`
`Description
`
`Strain Designation: NRRL 163 [118, CBS 133.61, IMI 16152, LSHB Ac71, NCTC 982, QM 1981, WB 163]
`Deposited Name: Aspergillus fumigatus Fresenius
`Product Description: An ampoule containing viable cells (may include spores and mycelia) suspended in
`cryoprotectant.
`
`Propagation
`
`The information recommended in this section is to assist users in obtaining living culture(s) for their studies.
`The recommendation does not imply that the conditions or procedures provided below are optimum.
`Experienced researchers may initiate the growth of a culture in their own way.
`
`ATCC® Medium 312: Czapek's agar
`ATCC® Medium 336: Potato dextrose agar (PDA)
`ATCC® Medium 28: Emmons' modification of Sabouraud's agar
`
`
`Growth Conditions
`Temperature: 24°C to 26°C
`Atmosphere: Typical aerobic
`
`Recommended Procedure
`For freezedry (lyophilized) ampoules:
`1. Open an ampoule according to enclosed instructions.
`2. From a single test tube of sterile distilled water (5 to 6 mL), withdraw approximately 0.5 to 1.0 mL
`with a sterile pipette and apply directly to the pellet. Stir to form a suspension.
`3. Aseptically transfer the suspension back into the test tube of sterile distilled water.
`4. Let the test tube sit at room temperature (25°C) undisturbed for at least 2 hours; longer (e.g.,
`overnight) rehydration might increase viability of some fungi..
`5. Mix the suspension well. Use several drops (or make dilutions if desired) to inoculate recommended
`solid or liquid medium. Include a control that receives no inoculum.
`6. Incubate the inoculum at the propagation conditions recommended.
`7. Inspect for growth of the inoculum/strain regularly. The sign of viability is noticeable typically after 12
`days of incubation. However, the time necessary for significant growth will vary from strain to strain.
`
`
`
`Colony and Cell Morphology: On PDA medium at 25°C after 22 days, mycelium are white becoming olive
`green, velutinous to cottony and the reverse is tan. The conidia are verrucose and olive green. The vesicles
`are subglobose to clavate and 16.5 to 18 µm. The hyphae are hyaline.
`
`Notes
`
`No special notes.
`Additional, updated information on this product may be available on the ATCC® web site at www.atcc.org.
`
`DNA Sequence
`
`18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene,
`and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
`GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACC
`CGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCC
`CCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTA
`TCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAAT
`GCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTG
`GTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCC
`GTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATG
`GGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGA
`CCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA
`
`D1D2 region of the 28S ribosomal RNA gene
`ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAG
`AGCTCAAATTTGAAAGCTGGCCCCTTCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTCGGGTGCAGC
`CCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGACGGGGTGTCTGC
`GTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCA
`
`Product Sheet
`Aspergillus fumigatus
`(ATCC® 1022™)
`
`Please read this FIRST
`
`Storage Temp.
`Frozen: 80°C or
`colder
`FreezeDried: 2°C
`to 8°C
`Live Culture: See
`Propagation
`Section
`
`Biosafety Level
`2
`
`
`
`
`
`Intended Use
`
`This product is intended for research use only. It is not
`intended for any animal or human therapeutic or
`diagnostic use.
`
`Citation of Strain
`
`If use of this culture results in a scientific publication, it
`should be cited in that manuscript in the following
`manner: Aspergillus fumigatus (ATCC® 1022™)
`
`American Type Culture Collection
`PO Box 1549
`Manassas, VA 20108 USA
`www.atcc.org
`
`800.638.6597 or 703.365.2700
`Fax: 703.365.2750
`Email: Tech@atcc.org
`
`Or contact your local distributor
`
`PARAGON - EXHIBIT 2026
`
`
`
`Page 2 of 2
`
`TCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCAC
`TTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTCGCCCG
`CGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCG
`GTCAAAGGCCCTCGGAATGTATCACCTCTCGGGGTGTCTTATAGCCGAGGGTGCAATGCGGCCTGCCT
`GGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCGTAATGGTCGTAAATGAC
`
`Isolation
`
`Lung of chicken, Connecticut
`
`References
`
`References and other information relating to this product are available online at www.atcc.org.
`
`Biosafety Level: 2
`
`Appropriate safety procedures should always be used with this material. Laboratory safety is discussed in
`the current publication of the Biosafety in Microbiological and Biomedical Laboratories from the U.S.
`Department of Health and Human Services Centers for Disease Control and Prevention and National Institutes
`for Health.
`
`ATCC Warranty
`
`The viability of ATCC® products is warranted for 30 days from the date of shipment, and is valid only if the
`product is stored and cultured according to the information included on this product information sheet. ATCC
`lists the media formulation that has been found to be effective for this strain. While other, unspecified media
`may also produce satisfactory results, a change in media or the absence of an additive from the ATCC
`recommended media may affect recovery, growth and/or function of this strain. If an alternative medium
`formulation is used, the ATCC warranty for viability is no longer valid.
`
`Disclaimers
`
`This product is intended for laboratory research purposes only. It is not intended for use in humans.
`While ATCC uses reasonable efforts to include accurate and uptodate information on this product
`sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature
`and patents are provided for informational purposes only. ATCC does not warrant that such information has
`been confirmed to be accurate.
`This product is sent with the condition that you are responsible for its safe storage, handling, and use.
`ATCC is not liable for any damages or injuries arising from receipt and/or use of this product. While
`reasonable effort is made to ensure authenticity and reliability of strains on deposit, ATCC is not liable for
`damages arising from the misidentification or misrepresentation of cultures.
`Please see the enclosed Material Transfer Agreement (MTA) for further details regarding the use of this
`product. The MTA is also available on our Web site at www.atcc.org
`
`Additional information on this culture is available on the ATCC web site at www.atcc.org.
`© ATCC 2016. All rights reserved. ATCC is a registered trademark of the American Type Culture Collection. [01/20]
`
`Product Sheet
`Aspergillus fumigatus
`(ATCC® 1022™)
`
`Please read this FIRST
`
`Storage Temp.
`Frozen: 80°C or
`colder
`FreezeDried: 2°C
`to 8°C
`Live Culture: See
`Propagation
`Section
`
`Biosafety Level
`2
`
`
`
`
`
`Intended Use
`
`This product is intended for research use only. It is not
`intended for any animal or human therapeutic or
`diagnostic use.
`
`Citation of Strain
`
`If use of this culture results in a scientific publication, it
`should be cited in that manuscript in the following
`manner: Aspergillus fumigatus (ATCC® 1022™)
`
`American Type Culture Collection
`PO Box 1549
`Manassas, VA 20108 USA
`www.atcc.org
`
`800.638.6597 or 703.365.2700
`Fax: 703.365.2750
`Email: Tech@atcc.org
`
`Or contact your local distributor