Faecal sample preparation and bifidobacteria quantification
`
`Individual rat faeces were collected before rats were sacrificed and
`stored at −70 °C until used. After thawing all of the faecal sample, the
`
`preparation of bacterial DNA were conducted as described by Wang
`RF [10]. An amount of 0.5 g of faeces was added to 9 ml of sterile
`phosphate-buffered saline (PBS, 0.05 M, pH 7.4) and mixed well by
`inverting and surging the tube for 5 to 10 min, then centrifuged at low
`speed (1440 rpm) for 5 min to collect the upper phases; this was
`repeated three times. The upper phases were then centrifuged at high
`speed (9200 rpm) for 3 min to collect the bacterial cells in the pellets.
`After washing four times with PBS and once with distilled water, the
`cells in the pellets were resuspended with 50 µl distilled water and
`50 µl 1% Triton X-100, boiled at 100 °C for 5 min, and immediately
`cooled down in ice water. The bifidobacteria in pure cultures with an
`accurate quantity of 5 × 1010 CFU/ml were directly centrifuged at
`9200 rpm for 3 min and then were washed twice with PBS and once
`with water, suspended, serially diluted, boiled, and cooled in ice water
`used as standard. The primer set was designed from the 16S rRNA
`gene sequence available from GenBank: GGGTGGTAATGCCGGATG
`(P1); CCACCGTTACA CCGGGAA (P2), with the product length 517
`base pair. Two microlitres of each sample was directly added to 48 µl
`of PCR mixture containing 25 µl of Real time PCR Master Mix
`(TOYOBO,
`Japan) and 0.2 µM of each primer. The amplifying
`conditions were: 95 °C for the first 20 min, then 95 °C for 30 s, 60 °C
`for 30 s and 72 °C for 40 s, for 40 cycles. The amount of bifidobacteria
`in the unknown samples was determined by interpolating the
`threshold cycle values to the standard curve, and the results were
`expressed as log10 CFU/g faeces.
`
`2.3. Preparation of single-cell suspensions
`
`The cellular suspensions of thymus and spleen were prepared by
`chopping the tissues into small pieces with a sterile scissor and then
`grinding mechanically with a 100 mesh stainless steel sieve. The
`resulting suspensions were then transferred to a tube and centrifuged
`at 1500 rpm for 5 min to collect the cell pellets. After washing twice
`with Hanks, the cells were resuspended and adjusted to a final
`concentration of 1 × 106 cells/ml in Hanks. To prepare the cellular
`suspension of Peyer's Patches (PPs), all PPs were carefully excised
`from the whole length of the small intestine using a curved scissor,
`chopped and then ground mechanically with a 200 mesh stainless
`steel sieve. The resulting suspensions were handled in the same way
`as that of the thymus and spleen.
`
`2.4. Fluorescence staining and flow cytometry analysis
`
`By using direct immunofluorescence, the development of T cells
`(immature CD3+CD4+CD8+ and mature CD3+CD4+ or CD3+
`CD8+ T cell) in thymus, the proportion of T-cell subsets (CD3+CD4+
`helper T cell, CD3+CD8+ cytotoxic T cell, and CD4+CD25+
`regulatory T cell, CD161+ natural killer cell), the number and
`maturation of DCs (OX62+ cell [11] and fluorescence intensity of
`CD86) and B cells (CD45RA+ cell [12] and fluorescence intensity of
`immunoglobulin (Ig)M heavy chain (mIgM)) in peripheral blood,
`spleen and PPs were determined. For the staining of thymus, spleen
`and PPs cells, 1 × 105 cells/tube were incubated with antibodies for
`20 min, rinsed with PBS, centrifuged at 1000 rpm for 5 min, and then
`resuspended in PBS. For blood studies, 100 µl whole blood was
`incubated with antibodies for 20 min. The blood was then lysed with
`FACS Lysing Solution (BD Biosciences, USA), rinsed with PBS,
`centrifuged at 1000 rpm for 5 min, and resuspended in PBS. Analysis
`was done with a FACSCalibur flow cytometer (BD Biosciences). The
`following mouse monoclonal antibodies were used: FITC anti-CD3
`(1 µg/106cells), PE anti-CD4 (0.25 µg/106cells), APC anti-CD8 (0.5 µg/
`106cells), FITC anti-CD25 (1 µg/106cells) and PE anti-CD45RA (1 µg/
`106cells) (all from Biolegend, San Diego, CA), PE anti-OX62 (10 µl/
`tube), FITC anti-CD86 (10 µl/tube), PE anti-CD161 (10 µl/tube) and
`FITC anti-mIgM (4 µl/tube) (all from Serotec, UK). Corresponding
`isotype-matched mAbs were used as controls.
