1/9/24, 11:12 AM
`
`Improved Fecal DNA Test for Colorectal Cancer Screening - Clinical Gastroenterology and Hepatology
`
`Access provided by Foley Hoag LLP
`
` Search for...
`
`ORIGINAL ARTICLE
`
`Log in
`
`
`
`Improved Fecal DNA Test for Colorectal Cancer Screening
`Steven H. Itzkowitz   • Lina Jandorf • Randall Brand • ... Kris Durkee • Sanford Markowitz •
`Anthony Shuber •
`Published: December 12, 2006 • DOI: https://doi.org/10.1016/j.cgh.2006.10.006
`
`PlumX Metrics
`
`Background & Aims: Fecal DNA testing has shown greater sensitivity than guaiac-based occult
`blood tests for noninvasive colorectal cancer (CRC) screening. The prototype assay (version 1),
`which analyzed 22 gene mutations and DNA integrity assay (DIA), showed a sensitivity of 52% for
`
`
`
`
`https://www.cghjournal.org/article/S1542-3565(06)01044-5/fulltext
`
`1/26
`
`|
`
` VOLUME 5, ISSUE 1
`
`,
`
`P111-117,
`
`JANUARY 2007
`
`Download Full Issue
`
`Show all authors
`
`Geneoscopy Exhibit 1074, Page 1
`
`

`

`1/9/24, 11:12 AM
`Improved Fecal DNA Test for Colorectal Cancer Screening - Clinical Gastroenterology and Hepatology
`CRC detection and a specificity of 94% in average-risk individuals. The present study was
`conducted to determine the sensitivity and specificity of a second-generation assay (version 2) that
`uses improved DNA stabilization/isolation techniques and a new promoter methylation marker.
`Methods: Forty patients with CRC and 122 subjects with normal colonoscopy provided stool
`samples to which DNA preservation buffer was added immediately. DNA was purified using gel-
`based capture, and analyzed for the original panel of 22 mutations, DIA, and 2 new promoter
`methylation markers. Results: By using DNA that was optimally preserved and purified from stool,
`the sensitivity of the prototype version 1 assay increased to 72.5% because of enhanced
`performance of DIA. Vimentin gene methylation alone provided sensitivity and specificity of 72.5%
`and 86.9%, respectively. The optimal combination of vimentin methylation plus DIA resulted in
`87.5% sensitivity and 82% specificity; cancers were detected regardless of stage or location. False-
`positive vimentin methylation was associated with older age. Conclusions: An improved fecal DNA
`test that incorporates only 2 markers shows much higher sensitivity for CRC. The new assay is
`easier to perform and should be less costly, thereby facilitating its use for noninvasive CRC
`screening.
`
`Abbreviations used in this paper:
`
`CI (confidence interval), CRC (colorectal cancer), DIA (DNA integrity assay), DY (locus D (5p21)
`and locus Y (LOC91199)), HLTF (Helicase-like Transcription Factor), MSP (methylation-specific
`polymerase chain reaction), NC (normal colonoscopy), PCR (polymerase chain reaction)
`
`Screening for colorectal cancer (CRC) is arguably the most effective intervention for preventing any
`cancer. Unfortunately, despite the recommendations of all major medical societies, fewer than half
`of eligible individuals older than age 50 have undergone CRC screening.
`
` In the United States,
`1, 2, 3
`colonoscopy is being used increasingly as a primary screening tool because of its excellent
`diagnostic accuracy and ability to remove precancerous and early cancerous lesions. However, the
`availability of an accurate, noninvasive screening test might increase compliance with CRC
`screening guidelines by individuals who are reluctant to undergo more invasive tests, or situations in
`which colonoscopy screening is not feasible or readily available.
`
`Several studies have shown the feasibility of detecting colon tumor–specific products in the stool.
`The markers in these studies represent alterations of genes involved in the predominant
`chromosomal instability pathway (such as APC, p53, and K-ras), the microsatellite instability
`
`
`pathway (Bat-26), and markers of abnormal apoptosis. Studies using stool samples from patients
`
`4
`
`https://www.cghjournal.org/article/S1542-3565(06)01044-5/fulltext
`
`2/26
`
`Geneoscopy Exhibit 1074, Page 2
`
`

