`BioMed Research International
`Volume 2014, Article ID 602832, 11 pages
`http://dx.doi.org/10.1155/2014/602832
`
`Research Article
`Microencapsulated Bifidobacterium longum subsp. infantis
`ATCC 15697 Favorably Modulates Gut Microbiota and Reduces
`Circulating Endotoxins in F344 Rats
`
`Laetitia Rodes,1 Shyamali Saha,1,2 Catherine Tomaro-Duchesneau,1 and Satya Prakash1
`1 Biomedical Technology and Cell Therapy Research Laboratory, Department of Biomedical Engineering and Artificial Cells and
`Organs Research Centre, Faculty of Medicine, McGill University, 3775 University Street, Montreal, QC, Canada H3A 2B4
`2 Faculty of Dentistry, McGill University, Montreal, QC, Canada H3A 2B2
`
`Correspondence should be addressed to Satya Prakash; satya.prakash@mcgill.ca
`
`Received 18 February 2014; Accepted 5 April 2014; Published 22 May 2014
`
`Academic Editor: Atsushi Sakuraba
`
`Copyright Β© 2014 Laetitia Rodes et al. This is an open access article distributed under the Creative Commons Attribution License,
`which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
`
`The gut microbiota is a bacterial bioreactor whose composition is an asset for human health. However, circulating gut microbiota
`derived endotoxins cause metabolic endotoxemia, promoting metabolic and liver diseases. This study investigates the potential of
`orally delivered microencapsulated Bifidobacterium infantis ATCC 15697 to modulate the gut microbiota and reduce endotoxemia
`in F344 rats. The rats were gavaged daily with saline or microencapsulated B. infantis ATCC 15697. Following 38 days of
`supplementation, the treated rats showed a significant (P < 0.05) increase in fecal Bifidobacteria (4.34 Β± 0.46 versus 2.45 Β± 0.25% of
`total) and B. infantis (0.28 Β± 0.21 versus 0.52 Β± 0.12 % of total) and a significant (P < 0.05) decrease in fecal Enterobacteriaceae (0.80 Β±
`0.45 versus 2.83 Β± 0.63% of total) compared to the saline control. In addition, supplementation with the probiotic formulation
`reduced fecal (10.52 Β± 0.18 versus 11.29 Β± 0.16 EU/mg; P = 0.01) and serum (0.33 Β± 0.015 versus 0.30 Β± 0.015 EU/mL; P = 0.25)
`endotoxins. Thus, microencapsulated B. infantis ATCC 15697 modulates the gut microbiota and reduces colonic and serum
`endotoxins. Future preclinical studies should investigate the potential of the novel probiotic formulation in metabolic and liver
`diseases.
`
`1. Introduction
`
`The human gut microbiota forms a large ecosystem con-
`sisting of approximately 1014 bacterial cells, a number 10
`times greater than the number of human body cells [1].
`The microbiome, which represents the collective genomes
`of the gut microbiota, is approximately 150 times larger
`than the human gene complement, with an estimated set
`of 3.3 million microbial genes [2]. The majority of the
`intestinal bacteria reside in the colon and belong to the
`Bacteroidetes, Firmicutes, and Actinobacteria phyla [2]. It
`is now well established that the gut microbiota is engaged
`in a dynamic interaction with the host, exerting essential
`protective, functional, and metabolic functions [3]. However,
`an imbalance in the composition of the gut microbiota, a
`
`state called gut dysbiosis, can disrupt the functions of the gut
`microbiota and impair human health [3].
`Endotoxins are immunogenic molecules derived from the
`cell wall of Gram-negative bacteria that are produced in large
`quantities by the human gut microbiota [4]. Gut-derived
`endotoxins can enter the bloodstream, causing metabolic
`endotoxemia, a phenomenon characterized by low levels of
`circulating endotoxins [5β7]. Metabolic endotoxemia causes
`a mild and continuous induction of proinflammatory medi-
`ators, resulting in low-grade systemic inflammation [5β7].
`This inflammatory state contributes to the progression of
`many human diseases, including obesity, type 2 diabetes, and
`liver, cardiovascular, and inflammatory bowel diseases [5β
`7]. Although the true incidence and prevalence of metabolic
`endotoxemia remain unknown, recent data suggests that
`
`Genome & Co. v. Univ. of Chicago, PGR2019-00002
`UNIV. CHICAGO EX. 2002 - 1/12
`
`
`
`2
`
`BioMed Research International
`
`metabolic endotoxemia occurs all over the globe, regardless
`of ethnicity [8]. Currently, there is no available intervention
`to reduce metabolic endotoxemia. Although many strategies
`have been developed to combat endotoxemia (e.g., antimi-
`crobial therapies, endotoxins-binding proteins, and extracor-
`poreal endotoxins absorbers), none is available for use in
`metabolic endotoxemia [9β11]. Thus, there is an urgent need
`for a novel intervention to reduce metabolic endotoxemia.