`
`Genome Ex. 1005
`Page 2 of 8
`
`
`
`P. Dong et al. / Early Human Development 86 (2010) 51–58
`
`53
`
`2.5. PBMCs cultured in vitro
`
`Peripheral blood mononuclear cells (PBMCs) were isolated from
`heparinised diluted blood by density gradient centrifugation over
`Ficoll–Hypaque gradients (SABC, Shanghai, China). After being
`washed twice with D-Hanks, the cells were resuspended at a
`concentration of 1 × 106 cells/ml
`in RPMI1640 culture medium
`(GIBCO, USA) supplemented with 10% heat-inactivated neonatal calf
`serum (Sijiqing, Hangzhou, China), 100 U/ml penicillin and 100 µg/ml
`streptomycin. The cell suspension was then incubated in a round
`bottom and ninety-six-well culture plate (Falcon, USA) at
`1 × 105 cells/well with the stimulation of phytohaemagglutinin
`(PHA, 5 µg/ml, Sigma, USA) or Staphylococcus aureus cells (SAC,
`0.0056% w/v, Calbiochem, USA). The plates were placed at 37 °C in an
`environment of 5% CO2. After being incubated with PHA for 24 h and
`48 h, the cells were harvested, mixed well with TRIzol (Invitrogen,
`USA) and stored at −70 °C until analysis of cytokine expression by
`RT-PCR. Cell-free supernatants were obtained after the PBMCs were
`incubated with SAC for 5 d and stored at −70 °C until assayed for
`antibody production by ELISA.
`
`2.6. RNA isolation and reverse transcription
`
`To investigate the mRNA levels of IL-12 (mainly secreted by DCs),
`Th1/Th2 (IFN-γ/ IL-4) and regulatory (IL-10, Foxp3) cytokines in
`intestinal mucosa, the mucosa of the small intestine was scraped and
`then put in the mortar and ground quickly with liquid nitrogen. Total
`RNA was isolated using TRIzol (Invitrogen) according to the
`manufacturer's instructions. For the gene expression of these
`cytokines in PHA-stimulated PBMCs, total RNA was isolated from
`the harvested cells, which had been transferred to TRIzol in the same
`way. The RNA concentration was measured by absorbance at 260 nm
`in a spectrophotometer (Shimadzu UV-1601, Japan). Two micrograms
`of total RNA was then reverse transcribed into cDNA with moloney
`murine leukaemia virus reverse transcriptase (Promega, USA)
`according to the manufacturer's instructions. After reverse transcrip-
`tion, the 25 µl reaction was diluted to 125 µl so that 2.5 µl of RT
`product added to a PCR mixture would be equivalent to the reverse
`transcription of 40 ng total RNA.
`
`2.7. Real-time quantitative PCR
`
`SYBR Green dye and Mastercycler ep realplex4 (Eppendorf,
`Germany) were used for Real-Time PCR. The sequence of primers,
`annealing temperature and PCR product size are described in Table 1.
`Quantitative PCR was carried out on a 25 µl final volume: 12.5 µl of
`Real time PCR Master Mix (TOYOBO), 0.2 µM of each primer and 2.5 µl
`of cDNA. The amplifying conditions were: 95 °C for the first 20 min,
`then 95 °C for 30 s, 54–60 °C (Table 1) for 30 s, and 72 °C for 40 s, for
`
`Table 1
`Primers, annealing temperatures and product sizes of PCR for β-actin and cytokine gene
`detection.
`
`Genes
`β-actin
`
`IL-12
`
`IFN-γ
`
`IL-4
`
`IL-10
`
`Foxp3
`
`Primers (5′ →3′)
`
`Ta (°C)
`
`Product (bp)
`
`P1: AAGATCCTGACCGAGCGTGG
`P2: CAGCACTGTGTTGGCATAGAGG
`P1: TCAGGGACATCATCAAACCG
`P2: ACGCACCTTTCTGGTTACACTC
`P1: GAAAGACAACCAGGCCATCAG
`P2: TCATGAATGCATCCTTTTTTGC
`P1: CCACGGAGAACGAGCTCATC
`P2: GAGAACCCCAGACTTGTTCTTCA
`P1: GCCAAGCCTTGTCAGAAATGA
`P2: TCCCAGGGAATTCAAATGCT
`P1: TTCACCTATGCCACCCTC
`P2: CACTGCTCCCTTCTCACTC
`
`58
`
`58
`
`54
`
`60
`
`56
`
`57
`
`320
`
`201
`
`101
`
`101
`
`101
`
`198
`
`P1: sense primer; P2: antisense primer; bp: base pair.