`

`1/9/24, 11:12 AM
`Improved Fecal DNA Test for Colorectal Cancer Screening - Clinical Gastroenterology and Hepatology
`already known to have colon cancer, adenomas, or a normal colon report sensitivities of 62%–91%
`for CRC, 27%–82% for advanced adenomas, and specificities of 93%–96% in individuals with a
`normal colonoscopy.
` These encouraging data prompted a large, prospective, multicenter study
`4, 5
`in more than 4000 average-risk, asymptomatic individuals older than age 50. The results showed a
`higher sensitivity for detecting cancer with the fecal DNA test compared with Hemoccult II (Beckman
`Coulter, Fullerton, CA) (51.6% vs 12.9%, P = .003), with comparable specificity (94.4% vs 95.2%,
`respectively). Despite superior sensitivity over Hemoccult II, the prototype fecal DNA test (version
`6
`1) revealed lower than expected sensitivity, which was owing to an unexpectedly low rate of
`positivity for the DNA integrity assay (DIA) component. In retrospect, it was learned that the
`suboptimal performance of DIA was a result of DNA degradation during transit of specimens to the
`laboratory, despite precautions such as immediate chilling of samples and rapid delivery by express
`courier.
`
`Since that time, pilot studies have shown that several technical and conceptual advances could
`improve fecal DNA testing. First, adding a DNA-stabilizing buffer to the stool immediately on
`defecation was shown to prevent DNA degradation for several days and enhance the performance
`of DIA. Second, a gel-based DNA capture approach, rather than the original bead-based
`7
`technology, allowed for enhanced extraction of DNA from stool. Finally, promoter methylation has
`8
`become recognized as a key pathway by which colon cancers develop. This epigenetic alteration is
`9
`not detected by approaches that analyze for gene mutations. Vimentin, a gene that typically is
`considered a product of mesenchymal cells, is not methylated in normal colonic epithelial cells, but
`becomes highly methylated in colon cancer cell lines and in 53%–83% of colon cancer tissues.
`10
`Vimentin methylation also has been detected in the stool from 43 of 94 (46%; 95% confidence
`interval [CI], 36%–56%) patients with CRC vs 20 of 198 (specificity, 90%; 95% confidence interval
`[CI], 85%–94%) with a normal colonoscopy,
` suggesting that methylation markers might contribute
`10
`to a fecal DNA assay panel.
`
`These improvements of better DNA stabilization, enhanced DNA extraction, and use of gene-
`specific methylation have been incorporated into a second-generation fecal DNA test (version 2).
`The purpose of the present study was to determine the sensitivity and specificity of the newer
`version 2 assay for detection of CRC.
`
`Methods
`
`Study Design
`
`https://www.cghjournal.org/article/S1542-3565(06)01044-5/fulltext
`
`
`
`
`
`3/26
`
`Geneoscopy Exhibit 1074, Page 3
`
`

`

`1/9/24, 11:12 AM
`Improved Fecal DNA Test for Colorectal Cancer Screening - Clinical Gastroenterology and Hepatology
`This study was designed in 2 phases. Phase 1 involved analyzing stool samples from approximately
`50 patients with CRC and 200 patients with normal colonoscopy (NC) to define suitable DIA cut-off
`values and to determine optimal markers for the new assay. Phase 2, which is ongoing, was
`designed as a validation set in which an additional 125 patients with CRC and 200 patients with NC
`will be analyzed using the optimal marker panel from phase 1. Without knowing the performance of
`the new assay, we decided to analyze specimens from phase 1 after 45 CRC and 150 NC patients
`were enrolled, which had a negligible effect on the initial estimations for setting cut-off points for the
`DIA assay. The findings presented herein represent the results of phase 1.
`
`Source of Clinical Material
`
`Seven centers participated in this study, representing a spectrum of academic medical settings
`(community based to tertiary care). Each center obtained local institutional review board approval
`before beginning the study. The number of patients contributed by each site varied depending on
`when institutional review board approval was obtained, with a mean number of 24 stool samples per
`site (range, 8–42). Between January and September 2005, subjects who were 50–80 years of age
`were eligible for the study if they were found at the time of colonoscopy to have either CRC or NC.
`The latter group consisted of individuals in whom the bowel preparation was classified as very good
`to excellent, the colonoscopy was complete to the cecum, and the mucosa was free of any type of
`mucosal lesion or polyps. Although they were younger than age 50, 4 subjects (3 CRC, 1 NC)
`between the ages of 44 and 50 were included because they fulfilled all other eligibility criteria.
`Individuals were excluded if any of the following conditions applied: any contraindication to
`colonoscopy or conscious sedation; personal history of, or coexistent, cancer except basal and
`squamous cell carcinomas of the skin; active therapy with chemotherapy or radiation therapy for a
`concurrent cancer; high-risk conditions such as familial adenomatous polyposis, hereditary
`nonpolyposis colorectal cancer, inflammatory bowel disease, and strong family history of CRC (2 or
`more first-degree relatives with CRC, or 1 or more first-degree relatives with CRC younger than age
`50), personal history of colorectal polyps, prior colorectal resection for any reason, current
`pregnancy, or lactation. The presence of gastrointestinal symptoms was not an exclusion criterion,
`although patients with NC were almost all asymptomatic and presented for routine screening. The
`preparation for, and performance of, colonoscopy was performed according to standard operating
`procedures at each site. The histologic diagnosis of CRC was verified by a board-certified
`pathologist. Cancers were staged according to the TNM classification. Left-sided cancers were
`defined as those arising at, or distal to, the splenic flexure.
`
`Sample Collection
`
`https://www.cghjournal.org/article/S1542-3565(06)01044-5/fulltext
`
`
`
`
`
`4/26
`
`Geneoscopy Exhibit 1074, Page 4
`
`