`Since the gut microbiota is the major source of endotoxins
`in metabolic endotoxemia, it may be a promising therapeutic
`target to reduce the condition.
`the gut micro-
`Due to the inherent plasticity of
`biota, probiotic biotherapeutics can promote human health
`by modulating the gut microbiota composition towards
`health-promoting bacterial populations [12]. Probiotics are
`βlive microorganisms, which, when consumed in adequate
`amounts, confer a health benefit on the hostβ [12]. Bifi-
`dobacterium spp. are common probiotic bacteria that are
`natural inhabitants of the human gastrointestinal tract and
`are present in many fermented dairy products [2, 12]. Sugar
`metabolism in Bifidobacteria produces high amounts of
`organic acids such as acetic and lactic acids [13]. In the
`colonic environment, acetic and lactic acids either can exert
`antimicrobial activities or be used in de novo fatty acid
`synthesis by other bacterial populations, providing multiple
`pathways that can modulate the gut microbiota composition
`[14β18]. Usually, the effect of probiotics formulations on the
`human gut microbiota composition is investigated primarily
`in vitro in human colonic models and in vivo in conventional
`or gnotobiotic rodents before any testing in humans [3].
`Previous in vitro studies performed by our group have already
`demonstrated the potential of Bifidobacterium longum subsp.
`infantis (B. infantis) ATCC 15697 to modulate simulated
`human gut microbiota towards reduced colonic endotox-
`ins concentrations [19]. The present study investigates the
`use of orally delivered alginate-poly-L-lysine-alginate (APA)
`microencapsulated B. infantis ATCC 15697 to modulate the
`gut microbiota composition and reduce endotoxemia in F344
`conventional rats.
`
`2. Materials and Methods
`2.1. Animals, Experimental Design, and Treatment. Twelve
`F344 male rats were obtained from Charles River Laborato-
`ries (Wilmington, MA, USA) at five weeks of age (86β100 g).
`Rats were housed two per cage in a room with controlled
`temperature (22β24βC) and humidity. The rats were fed a
`standard diet and had free access to water throughout the
`trial. Following one-week acclimatization period, rats were
`randomly assigned, based on body mass values, into 2 groups
`(π = 6 per group): (1) control rats were administered 2 mL
`of 0.85% (w/v) NaCl and (2) treated rats were administered
`2 mL of APA microencapsulated B. infantis ATCC 15697 at
`9 CFU/g dissolved in 0.85% (w/v) NaCl. Dosage was
`performed by intragastric gavage once a day. The treatment
`period lasted for 38 days. Animal mass was measured weekly.
`Fresh feces were collected weekly and stored at β80βC until
`analysis. Serum from rats that had been fasted for 16 h
`
`5.5 Γ 10
`
`was collected biweekly by the lateral saphenous vein into
`Microtainer serum separator tubes from Becton Dickinson
`(Franklin Lakes, NJ, USA). Serum was obtained by allowing
`the blood to clot for a minimum of 30 min and centrifugation
`for 5 min at 10000 g. Serum samples were stored at β80βC
`until analysis. The rats were euthanized by CO2 asphyxiation
`and blood was withdrawn by cardiac puncture. Animal
`maintenance and experimental procedures complied with the
`Animal Care Committee of McGill University.
`
`infantis
`2.2. Bacterial Strain and Culture Conditions. B.
`ATCC 15697 was purchased from Cedarlane Laboratories
`(Burlington, ON, Canada). The bacterial strain was stored
`at β80βC in de Man, Rogosa, and Sharpe (MRS, Fisher
`Scientific, Ottawa, Canada) broth containing 20% (v/v)
`glycerol. An MRS agar plate was streaked from the frozen
`stock and incubated at 37βC under anaerobic conditions for
`24 h. One colony from the MRS agar plate was propagated
`into MRS broth and incubated at 37βC for 24 h. A 1% (v/v)
`inoculum was further passaged daily in MRS broth at 37βC.
`Bacterial cell viability was determined on MRS agar triplicate
`plates. Incubation was performed in anaerobic jars with
`anaerobe atmosphere-generating bags (Oxoid, Hampshire,
`United Kingdom) for 72 h at 37βC.
`
`2.3. Microencapsulation Procedure. Microencapsulation of B.
`infantis ATCC 15697 was performed according to the stan-
`dard protocol [20]. Briefly, the microcapsules were formed
`using an Inotech Encapsulator IER-20 (Inotech Biosystems
`International, Rockville, MD, USA) with a nozzle of 300 πm
`in diameter under sterile conditions, as previously described
`[21]. Bacterial cells were released from the microcapsules by
`homogenizing capsules in 0.1 M sodium citrate.
