throbber
Page 1 of 2
`
`Description
`
`Strain Designation: NRRL 163 [118, CBS 133.61, IMI 16152, LSHB Ac71, NCTC 982, QM 1981, WB 163]
`Deposited Name: Aspergillus fumigatus Fresenius
`Product Description: An ampoule containing viable cells (may include spores and mycelia) suspended in
`cryoprotectant.
`
`Propagation
`
`The information recommended in this section is to assist users in obtaining living culture(s) for their studies.
`The recommendation does not imply that the conditions or procedures provided below are optimum.
`Experienced researchers may initiate the growth of a culture in their own way.

`ATCC® Medium 312: Czapek's agar
`ATCC® Medium 336: Potato dextrose agar (PDA)
`ATCC® Medium 28: Emmons' modification of Sabouraud's agar

`
`Growth Conditions
`Temperature: 24°C to 26°C
`Atmosphere: Typical aerobic

`Recommended Procedure
`For freeze­dry (lyophilized) ampoules:
`1.  Open an ampoule according to enclosed instructions.
`2.  From a single test tube of sterile distilled water (5 to 6 mL), withdraw approximately 0.5 to 1.0 mL
`with a sterile pipette and apply directly to the pellet.  Stir to form a suspension.
`3.  Aseptically transfer the suspension back into the test tube of sterile distilled water.
`4.  Let the test tube sit at room temperature (25°C) undisturbed for at least 2 hours; longer (e.g.,
`overnight) rehydration might increase viability of some fungi..
`5.  Mix the suspension well.  Use several drops (or make dilutions if desired) to inoculate recommended
`solid or liquid medium. Include a control that receives no inoculum.
`6.  Incubate the inoculum at the propagation conditions recommended.
`7.  Inspect for growth of the inoculum/strain regularly. The sign of viability is noticeable typically after 1­2
`days of incubation. However, the time necessary for significant growth will vary from strain to strain.

`

`Colony and Cell Morphology: On PDA medium at 25°C after 22 days, mycelium are white becoming olive
`green, velutinous to cottony and the reverse is tan. The conidia are verrucose and olive green. The vesicles
`are sub­globose to clavate and 16.5 to 18 µm. The hyphae are hyaline.
`
`Notes
`
`No special notes.
`Additional, updated information on this product may be available on the ATCC® web site at www.atcc.org.
`
`DNA Sequence
`
`18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene,
`and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
`GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACC
`CGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCC
`CCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTA
`TCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAAT
`GCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTG
`GTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCC
`GTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATG
`GGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGA
`CCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA
`
`D1D2 region of the 28S ribosomal RNA gene
`ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAG
`AGCTCAAATTTGAAAGCTGGCCCCTTCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTCGGGTGCAGC
`CCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGACGGGGTGTCTGC
`GTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCA
`
`Product Sheet
`Aspergillus fumigatus  
`(ATCC® 1022™)
`
`Please read this FIRST
`
`Storage Temp.
`Frozen: ­80°C or
`colder
`Freeze­Dried: 2°C
`to 8°C
`Live Culture: See
`Propagation
`Section
`
`Biosafety Level
`2
`

`

`
`Intended Use
`
`This product is intended for research use only. It is not
`intended for any animal or human therapeutic or
`diagnostic use.
`
`Citation of Strain
`
`If use of this culture results in a scientific publication, it
`should be cited in that manuscript in the following
`manner: Aspergillus fumigatus   (ATCC® 1022™)
`
`American Type Culture Collection
`PO Box 1549
`Manassas, VA 20108 USA
`www.atcc.org
`
`800.638.6597 or 703.365.2700
`Fax: 703.365.2750
`Email: Tech@atcc.org