`

`1/9/24, 11:12 AM
`Improved Fecal DNA Test for Colorectal Cancer Screening - Clinical Gastroenterology and Hepatology
`To avoid any possible effect of the colonoscopic bowel preparation on test results, each subject
`provided a single stool sample approximately 6–14 days after colonoscopy. In the case of patients
`with CRC, the sample was provided before beginning the presurgical bowel preparation. Subjects
`were given detailed instructions and a special stool collection kit that is mounted on the toilet bowl.
`Immediately after defecation, subjects added 250 mL of a DNA-stabilizing buffer to a stool
`7
`specimen of at least 50 g. Only 10 patients provided less than 50 g of stool, and, of these, 3
`subsequently provided an adequate second specimen. The specimen was shipped at room
`temperature overnight using a coded identifier provided by an external clinical research organization
`(Carestat Inc., Newton, MA) to keep the laboratory blinded to the clinical source. The clinical
`research organization was responsible for maintaining all of the clinical data files. The collection
`interval was defined as the number of hours from the time of defecation until the specimen arrived in
`the laboratory. Stool samples were processed and analyzed without knowledge of clinical
`information. The details of sample processing and human DNA purification have been described
`previously.
`7
`
`Version 1 Assay
`
`Samples were processed for 22 specific mutations according to Whitney et al using a gel-based
`8
`DNA capture approach (Effipure; Exact Sciences Corporation, Marlborough, MA) with the following
`modifications: (1) DNA amplifications were increased to 60 cycles; (2) single base extension
`reactions included internal controls, that is, 0.5-umol/L internal control primers and 25 ng (mutant
`reactions) or 5 ng (wild-type reactions); (3) acyclopol enzyme was increased to 0.027 U/reaction;
`and (4) extension reactions were treated with 0.1 uL of shrimp alkaline phosphatase (SAP;
`Promega, Madison, WI) at 37°C for 30 minutes before analysis by capillary electrophoresis (Applied
`Biosystems 3100 instrument; Applied Biosystems, Foster City, CA).
`
`DNA Integrity Assay
`
`The DIA was performed using real-time polymerase chain reaction (PCR) as described previously.
`8
`The assay was converted to a multiplex format in which 4 primer/probe pairs simultaneously
`interrogated the presence and quantity of 200-, 1300-, 1800-, and 2400-bp human DNA fragments
`at 4 loci: 5p21 (locus D), 17p13 (locus E), HRMT1L1 (locus X), and LOC91199 (locus Y).
`
`Methylation Assay
`
`Stool samples were processed for vimentin and Helicase-like Transcription Factor (HLTF) analysis
`according to Whiney et al by using the following capture sequences: vimentin (Vimcp50a: 5′-
`8
`GGCCAGCGAGAAGTCCACCGAGTCCTGCAGGAGCCGC -3′; Vimcp29b: 5′-
`
`
`
`
`
`https://www.cghjournal.org/article/S1542-3565(06)01044-5/fulltext
`
`5/26
`
`Geneoscopy Exhibit 1074, Page 5
`
`