`
`2.4. Quantification of Fecal Bacterial Populations. Frozen
`feces were thawed and homogenized at a ratio of 0.1% (w/v) of
`feces in the ASL buffer provided with the QIAamp DNA stool
`Mini Kit (Qiagen, Toronto, ON, Canada). DNA was further
`extracted following the manufacturerβs kit instructions and
`stored at β20βC. The quantification of bacterial populations
`was carried out by Real-Time- (RT-) PCR using the Eco Real-
`Time PCR System (Illumina Inc., San Diego, CA, USA) and
`the ROX RT-PCR Master Mix (2X) (Fisher Scientific), as pre-
`viously described [21]. Enumeration of Enterobacteriaceae,
`Escherichia coli, Bacteroidetes, Bacteroides sp.-Prevotella sp.,
`Actinobacteria, Bifidobacterium sp., B. infantis, Firmicutes,
`and Lactobacillus sp. was performed using specific RT-PCR
`primer sequences (Table 1) [22β27]. RT-PCR signals specific
`to a bacterial group were normalized to the RT-PCR signals
`of total bacteria. The abundance of Bifidobacteria other than
`B. infantis was calculated as the difference between the
`abundance of total Bifidobacteria and that of B. infantis. A
`nontemplate control was included in each assay to confirm
`that the Ct value generated by the lowest DNA concentration
`was not an artifact. To determine the specificity of the DNA
`amplification reactions, a melt curve analysis was carried out
`after amplification.
`
`Genome & Co. v. Univ. of Chicago, PGR2019-00002
`UNIV. CHICAGO EX. 2002 - 2/12
`
`
`
`BioMed Research International
`
`Table 1: Primers used for the quantification of fecal bacterial populations.
`
`Target phylum or group
`All bacteria
`
`Phylum Firmicutes
`
`Genus Lactobacillus
`
`Phylum Actinobacteria
`
`Genus Bifidobacterium
`
`Species Bifidobacterium infantis
`
`Phylum Bacteroidetes
`
`Genus Bacteroides-Prevotella
`
`Family Enterobacteriaceae
`
`Species Escherichia coli
`
`Primer
`Bact-1369-F
`Bact-1492-R
`Firm-928-F
`Firm-1040-R
`Lact-05-F
`Lact-04-R
`Act-920-F3
`Act-1200-R
`Bif-164-F
`Bif-662-R
`F inf IS
`R inf IS
`CBF-798-F
`CBF-967-R
`Bacter-11-F
`Bacter-08-R
`Eco1457-F
`Eco1652-R
`E. coli-F
`E. coli-R
`
`Sequence (5σΈ to 3σΈ )
`CGGTGAATACGTTCCCGG
`TACGGCTACCTTGTTACGACTT
`TGAAACTCAAAGGAATTGACG
`ACCATGCACCACCTGTC
`AGCAGTAGGGAATCTTCCA
`CGCCACTGGTGTTCYTCCATATA
`TACGGCCGCAAGGCTA
`TRCTCCCCACCTTCCTCCG
`GGGTGGTAATGCCGGATG
`CCACCGTTACACCGGGAA
`CGCGAGCAAAACAATGGT T
`AACGATCGAAACGAACAATAGAGTT
`CRAACAGGATTAGATACCCT
`GGTAAGGTTCCTCGCGTAT
`CCTACGATGGATAGGGGTT
`CACGCTACTTGGCTGGTTCAG
`CATTGACGTTACCCGCAGAAGAAGC
`CTCTACGAGACTCAAGCT TGC
`CATGCCGCGTGTATGAAGAA
`CGGGTAACGTCAATGAGCAAA
`
`3
`
`Reference
`
`[22]
`
`[23]
`
`[24]
`
`[25]
`
`[26]
`
`[27]
`
`[23]
`
`[22]
`
`[24]
`
`[22]
`
`2.5. Endotoxins Quantification. Fecal and serum endotoxin
`concentrations were measured using the ToxinSensor Chro-
`mogenic Limulus amebocyte lysate (LAL) Endotoxin Assay
`Kit from GenScript (Piscataway, NJ, USA) under sterile
`conditions. For colonic analysis, fecal samples were diluted
`at a ratio of 15% (w/v) in endotoxin-free water. The samples
`were then vortexed for 1 min and the homogenate was
`centrifuged at 10000 g for 10 min. The endotoxins-containing
`supernatant was further stored at β20βC until endotoxins
`quantification. For serum analysis, serum was diluted at
`1 : 10 (v/v) in endotoxin-free water. Samples were assayed at
`different dilutions and plotted against a standard curve of
`endotoxins concentrations (0.0, 0.1, 0.25, 0.5, and 1.0 EU/mL),
`according to the manufacturerβs instructions.