`Or contact your local distributor
`
`PARAGON - EXHIBIT 2026
`
`

`
`Page 2 of 2
`
`TCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCAC
`TTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTCGCCCG
`CGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCG
`GTCAAAGGCCCTCGGAATGTATCACCTCTCGGGGTGTCTTATAGCCGAGGGTGCAATGCGGCCTGCCT
`GGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCGTAATGGTCGTAAATGAC
`
`Isolation
`
`Lung of chicken, Connecticut
`
`References
`
`References and other information relating to this product are available online at www.atcc.org.
`
`Biosafety Level: 2
`
`Appropriate safety procedures should always be used with this material. Laboratory safety is discussed in
`the current publication of the Biosafety in Microbiological and Biomedical Laboratories from the U.S.
`Department of Health and Human Services Centers for Disease Control and Prevention and National Institutes
`for Health.
`
`ATCC Warranty
`
`The viability of ATCC® products is warranted for 30 days from the date of shipment, and is valid only if the
`product is stored and cultured according to the information included on this product information sheet. ATCC
`lists the media formulation that has been found to be effective for this strain. While other, unspecified media
`may also produce satisfactory results, a change in media or the absence of an additive from the ATCC
`recommended media may affect recovery, growth and/or function of this strain. If an alternative medium
`formulation is used, the ATCC warranty for viability is no longer valid.
`
`Disclaimers
`
`This product is intended for laboratory research purposes only. It is not intended for use in humans.
`While ATCC uses reasonable efforts to include accurate and up­to­date information on this product
`sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature
`and patents are provided for informational purposes only. ATCC does not warrant that such information has
`been confirmed to be accurate.
`This product is sent with the condition that you are responsible for its safe storage, handling, and use.
`ATCC is not liable for any damages or injuries arising from receipt and/or use of this product. While
`reasonable effort is made to ensure authenticity and reliability of strains on deposit, ATCC is not liable for
`damages arising from the misidentification or misrepresentation of cultures.
`Please see the enclosed Material Transfer Agreement (MTA) for further details regarding the use of this
`product. The MTA is also available on our Web site at www.atcc.org
`
`Additional information on this culture is available on the ATCC web site at www.atcc.org.
`© ATCC 2016. All rights reserved. ATCC is a registered trademark of the American Type Culture Collection. [01/20]
`
`Product Sheet
`Aspergillus fumigatus  
`(ATCC® 1022™)
`
`Please read this FIRST
`
`Storage Temp.
`Frozen: ­80°C or
`colder
`Freeze­Dried: 2°C
`to 8°C
`Live Culture: See
`Propagation
`Section
`
`Biosafety Level
`2
`

`

`
`Intended Use
`
`This product is intended for research use only. It is not
`intended for any animal or human therapeutic or
`diagnostic use.
`
`Citation of Strain
`
`If use of this culture results in a scientific publication, it
`should be cited in that manuscript in the following
`manner: Aspergillus fumigatus   (ATCC® 1022™)
`
`American Type Culture Collection
`PO Box 1549
`Manassas, VA 20108 USA
`www.atcc.org
`
`800.638.6597 or 703.365.2700
`Fax: 703.365.2750
`Email: Tech@atcc.org

`Or contact your local distributor

This document is available on Docket Alarm but you must sign up to view it.


Or .

Accessing this document will incur an additional charge of $.

After purchase, you can access this document again without charge.

Accept $ Charge
throbber

Still Working On It

This document is taking longer than usual to download. This can happen if we need to contact the court directly to obtain the document and their servers are running slowly.

Give it another minute or two to complete, and then try the refresh button.

throbber

A few More Minutes ... Still Working

It can take up to 5 minutes for us to download a document if the court servers are running slowly.

Thank you for your continued patience.

This document could not be displayed.

We could not find this document within its docket. Please go back to the docket page and check the link. If that does not work, go back to the docket and refresh it to pull the newest information.

Your account does not support viewing this document.

You need a Paid Account to view this document. Click here to change your account type.

Your account does not support viewing this document.

Set your membership status to view this document.

With a Docket Alarm membership, you'll get a whole lot more, including:

  • Up-to-date information for this case.
  • Email alerts whenever there is an update.
  • Full text search for other cases.
  • Get email alerts whenever a new case matches your search.

Become a Member

One Moment Please

The filing “” is large (MB) and is being downloaded.

Please refresh this page in a few minutes to see if the filing has been downloaded. The filing will also be emailed to you when the download completes.

Your document is on its way!

If you do not receive the document in five minutes, contact support at support@docketalarm.com.

Sealed Document

We are unable to display this document, it may be under a court ordered seal.

If you have proper credentials to access the file, you may proceed directly to the court's system using your government issued username and password.


Access Government Site

We are redirecting you
to a mobile optimized page.





Document Unreadable or Corrupt

Refresh this Document
Go to the Docket

We are unable to display this document.

Refresh this Document
Go to the Docket