`

`1/9/24, 11:12 AM
`Improved Fecal DNA Test for Colorectal Cancer Screening - Clinical Gastroenterology and Hepatology
`GAGCGAGAGTGGCAGAGGACTGGACCCCGCCGAGG -3′), and HLTF (methylation-specific
`polymerase chain reaction [MSP]5cp: 5′-CAAATGAACCTGACCTTCCCGGCGTTCCTCTGCGTTC-
`3′). Bisulfite conversion of DNA was performed as previously described.
`
` MSP PCR reactions
`11, 12
`were performed using 0.5-umol/L armed primers for either HLTF MSP-5 or vimentin MSP-29 (IDT,
`Coralville, IA). HLTF MSP-5 primer sequences have been reported previously.
` Modified HLTF
`13
`MSP-5 methylation-specific forward primers 5′-GACGTCTAACTAAACTCGCGA-3′ and reverse
`primers 5′-TTTTAGGTCGTTAGATCGAGC-3′ were extended by a 5′ tag sequence 5′-
`GCGGTCCCAATAGGGTCAGT-3′, which is not derived from the HLTF sequence, but which allows
`for more robust sequence-specific template amplification. Vimentin MSP-29 primer sequences have
`been reported previously.
` Primers were combined with 1× HotStar buffer, 1.25 U HotStar
`10
`polymerase (Qiagen, Alameda, CA), 200 μmol/L deoxynucleoside triphosphate (Promega), and 10
`μL (capture stool) DNA in a final volume of 50 μL. Cycling conditions were 95°C for 14.5 minutes
`followed by 40 cycles of 94°C for 30 seconds, 57°C (HLTF), 68°C (vimentin methylated) or 62°C
`(vimentin unmethylated) for 1 minute, 72°C for 1 minute, with final 72°C for 5 minutes. Samples
`were visualized on 4% NuSieve 3:1 agarose (FMC, Rockland, ME) gels using a Stratagene
`EagleEye II (Stratagene, La Jolla, CA) still-image system. Samples were scored as positive if the
`PCR band intensity exceeded a previously determined level. Positive samples were repeated in
`duplicate to confirm methylation status.
`
`Patient Satisfaction Questionnaire
`
`Individuals submitting a stool sample were asked to complete a brief, 6-item satisfaction
`questionnaire designed by the authors to assess satisfaction with the new stool collection kit. The
`questionnaire was made available to all co-investigators, who then distributed it to participants
`without tracking. Completed questionnaires were mailed back anonymously without identifiers, so it
`was not possible to determine the response rate.
`
`Data Analysis
`
`Descriptive statistics were used to characterize the data. The sensitivities and specificities with 95%
`confidence intervals were computed for all markers. t tests and χ tests comparing the CRC with the
`2
`NC group were used to examine associations between patient characteristics (eg, sex, age, time
`since colonoscopy) or markers. P values less than .05 were considered significant. SPSS (version
`14; SPSS, Chicago, IL) was used for all analyses.
`
`Results
`
`https://www.cghjournal.org/article/S1542-3565(06)01044-5/fulltext
`
`
`
`
`
`6/26
`
`Geneoscopy Exhibit 1074, Page 6
`
`

`

`1/9/24, 11:12 AM
`Improved Fecal DNA Test for Colorectal Cancer Screening - Clinical Gastroenterology and Hepatology
`Rationale for Postcolonoscopy Stool Samples
`
`In the previous multicenter study using version 1, precolonoscopy stool samples were collected from
`an asymptomatic average-risk population undergoing screening colonoscopy. That study required
`6
`4404 patients to identify 31 cancers. During that study period, several of the same clinical centers
`also participated in a parallel study to collect postcolonoscopy stool samples from patients with
`CRC. Both sets of samples were processed in a blinded fashion alongside 1423 CRC-negative
`samples using the version 1 assay. At that time, stools were collected without DNA stabilization
`buffer and DNA was extracted by a bead-capture technique. As shown in Table 1, CRC detection for
`the precolonoscopy and postcolonoscopy stool groups was 51.6% (95% CI, 34.8%–68.0%) and
`42.6% (95% CI, 29.5%–56.7%), respectively (not statistically significant). There was also no
`significant difference in detection frequency according to tumor stage, although the number of
`patients was small. If anything, postcolonoscopy stool samples showed a lower sensitivity,
`suggesting that such samples may underestimate the assay’s sensitivity. Thus, tumor manipulation
`or other potential factors at the time of colonoscopy do not appear to bias in favor of molecular CRC
`detection, suggesting that analysis of postcolonoscopy stool samples is adequate for estimating the
`performance of a fecal DNA test.
`
`Table 1 Comparison of CRC Detection for Stool Samples Obtained
`Precolonoscopy and Postcolonoscopy (Version 1 Assay)
`
`https://www.cghjournal.org/article/S1542-3565(06)01044-5/fulltext
`
`
`
`
`
`7/26
`
`Geneoscopy Exhibit 1074, Page 7
`
`