`
`2.6. Quantification of Fecal Organic Acids. Fecal butyric,
`acetic, and lactic acids concentrations were determined by
`high-performance liquid chromatography (HPLC) using a
`Varian 335 model (Agilent, Fort Worth, TX, USA). Fecal
`samples were diluted at a ratio of 15% (w/v) in sterile
`distilled water. Then, the samples were vortexed for 1 min and
`the homogenate was centrifuged at 10000 g for 10 min. The
`organic acids-containing supernatant was stored at β20βC
`until HPLC analysis. The analysis was performed on a HPLC
`ion-exclusion column: Rezex ROA-Organic Acid H+ (8%),
`25 Γ 0.46 cm, set up with SecurityGuard guard Cartridges
`(Phenomenex, Torrance, CA, USA). The HPLC system con-
`sisted of a ProStar 335 diode array detector set at 210 nm and
`a ProStar 410 autosampler monitored using the Varian Star 6
`
`Chromatography Worstation (ProStar Version 6.0). Degassed
`5 mM H2SO4 was used as the mobile phase at a flow rate of
`0.2 mL/min. The injection volume was 10 πL and the analysis
`was carried out at room temperature. Before analysis, samples
`were thawed, mixed at a ratio of 4 : 5 (v/v) with an internal
`standard of 50 mM 2-ethylbutyric acid, filtered through a
`0.20 πm PROgene nylon membrane (Ultident, St. Laurent,
`QC, Canada) directly into HPLC vials, and immediately
`sealed and analyzed. Calibration curves were generated using
`seven different concentrations of standards: 1, 5, 10, 25, 50, 75,
`and 100 mM for acetic acid (ACP, St Leonard, QC, Canada)
`and 0.6, 3, 6, 15, 30, 45, and 60 mM for lactic and butyric
`acids (Supelco, Bellefonte, PA, USA). The organic acids were
`identified by comparing each peakβs retention time with those
`of standards.
`
`2.7. Statistical Analysis. The experimental results are pre-
`sented as the mean Β± standard error of the mean (SEM) (π =
`6). DβAgostino and Pearson normality test was performed
`to assess Gaussian distribution of the data. Bartlettβs test
`was performed to assess homogeneity of variances. Statistical
`difference between the treatment groups (saline versus APA
`microencapsulated B. infantis) was analyzed at endpoint (day
`38) using unpaired Studentβs t-test for parametric data or
`the Mann-Whitney test for nonparametric data. Correlations
`were performed using Pearsonβs correlation in the saline
`and APA microencapsulated B. infantis treatment groups at
`endpoint (day 38). Statistical significance was set at π < 0.05.
`
`Genome & Co. v. Univ. of Chicago, PGR2019-00002
`UNIV. CHICAGO EX. 2002 - 3/12
`
`
`
`4
`
`BioMed Research International
`
`β
`
`coli
`Species Escherichia
`
`β
`
`Enterobacteriaceae
`Family
`
`Prevotella
`Genus Bacteroid-
`
`(b)
`
`Bacteroidetes
`Phylum
`
`Total Gram-negative
`
`Saline
`APA B. infantis
`
`16
`
`10
`
`4
`
`024
`
`Genus Lactobacillus
`
`Phylum Firmicutes
`
`Other Bifidobacterium sp.
`
`β
`
`Species B. infantis
`
`β
`
`Genus Bifidobacterium
`
`(a)
`
`Phylum Actinobacteria
`
`Total Gram-positive
`
`Saline
`APA B. infantis
`
`110
`
`60
`
`10
`10
`
`05
`
`Figure 1: Effect of alginate-poly-L-lysine-alginate (APA) microencapsulated B. infantis ATCC 15697 supplementation on the abundance of
`fecal bacteria at endpoint (day 38): (a) bacteria that do not produce endotoxins and (b) potential endotoxins-producing bacteria. F344 rats
`were gavaged daily with APA microencapsulated B. infantis ATCC 15697 or saline during 38 days. Data represent the means Β± SEM (π = 6)
`of the abundance of each bacterial group (mean percentage of total bacteria) at endpoint (day 38). Statistical analysis was performed using
`unpaired Studentβs t-test or the Mann-Whitney test. βIndicates statistical significance between treatment groups (π < 0.05).
`
`All analyses were performed using the Prism software (Prism,
`Version 5.0, GraphPad Software, San Diego, CA, USA).
`
`associated with APA microencapsulated B. infantis ATCC
`15697 supplementation.
`
`3. Results
`3.1. Effect of APA Microencapsulated B. infantis ATCC 15697
`on Fecal Bacterial Populations. The effect of orally admin-
`istered APA microencapsulated B. infantis ATCC 15697 on
`fecal bacteria was investigated after 38 days of daily sup-
`plementation (Figure 1). Results showed that APA microen-
`capsulated B. infantis ATCC 15697 significantly increased
`the abundance of bacterial populations that do not produce
`endotoxins. There was a significant increase in Gram-positive
`Bifidobacteria (4.34 Β± 0.46 versus 2.45 Β± 0.25% of total;
`π = 0.001) and B. infantis (0.28 Β± 0.21 versus 0.52 Β± 0.12%
`of total; π = 0.002), as compared to the saline control.