`
`40 cycles. β-actin was used as quality control. Experiments were
`performed in duplicate to ensure the reproducibility of the technique.
`Amplification specificity was checked using a melting curve following
`the manufacturer's instructions. The relative number of molecules of
`each transcript was determined by interpolating the threshold cycle
`values of the unknown samples to each standard curve.
`
`2.8. Enzyme-linked immunosorbent assay
`
`To determine the basal concentration of cytokines (IL-12, IFN-γ,
`IL-4 and IL-10) and immunoglobulin (IgG, IgM, IgA and IgE) in plasma,
`the plasma samples were prepared by having the heparinised blood
`coagulated naturally at room temperature for 15 min and then
`centrifuged at 2000 rpm for 10 min to collect the upper phases. The
`sample quantification was conducted using a double antibody
`sandwich ELISA with the kits (for cytokines, Jingmei, Beijing, China;
`for immunoglobulin,
`ICL, USA) according to the manufacturer's
`instructions. The level of IgG and IgM in cell-free culture supernatants
`was measured in the same way to investigate the ability of
`immunoglobulin secretion by SAC-stimulated PBMCs. The limits of
`detection of these ELISA kits are as follows: IL-12, 4 pg/ml; IFN-γ,
`7 pg/ml; IL-4, 7 pg/ml; IL-10, 6 pg/ml; IgG, IgM and IgA, 5 ng/ml; and
`IgE, 0.2 ng/ml.
`
`2.9. Statistical analyses
`
`Data are expressed as means and standard deviations (SD). One-
`way ANOVA was applied to examine group differences, with further
`multiple comparisons using a Bonferroni test (Stata ver. 7.0, Stata
`Corp., USA). A p-value of less than 0.05 was considered statistically
`significant.
`
`3. Results
`
`3.1. The amount of bifidobacteria in faecal samples
`
`To evaluate the actual results of bifidobacteria minimisation in the
`BM group, as well as the extra colonisation of it in the BS group, the
`amount of bifidobacteria in faecal samples was detected by RT-
`fluorescence quantitative PCR. The results showed that, as compared
`with the control of the same age, the resident bifidobacteria in the BM
`group decreased by three orders of magnitude at the end of three
`weeks and decreased by four orders of magnitude at the end of six
`weeks, whereas that in the BS group increased by four orders of
`magnitude at the end of three weeks and maintained this level to the
`end of six weeks (n = 10, p < 0.001 for all, Bonferroni test) (Fig. 1). In
`addition, bifidobacteria minimisation or supplementation didn't
`result in any body weight or organ (the thymus, spleen and PPs)
`weight difference at any age (data not shown), as well as the organ
`gross observation, except that at the end of six weeks, the intestine of
`rats in the BM group had excessive gas and mucus (especially the
`cecum).
`
`3.2. The modulation of bifidobacteria on the differentiation, maturation
`and function of DCs
`
`To determine the modulation of intestinal bifidobacteria on DCs,
`the number and maturation of DCs in the peripheral blood, spleen and
`PPs, the gene expression of IL-12 (mainly secreted by DCs) in
`intestinal mucosa and cultured PBMCs, as well as the secretion of it in
`plasma were determined by flow cytometry, RT-PCR and ELISA,
`respectively. For the level of surface marker CD86 (co-stimulatory
`molecule) expression increases as DCs mature gradually and thus
`reflects DC developmental stage [13]. It was found that in PPs and at
`six weeks, as compared with the control (19.17 (2.32)), the Geo Mean
`(SD) fluorescence intensity of CD86 in the BM group decreased
`
`Genome Ex. 1005
`Page 3 of 8
`
`
`
`54
`
`P. Dong et al. / Early Human Development 86 (2010) 51–58
`
`CD8+ cytotoxic T cell, and CD4+CD25+ regulatory T cell, CD161+
`natural killer cell) in the peripheral blood, spleen and PPs was also
`studied by flow cytometry, and none of the T-cell subsets differed
`significantly among the three groups in all areas (Table 2).
`
`3.4. The impact of bifidobacteria on the T-helper cell response
`
`To determine whether intestinal bifidobacteria affect the balance
`of Th1 and Th2, the mRNA levels of Th1/Th2 (IFN-γ/ IL-4) cytokines in
`intestinal mucosa and cultured PBMCs, as well as the secretion of
`them in plasma were measured with RT-PCR and ELISA respectively.
`The results showed that, as compared with the control, the BM group
`had an increased protein level of IL-4 in plasma at six weeks (n = 10,
`p = 0.006, Bonferroni test), but a decreased IFN-γ/IL-4 mRNA ratio in
`intestinal mucosa both at three weeks and six weeks (n = 10,
`p = 0.011, p = 0.015 respectively, Bonferroni test), as well as a
`decreased IFN-γ gene transcript in cultured PBMCs at six weeks
`(n = 10, p = 0.034, Bonferroni test). The BS group, however, had up-
`regulated IFN-γ mRNA and IFN-γ/IL-4 ratio in intestinal mucosa both
`at three weeks and six weeks (n = 10, p < 0.001 for all, Bonferroni
`test), as well as increased IFN-γ gene expression in cultured PBMCs at
`six weeks (n = 10, p = 0.035, Bonferroni test) (Fig. 3).
`
`3.5. The modulation of bifidobacteria on the regulatory T cell response
`
`To further evaluate the modulation of intestinal bifidobacteria on
`the Treg cell response, the number of CD4+CD25+ Treg cells in the
`peripheral blood, spleen and PPs, the expression of regulatory (IL-10,
`Foxp3) cytokines in intestinal mucosa and cultured PBMCs, as well as
`IL-10 secretion in plasma were determined by flow cytometry, RT-PCR
`and ELISA, respectively. We found that at both three weeks and six
`weeks, the BM group had a decreased expression of IL-10 mRNA in the
`intestinal mucosa (n = 10, p = 0.022, p = 0.012 respectively, Bonfer-
`roni test), whereas the BS group had an increased expression (n = 10,
`p = 0.015, p = 0.011 respectively, Bonferroni test), as compared with
`the control (Fig. 4). Expression of IL-10 outside the gut, Foxp3 gene
`expression (data not shown) and the percentage of CD4+CD25+ Treg
`cells (as has been noted) in all areas showed no significant group
`differences.
`
`3.6. The effect of bifidobacteria on immunoglobulin synthesis
`
`To investigate the effect of intestinal bifidobacteria on immuno-
`globulin secretion, the number and maturation of B cells in the
`peripheral blood, spleen and PPs, the basal level of immunoglobulin
`(IgG, IgM, IgA and IgE) in plasma and the production of IgG and IgM by
`SAC-stimulated PBMCs were determined by flow cytometry and
`ELISA, respectively. We found that at six weeks, after PBMCs were
`cultured with SAC for 5d, the BM group had a decreased production of
`IgM (299.91 (100.03) ng/ml), whereas the BS group had an increased
`production of it (749.58 (85.58) ng/ml), as compared with the control
`(507.16 (89.8) ng/ml) (p < 0.001, one-way ANOVA; p = 0.012 for the
`BM, p = 0.009 for the BS, Bonferroni test) (n = 10). The number and
`maturation of B cells (the percentage of CD45RA + cells and
`fluorescence intensity of mIgM) in all areas showed no significant
`group differences (Table 2); this was also the case for the level of
`immunoglobulin in plasma (data not shown).
`
`4. Discussion
`
`Early colonising flora of the gut is crucial in the development of the
`body's immune system. Bifidobacteria, as the predominant bacteria in
`the gut during the early period of life, could play a major role in this
`process. In our present study, feeding the neonatal rats daily with
`sufficient antibiotics and keeping them in a strict barrier environment
`effectively minimised the bifidobacteria in the gut; conversely, B.
`
`Fig. 1. Amount of bifidobacteria in faecal samples, measured by RT-fluorescence
`quantitative PCR at the end of one, three and six weeks, showing the effective
`bifidobacteria minimisation in the BM group and bifidobacteria supplementation in the
`BS group. ‡p values were obtained using one-way ANOVA to examine group differences,
`asterisks indicate statistical difference vs. control (**p <0.01) through the further
`multiple comparisons using a Bonferroni test (n = 10).