`In addition, oral administration of APA microencapsulated
`B. infantis ATCC 15697 significantly reduced the levels of
`potential endotoxins-producing bacteria including Gram-
`negative Enterobacteriaceae (0.80 Β± 0.45 versus 2.83 Β± 0.63%
`of total; π = 0.026) and E. coli (0.01 Β± 0.01 versus 0.06 Β± 0.02%
`of total; π = 0.026). Furthermore, there was a nonsignificant
`increase in the abundance of total Gram-positivebacteria
`(89.11 Β± 14.27 versus 72.74 Β± 14.69% of total; π = 0.497)
`and a nonsignificant decrease in total Gram-negative bacteria
`(7.84 Β± 2.22 versus 13.75 Β± 1.92% of total; π = 0.074)
`
`3.2. Effect of APA Microencapsulated B. infantis ATCC 15697
`on the Concentration of Fecal Organic Acids. The effect
`of orally administered APA microencapsulated B. infantis
`ATCC 15697 on the levels of fecal organic acids was deter-
`mined after 38 days of daily supplementation (Figure 2).
`Results showed that butyric (12.14 Β± 1.34 versus 8.26 Β±
`1.34 πM; π = 0.025) and lactic (7.11 Β± 0.75 versus 5.09 Β±
`0.49 πM; π = 0.025) acids were significantly increased
`following supplementation with APA microencapsulated B.
`infantis ATCC 15697, as compared to the saline control. The
`increase in acetic acid following supplementation with APA
`microencapsulated B. infantis ATCC 15697 was nonsignifi-
`cant (22.46 Β± 2.40 versus 19.23 Β± 2.41 πM; π = 0.365).
`
`3.3. Effect of APA Microencapsulated B. infantis ATCC 15697
`on Fecal and Serum Endotoxins Concentrations. The effect
`of orally administered APA microencapsulated B. infantis
`ATCC 15697 on fecal and serum endotoxins was determined
`after 38 days of daily supplementation. Results showed that
`the probiotic formulation significantly reduced fecal endo-
`toxins concentrations at endpoint (38 days) compared to the
`saline control, with a change averaging 7.34% (10.52 Β± 0.18
`
`Genome & Co. v. Univ. of Chicago, PGR2019-00002
`UNIV. CHICAGO EX. 2002 - 4/12
`
`
`
`BioMed Research International
`
`5
`
`of fecal acetic acid and Enterobacteriaceae (π = β0.596;
`π = 0.041). There was also a significant positive correlation
`between the levels of fecal B. infantis and fecal butyric (π =
`0.752; π = 0.005) and lactic (π = 0.696; π = 0.012)
`acids. Furthermore, the concentration of fecal lactic acid
`was significantly positively correlated with the abundance of
`Lactobacilli (π = 0.659; π = 0.020).
`
`4. Discussion
`It has been suggested to administer live probiotic bacterial
`cells in high doses in the colon to modulate the gut microbiota
`composition to promote human health [28]. As the cell
`viability of bacteria is hindered by the harsh conditions of
`the gastrointestinal tract (e.g., gastric acid and bile salts in
`the small intestine), microencapsulation has been extensively
`used to provide probiotic bacterial cells with a physical
`barrier to protect and deliver viable cells to the colon [21, 29].
`Alginate microparticle systems have been used in particular
`because they are nontoxic, bioavailable, and cost-effective
`[21, 29]. Previous research has established the efficacy of APA
`microencapsulation as an effective delivery system to main-
`tain the cell viability of B. infantis ATCC 15697 in the colon
`[21]. In addition, in vitro studies have demonstrated that B.
`infantis administration to the gut microbiota modulated gut
`bacterial populations towards reduced colonic endotoxins
`concentrations [19]. Endotoxins are potent immunomodula-
`tory components derived from the cell wall of Gram-negative
`bacteria that can enter the blood circulation and cause
`metabolic endotoxemia [5β7]. The present study investigates
`the potential of orally delivered APA microencapsulated B.
`infantis ATCC 15697 to modulate the gut microbiota and
`lower endotoxemia in F344 rats.
`The study shows that oral supplementation with APA
`microencapsulated B. infantis ATCC 15697 for 38 days sig-
`nificantly increases the levels of fecal B. infantis and Bifi-
`dobacteria. Although fecal bacteria do not exactly reproduce
`the gut microbiota composition [30], they represent a good
`indicator of the changes arising in the colon [3, 31]. In
`addition, APA microencapsulated B. infantis ATCC 15697 sig-
`nificantly reduced fecal Gram-negative Enterobacteriaceae
`and E. coli compared to the saline treatment, in agreement
`with previous studies [32]. Furthermore, supplementation
`with the probiotic bacterial formulation nonsignificantly
`reduced fecal Gram-negative bacteria and increased Gram-
`positive bacteria. The lack of statistical significance may be
`due to underestimated cell counts of Gram-negative and -
`positive bacteria, calculated based on the cell counts of Gram-
`negative Bacteroidetes and Enterobacteriaceae, and Gram-
`positive Firmicutes and Actinobacteria, respectively.