`
`significantly (16.89 (1.77)), whereas that in the BS group increased
`significantly (22.33 (2.09)) (p = 0.013, One-way ANOVA; p = 0.024
`for the BM, p = 0.015 for the BS, Bonferroni test) (n = 10). The results
`of RT-PCR showed that the BS group had an increased expression of IL-
`12 mRNA in the intestinal mucosa, both at three weeks and six weeks
`(n = 10, p = 0.039, p < 0.001 respectively, Bonferroni test); whereas
`the BM group had a decreased expression of it at six weeks (n = 10,
`p < 0.001, Bonferroni test) (Fig. 2). DC maturation and IL-12
`expression outside the gut showed no significant group differences,
`as well as DC number (the percentage of OX62+ cells) in all areas
`(data not shown).
`
`3.3. The effect of bifidobacteria on the development of T cells in the
`thymus
`
`Using flow cytometry, we studied the effect of intestinal bifido-
`bacteria on the development of T cells in the thymus. We found that in
`the thymus, the immature CD4+CD8+ T cell percentage in the BM
`group was significantly higher than that in the control group, both at
`three weeks and six weeks (n = 10, p = 0.043, p = 0.022 respectively,
`Bonferroni test), but the mature CD4+ or CD8+ T cell percentage was
`markedly lower than that in the control group at three weeks (n = 10,
`p = 0.036, p = 0.031 respectively, Bonferroni test). The BS group was
`not significantly different than the control however. In addition, the
`proportion of each T-cell subset (CD3+CD4+ helper T cell, CD3+
`
`Fig. 2. Effect of intestinal bifidobacteria minimisation (the BM group) or supplemen-
`tation (the BS group) on the expression of IL-12 mRNA in the intestinal mucosa.
`‡p values were obtained using one-way ANOVA to examine group differences, asterisks
`indicate statistical difference vs. control (*p <0.05, **p < 0.01) through the further
`multiple comparisons using a Bonferroni test (n = 10).
`
`Genome Ex. 1005
`Page 4 of 8
`
`
`
`Table 2
`Effects of intestinal bifidobacteria on T-cell development in thymus, proportion of each lymphocyte subset and B-cell maturation in peripheral blood, spleen and PPs.
`
`P. Dong et al. / Early Human Development 86 (2010) 51–58
`
`55
`
`dCD3+CD4+CD8+
`1W
`3W
`6W
`dCD3+CD4+
`1W
`3W
`6W
`dCD3+CD8+
`1W
`3W
`6W
`dCD4+CD25+
`1W
`3W
`6W
`dCD161+
`1W
`3W
`6W
`dCD45RA+
`1W
`3W
`6W
`emIgM+
`1W
`3W
`6W
`
`Control
`
`65.13(10.09)
`49.25(6.13)
`30.09(5.06)
`
`8.21(1.12)
`11.46(2.30)
`12.27(2.17)
`
`4.65(0.24)
`9.44(0.76)
`6.76(0.52)
`
`Thymus
`
`aBM
`
`65.31(9.76)
`55.21(7.20)*
`44.31(5.98)*
`
`7.89(0.98)
`8.62(1.51)*
`11.49(1.25)
`
`4.52(0.19)
`6.33(0.51)*
`5.98(0.45)
`
`bBS
`
`64.98(9.55)
`48.81(5.21)
`31.21(4.03)
`
`8.05(1.10)
`11.95(1.76)
`12.12(1.34)
`
`4.31(0.12)
`9.19(0.58)
`6.13(0.60)
`
`–
`–
`–
`
`–
`–
`–
`
`–
`–
`–
`
`–
`–
`–
`
`–
`–
`–
`
`–
`–
`–
`
`–
`–
`–
`
`–
`–
`–
`
`–
`–
`–
`
`–
`–
`–
`
`–
`–