`In addition, this study shows for the first time that sup-
`plementation with APA microencapsulated B. infantis ATCC
`15697 significantly reduced fecal endotoxins concentrations
`in vivo compared to the saline treatment. Moreover, there was
`a significant negative correlation between fecal endotoxins
`concentrations and the abundance of Bifidobacteria and B.
`infantis, as observed by others [33, 34]. In addition, there was
`a significant positive correlation between the fecal levels of
`
`β
`
`β
`
`Butyric acid
`
`Acetic acid
`
`Lactic acid
`
`Saline
`APA B. infantis
`
`30
`
`20
`
`10
`
`0
`
`Organic acid (πM)
`
`Figure 2: Effect of alginate-poly-L-lysine-alginate (APA) microen-
`capsulated B. infantis ATCC 15697 supplementation on fecal organic
`acids concentrations at endpoint (day 38). F344 rats were gavaged
`daily with APA microencapsulated B. infantis ATCC 15697 or saline
`during 38 days. Data represent the means Β± SEM (π = 6) of the
`concentration of organic acids per gram of wet feces at endpoint
`(day 38). Statistical analysis was performed using unpaired Studentβs
`t-test. βIndicates statistical significance between treatment groups
`(π < 0.05).
`
`versus 11.29Β±0.16 EU/mg; π = 0.011; Figure 3(a)). Also, APA
`microencapsulated B. infantis ATCC 15697 supplementation
`decreased serum endotoxins concentrations with a change
`averaging 8.73%, but the effect was nonsignificant (0.33 Β±
`0.015 versus 0.30 Β± 0.015 EU/mL; π = 0.252; Figure 3(b)).
`
`3.4. Correlations between the Levels of Fecal Endotoxins and
`Bacterial Populations. To investigate the putative relationship
`between the levels of fecal endotoxins and bacteria that do
`not produce endotoxins (Figure 4) and potential endotoxins-
`producing bacteria (Figure 5), correlation analyses were per-
`formed. Results showed a significant negative correlation
`between fecal endotoxins concentrations and the abundance
`of Gram-positive Bifidobacteria (π = β0.587, π = 0.045)
`and B. infantis (π = β0.670, π = 0.017). Furthermore, there
`was a positive significant correlation between the levels of
`fecal endotoxins and Gram-negative Enterobacteriaceae (π =
`0.585, π = 0.046).
`
`3.5. Multicorrelation Analysis between the Levels of Fecal
`Organic Acids and Fecal/Serum Endotoxins and Fecal Bac-
`terial Populations. Multicorrelation analysis was performed
`to investigate the putative relationship between the levels of
`fecal organic acids and fecal/serum endotoxins (Figure 6)
`and fecal bacterial populations (Table 2). Results showed that
`there was no significant correlation between the levels of fecal
`endotoxins and fecal butyric (π = 0.474), acetic (π = 0.077),
`and lactic (π = 0.174) acids. In addition, the level of serum
`endotoxins was significantly negatively correlated with fecal
`acetic acid concentration (π = β0.747; π = 0.005), while there
`was no significant correlation with fecal butyric (π = 0.087)
`and lactic (π = 0.334) acids concentrations. Furthermore,
`there was a significant negative correlation between the levels
`
`Genome & Co. v. Univ. of Chicago, PGR2019-00002
`UNIV. CHICAGO EX. 2002 - 5/12
`
`
`
`6
`
`BioMed Research International
`
`Saline
`
`APA B. infantis
`
`(b)
`
`0.4
`
`0.3
`
`0.2
`
`0.1
`
`0.0
`
`Serum endotoxins concentration (EU/mL)
`
`β
`
`Saline
`
`APA B. infantis
`
`(a)
`
`12
`
`11
`
`10
`
`9
`
`8
`
`Fecal endotoxins concentration (EU/mg)
`
`Figure 3: Effect of alginate-poly-L-lysine-alginate (APA) microencapsulated B. infantis ATCC 15697 on (a) fecal and (b) serum endotoxins
`concentrations. F344 rats were gavaged daily with APA microencapsulated B. infantis ATCC 15697 or saline during 38 days. Data represent
`the means Β± SEM (π = 6) of the concentration of endotoxins at endpoint (day 38). Statistical analysis was performed using unpaired Studentβs
`t-test. βindicates statistical significance between treatment groups (π < 0.05).
`
`Table 2: Correlations between the levels of fecal organic acids and bacterial populations.
`
`Lactic acid (πM)
`Butyric acid (πM)
`Acetic acid (πM)
`Bacteria (% of total)
`π = β0.084; π = 0.631
`π = 0.136; π = 0.690
`π = 0.193; π = 0.570
`Gram-positive
`π = 0.019; π = 0.952
`π = 0.176; π = 0.585
`π = 0.458; π = 0.134
`Phylum Actinobacteria
`Genus Bifidobacterium
`π = 0.345; π = 0.273
`π = 0.436; π = 0.156
`π = 0.511; π = 0.089
`r = 0.752; P = 0.005β
`r = 0.696; P = 0.012β
`Species B. infantis
`π = 0.509; π = 0.091
`Other Bifidobacterium sp.
`π = β0.157; π = 0.625
`π = β0.058; π = 0.857
`π = 0.341; π = 0.278
`π = β0.143; π = 0.675
`π = 0.046; π = 0.892
`π = 0.012; π = 0.973
`Phylum Firmicutes
`r = 0.659; P = 0.020β
`Genus Lactobacillus
`π = 0.286; π = 0.368
`π = 0.363; π = 0.246
`π = β0.155; π = 0.631
`π = 0.054; π = 0.867
`π = β0.157; π = 0.627
`Gram-negative
`π = 0.074; π = 0.829
`π = 0.076; π = 0.825
`π = β0.005; π = 0.989
`Phylum Bacteroidetes
`Genus Bacteroides-Prevotella
`π = 0.404; π = 0.218
`π = 0.427; π = 0.190
`π = β0.083; π = 0.809
`r = β0.596; π = 0.041
`Family Enterobacteriaceae
`π = β0.148; π = 0.647
`π = β0.259; π = 0.416
`Species Escherichia coli
`π = β0.501; π = 0.097
`π = β0.474; π = 0.119
`π = β0.269; π = 0.389
`F344 rats were gavaged daily with alginate-poly-L-lysine-alginate (APA) microencapsulated B. infantis ATCC 15697 or saline during 38 days (π = 6).
`Correlations were performed at endpoint (day 38) using Pearsonβs correlation in the saline and APA microencapsulatedB. infantis ATCC 15697 treatment
`groups. βIndicates statistical significance of the correlation (π < 0.05).
`
`β
`
`endotoxins and Gram-negative Enterobacteriaceae, suggest-
`ing that the decrease in Enterobacteriaceae might account for
`the endotoxins reduction, consistent with the findings of oth-
`ers [35, 36]. Furthermore, APA microencapsulated B. infantis
`ATCC 15697 nonsignificantly reduced serum endotoxins
`compared to the saline treatment, with a change averaging
`8.73%. Endotoxins concentrations were determined using
`the chromogenic LAL assay, the most preferred method to
`quantify endotoxins in biological fluids. Although LAL assay
`can lead to erroneous endotoxins values due to variations in
`LAL preparations, cross-reactions, and low detection limits
`[37], our data is consistent with previous publications [32, 38].
`
`The low number of animals included in our study (π = 6) may
`explain the nonsignificant statistical decrease in circulating
`endotoxins. Importantly, this serum endotoxins reduction
`may be of great importance physiologically, as a 10% change
`in serum endotoxins concentrations has been shown to
`induce significant consequences on systemic inflammation
`and human health during metabolic endotoxemia [39, 40].
`It is also important to point out that the present study
`was performed in a healthy animal model, providing the
`proof of concept in a rat model. F344 rats are conventional
`and inexpensive rats that present a low level of circulating
`endotoxins. Future preclinical studies should confirm the
`
`Genome & Co. v. Univ. of Chicago, PGR2019-00002
`UNIV. CHICAGO EX. 2002 - 6/12
`
`
`
`BioMed Research International
`
`7
`
`r = β0.497, P = 0.100
`
`20
`10
`Actinobacteria (% of total)
`(b) Phylum Actinobacteria
`
`r = β0.670, P = 0.017β
`
`2
`1
`B. infantis (% of total)
`(d) Species B. infantis
`
`30
`
`3
`
`r = β0.232, P = 0.493
`
`65
`Firmicutes (% of total)
`(f) Phylum Firmicutes
`
`130
`
`0
`
`0
`
`0
`
`12
`
`11
`
`10
`
`89
`
`Fecal endotoxins (EU/mg)
`
`12
`
`11
`
`10
`
`89
`
`Fecal endotoxins (EU/mg)
`
`12
`
`11
`
`10
`
`89
`
`Fecal endotoxins (EU/mg)
`
`8
`
`4.0
`
`r = β0.333, P = 0.317
`
`0
`
`60
`Gram-positive bacteria (% of total)
`(a) Total Gram-positive bacteria
`
`120
`
`r = β0.587, P = 0.045β
`
`0
`
`4
`Bifidobacteria (% of total)
`(c) Genus Bifidobacterium
`
`r = β0.297, P = 0.348
`
`12
`
`11
`
`10
`
`89
`
`Fecal endotoxins (EU/mg)
`
`12
`
`11
`
`10
`
`89
`
`Fecal endotoxins (EU/mg)
`
`12
`
`11
`
`10
`
`89
`
`Fecal endotoxins (EU/mg)
`
`0.0
`
`2.0
`Other Bifidobacterium spp. (% of total)
`(e) Other species of Bifidobacterium
`12
`
`r = β0.492, P = 0.104
`
`10
`5
`Lactobacilli (% of total)
`(g) Genus Lactobacillus
`
`15
`
`11
`
`10
`
`89
`
`0
`
`Fecal endotoxins (EU/mg)
`
`Figure 4: Correlations between the levels of fecal endotoxins and bacteria that do not produce endotoxins in F344 rats: (a) total Gram-
`positive bacteria, (b) phylum Actinobacteria, (c) genus Bifidobacterium, (d) species B. infantis, (e) other species of Bifidobacterium, (f) phylum
`Firmicutes, and (g) genus Lactobacillus. F344 rats were gavaged daily with APA microencapsulated B. infantis ATCC 15697 or saline during
`38 days (π = 6). Correlations were performed at endpoint (day 38) using Pearsonβs correlation in the saline and APA microencapsulated B.