`–
`
`–
`–
`–
`
`cp
`
`0.998
`0.039
`0.012
`
`0.896
`0.043
`0.747
`
`0.841
`0.046
`0.354
`
`–
`–
`–
`
`–
`–
`–
`
`–
`–
`–
`
`–
`–
`–
`
`Control
`
`7.74(1.44)
`2.40(0.71)
`1.70(0.36)
`
`19.84(2.65)
`29.35(5.38)
`44.55(4.23)
`
`7.66(1.44)
`11.73(2.11)
`22.55(3.35)
`
`1.47(0.11)
`1.97(0.21)
`2.30(0.23)
`
`2.08(0.31)
`7.66(1.11)
`5.29(0.48)
`
`17.61(0.93)
`21.82(1.39)
`18.16(2.21)
`
`24.94(3.11)
`17.96(2.61)
`22.47(2.01)
`
`Blood
`
`BM
`
`8.67(2.78)
`2.35(1.13)
`1.98(0.45)
`
`21.13(1.98)
`27.11(6.13)
`42.99(3.29)
`
`6.31(1.05)
`12.47(1.98)
`24.07(4.84)
`
`1.22(0.18)
`2.16(0.15)
`2.65(0.25)
`
`1.79(0.54)
`8.25(0.98)
`5.57(0.55)
`
`15.39(1.12)
`21.16(2.27)
`19.55(3.43)
`
`25.21(2.60)
`17.77(3.58)
`20.35(2.33)
`
`BS
`
`8.09(2.30)
`2.88(0.52)
`1.61(0.28)
`
`20.05(3.14)
`26.45(4.99)
`46.31(3.28)
`
`6.06(2.33)
`14.55(2.31)
`24.10(4.29)
`
`1.28(0.21)
`2.03(0.32)
`2.57(0.18)
`
`1.76(0.37)
`8.31(1.40)
`6.02(0.56)
`
`15.79(2.04)
`20.88(2.41)
`16.64(3.07)
`
`23.39(3.07)
`16.49(3.12)
`20.68(3.14)
`
`p
`
`0.776
`0.584
`0.189
`
`0.581
`0.069
`0.055
`
`0.772
`0.084
`0.163
`
`0.065
`0.282
`0.059
`
`0.069
`0.233
`0.340
`
`0.081
`0.454
`0.052
`
`0.399
`0.652
`0.113
`
`CD3+CD4+CD8+
`1W
`3W
`6W
`CD3+CD4+
`1W
`3W
`6W
`CD3+CD8+
`1W
`3W
`6W
`CD4+CD25+
`1W
`3W
`6W
`CD161+
`1W
`3W
`6W
`CD45RA+
`1W
`3W
`6W
`mIgM+
`1W
`3W
`6W
`
`Control
`
`4.11(0.31)
`3.69(0.37)
`2.02(0.48)
`
`21.94(5.39)
`22.78(4.55)
`20.86(4.08)
`
`13.45(1.57)
`11.31(1.79)
`10.12(2.41)
`
`1.88(0.14)
`1.93(0.17)
`2.39(0.18)
`
`7.42(0.95)
`10.21(0.78)
`8.45(1.24)
`
`37.41(6.28)
`43.51(5.87)
`30.39(5.04)
`
`22.96(3.05)
`31.25(2.67)
`41.03(2.23)
`
`Spleen
`
`BM
`
`4.09(0.45)
`4.06(0.87)
`1.19(1.13)
`
`18.19(4.27)
`24.23(5.17)
`18.06(5.33)
`
`10.53(2.41)
`9.36(1.50)
`7.19(3.68)
`
`1.71(0.21)
`2.11(0.22)
`2.43(0.25)
`
`5.99(2.11)
`10.06(1.03)
`6.39(2.09)
`
`39.15(7.13)
`39.11(6.93)
`30.06(3.98)
`
`19.58(3.66)
`34.29(3.30)
`40.22(3.38)
`
`BS
`
`p
`
`Control
`
`3.75(0.39)
`3.99(0.55)
`1.61(0.85)
`
`19.82(3.66)
`25.01(4.44)
`17.87(5.51)
`
`13.07(3.42)
`10.55(2.30)
`9.48(2.19)
`
`1.77(0.13)
`1.85(0.19)
`2.16(0.20)
`
`5.92(1.72)
`11.05(0.67)
`6.88(1.56)
`
`40.01(6.03)
`42.55(7.02)
`33.19(3.71)
`
`23.11(4.05)
`30.97(4.15)
`41.18(4.06)
`
`0.072
`0.060
`0.225
`
`0.060
`0.082
`0.224
`
`0.115
`0.644
`0.098
`
`0.150
`0.373
`0.551
`
`0.068
`0.197
`0.058
`
`0.062
`0.055
`0.266
`
`0.077
`0.064
`0.549
`
`0.99(0.12)
`1.17(0.14)
`1.58(0.19)
`
`18.13(1.35)
`20.38(4.02)
`21.29(2.87)
`
`5.56(1.94)
`5.37(1.39)
`7.43(1.82)
`
`5.36(0.18)
`6.02(0.19)
`8.47(1.35)
`
`1.99(0.12)
`2.94(0.41)
`2.77(0.37)
`
`53.39(11.45)
`60.01(16.13)
`57.62(14.61)
`
`12.12(3.31)
`19.37(2.60)
`19.19(4.05)
`
`PPs
`
`BM
`
`0.98(0.24)
`1.26(0.05)
`1.39(0.22)
`
`16.76(2.21)
`19.61(2.19)
`19.59(2.95)
`
`4.11(1.19)
`5.29(1.43)
`5.78(1.31)
`
`6.03(1.12)
`5.79(0.34)
`7.11(0.79)
`
`1.64(0.11)
`3.03(0.58)
`3.49(0.71)
`
`49.75(15.42)
`64.12(15.52)
`54.19(10.09)
`
`15.13(4.54)
`22.27(3.79)
`17.81(3.99)
`
`BS
`
`1.23(0.25)
`1.22(0.18)
`1.56(0.27)
`
`15.48(1.39)
`21.11(4.67)
`22.18(2.06)
`
`6.31(1.71)
`6.56(2.42)
`7.76(2.07)
`
`5.93(0.77)
`6.11(0.25)
`9.09(1.16)
`
`1.73(0.19)
`3.43(0.44)
`2.84(0.62)
`
`51.11(13.39)
`59.98(11.31)
`56.05(13.36)
`
`13.93(5.16)
`20.11(4.12)
`20.15(5.63)
`
`p
`
`0.255
`0.774
`0.069
`
`0.079
`0.661
`0.177
`
`0.064
`0.113
`0.472
`
`0.054
`0.344
`0.092
`
`0.221
`0.057
`0.121
`
`0.077
`0.060
`0.112
`
`0.227
`0.545
`0.066
`
`Asterisks indicate statistical difference vs. control (*p <0.05) through the further multiple comparisons using a Bonferroni test, n = 10.
`a : the bifidobacteria minimisation group (BM).
`b : the bifidobacteria supplementation group (BS).
`c : p values were obtained using one-way ANOVA to examine group differences.
`d : data were expressed as the percentage of positive cells with respect to total lymphocytes (mean (SD)).
`e : data were expressed as the fluorescence intensity of mIgM in CD45RA+ cells (mean (SD)).
`
`longum (a bifidobacterial species that is widely used in infant formula
`and probiotic functional foods) successfully colonised the gut after the
`daily supplementation of 1 × 1010 CFU from birth. Although none of
`the immunological parameters observed changed at the end of one
`
`week (the neonatal period), several aspects of the immunity were
`affected by both bifidobacteria minimisation and supplementation at
`the end of three weeks (the infant period), with the most obvious
`change at six weeks of age (the adolescent period). These suggest that
`
`Genome Ex. 1005
`Page 5 of 8
`
`
`
`56
`
`P. Dong et al. / Early Human Development 86 (2010) 51–58
`
`Fig. 3. Effect of intestinal bifidobacteria minimisation (the BM group) or supplementation (the BS group) on Th1/Th2 (IFN-γ/ IL-4) cytokines profile. (A) Protein level of IL-4 in the
`plasma; (B) expression of IFN-γ mRNA in the intestinal mucosa; (C) IFN-γ/IL-4 mRNA ratio in the intestinal mucosa; (D) expression of IFN-γ mRNA in phytohaemagglutinin (PHA)-
`stimulated PBMCs. ‡p values were obtained using one-way ANOVA to examine group differences, asterisks indicate statistical difference vs. control (*p < 0.05, **p< 0.01) through the
`further multiple comparisons using a Bonferroni test (n = 10).
`
`intestinal bifidobacteria minimisation or extra
`the influence of
`colonisation on immune development may become apparent only if
`this kind of change in bifidobacteria persists long enough in the gut.
`DCs are the gatekeepers of immune response and are the principal
`stimulators of naive T cells, a property that distinguishes them from
`all other APCs [7]. While a number of
`in vitro studies have
`demonstrated that DCs are the target cells of a variety of probiotic
`strains [8,9,14–16], to date, few st