`infantis ATCC 15697 treatment groups. βIndicates statistical significance of the correlation (π < 0.05).
`
`potential of the probiotic bacterial formulation to lower
`circulating endotoxins in an animal model with metabolic
`endotoxemia, as observed in high-fat, diet-induced, obe-
`sity/type 2 diabetes/steatosis, ob/ob mice, and fatty Zucker
`(diabetic) rats.
`
`It is well documented that probiotic bacteria such as
`B. infantis produce organic acids that can affect the gut
`microbiota composition [41, 42]. This study showed that
`APA microencapsulated B. infantis ATCC 15697 significantly
`increased fecal lactic, butyric, and acetic acids concentrations,
`
`Genome & Co. v. Univ. of Chicago, PGR2019-00002
`UNIV. CHICAGO EX. 2002 - 7/12
`
`
`
`8
`
`BioMed Research International
`
`r = 0.534, P = 0.072
`
`0
`
`20
`10
`Gram-negative bacteria (% of total)
`(a) Total Gram-negative bacteria
`
`30
`
`r = 0.400, P = 0.197
`
`12
`
`11
`
`10
`
`89
`
`Fecal endotoxins (EU/mg)
`
`12
`
`11
`
`10
`
`89
`
`Fecal endotoxins (EU/mg)
`
`0.00
`
`0.15
`
`0.10
`0.05
`E. coli (% of total)
`(c) Species Escherichia coli
`12
`
`r = 0.585, P = 0.046β
`
`3
`Enterobacteriaceae (% of total)
`(b) Family Enterobacteriaceae
`
`r = 0.449, P = 0.166
`
`10
`Bacteroidetes (% of total)
`(d) Phylum Bacteroidetes
`
`6
`
`20
`
`0
`
`0
`
`12
`
`11
`
`10
`
`89
`
`12
`
`11
`
`10
`
`89
`
`Fecal endotoxins (EU/mg)
`
`Fecal endotoxins (EU/mg)
`
`r = 0.235, P = 0.486
`
`0
`
`10
`5
`Bacteroides-Prevotella (% of total)
`(e) Genus Bacteroides-Prevotella
`
`15
`
`11
`
`10
`
`89
`
`Fecal endotoxins (EU/mg)
`
`Figure 5: Correlations between the concentrations of fecal endotoxins and potential endotoxins-producing bacteria in F344 rats: (a) total
`Gram-negative bacteria, (b) family Enterobacteriaceae, (c) species Escherichia coli, (d) phylum Bacteroidetes, and (e) genus Bacteroides-
`Prevotella. F344 rats were gavaged daily with APA microencapsulated B. infantis ATCC 15697 or saline during 38 days (π = 6). Correlations
`were performed at endpoint (day 38) using Pearsonβs correlation in the saline and APA microencapsulated B. infantis ATCC 15697 treatment
`groups. βIndicates statistical significance of the correlation (π < 0.05).
`
`as observed by others [43, 44]. In addition, there was a
`positive correlation between the fecal levels of B. infantis
`and organic acids, while the correlation between acetic acid
`and Enterobacteriaceae and serum endotoxins was negative.
`To date, there is no published data on the effect of acetic
`acid on the viability of Enterobacteriaceae, neither on gut
`endotoxins release and translocation. Nevertheless, previous
`studies have reported a negative relationship between the
`gut levels of Enterobacteriaceae and acetic acid [45, 46].
`Altogether, this study suggests that oral supplementation with
`APA microencapsulated B. infantis ATCC 15697 increases the
`
`production of colonic organic acids, impeding the growth of
`endotoxins-producing bacteri