`

`1/9/24, 11:12 AM
`
`Improved Fecal DNA Test for Colorectal Cancer Screening - Clinical Gastroenterology and Hepatology
`
`Precolonoscopy6
`
`Postcolonoscopy
`
`No. positive/total
`
`% (95% CI)
`
`No. positive/total
`
`% (95% CI)
`
`Total
`
`16/31
`
`51.6 (34.8–68.0)
`
`20/47
`
`42.6 (29.5–56.7)
`
`Stage I
`
`8/15
`
`53.3 (30.1–75.2)
`
`7/16
`
`43.8 (23.1–66.8)
`
`62.5 (30.6–86.3)
`
`2/10
`
`20.0 (5.7–51.0)
`
`37.5 (13.7–69.4)
`
`7/11
`
`63.6 (35.4–84.8)
`
`—
`
`—
`
`3/7
`
`1/3
`
`42.9 (15.8–75.0)
`
`33.3 (6.2–79.2)
`
`Stage II
`
`Stage III
`
`Stage IV
`
`Unknown
`
`5/8
`
`3/8
`
`0
`
`—
`
`Open table in a new tab
`
`Patient Population
`
`Initially, 45 patients in the CRC group and 150 subjects in the NC group were enrolled. Of the
`patients in the CRC group, 5 were excluded because of age younger than 40 years (n = 2),
`carcinoma in situ (n = 1), history of colitis (n = 1), and the finding of an adenoma instead of cancer
`(n = 1). Of the subjects in the NC group, 28 were excluded because of inadequate colonoscopy
`preparation (n = 13), insufficient stool sample (n = 7), strong family history of CRC (n = 2), personal
`history of polyps (n = 3), polyp found on colonoscopy (n = 2), and patient withdrawal (n = 1).
`
`Table 2 lists the demographic characteristics of the 40 CRC and 122 NC subjects studied. There
`were no significant differences between the 2 groups in terms of sex, collection interval, or number
`of days after colonoscopy that the stool sample was collected. The NC group was younger than the
`CRC group (P = .03). Among those with CRC, there was no difference in mean age according to
`cancer stage. Almost half of all cancers were early stage (I and II), and approximately three quarters
`of the CRCs were left-sided.
`
`https://www.cghjournal.org/article/S1542-3565(06)01044-5/fulltext
`
`
`
`
`
`8/26
`
`Geneoscopy Exhibit 1074, Page 8
`
`

`

`1/9/24, 11:12 AM
`
`Improved Fecal DNA Test for Colorectal Cancer Screening - Clinical Gastroenterology and Hepatology
`
`Table 2 Demographic Characteristics of the Study Population
`
`Colon cancer (N = 40)
`
`NC (N = 122)
`
`Male, N (%)
`
`24 (60)
`
`Mean collection interval, h (±SD)
`
`38.9 (21.6)
`
`Days since colonoscopy (mean ± SD)
`
`12.4 (6.2)
`
`65.6 (10.3)
`
`71.0 (7.4)
`
`67.1 (10.6)
`
`64.9 (10.0)
`
`56.8 (11.3)
`
`8 (20)
`
`Age, y (mean ± SD)
`
` Stage I
`
` Stage II
`
` Stage III
`
` Stage IV
`
`Stage of cancer, N (%)
`
` I
`
`a P = .03.
`
`Open table in a new tab
`
`62 (51)
`
`27.4 (5.2)
`
`10.2 (5.5)
`
`58.5 (7.2)a
`
`N/A
`
`N/A
`
`N/A
`
`N/A
`
`N/A
`
`Version 1 Marker Performance Using Optimized Sample Collection and
`Purification Techniques
`
`The same version 1 markers used in the previous multicenter study were analyzed after the stool
`6
`was collected using improved sample collection with DNA stabilization buffer and a gel-based DNA
`7
`
`
`purification method. As shown in Table 3, the sensitivity of all version 1 markers was increased
`8
`
`https://www.cghjournal.org/article/S1542-3565(06)01044-5/fulltext
`
`9/26
`
`Geneoscopy Exhibit 1074, Page 9
`
`

`

`1/9/24, 11:12 AM
`Improved Fecal DNA Test for Colorectal Cancer Screening - Clinical Gastroenterology and Hepatology
`using the newer collection and purification methods from 51.6% (95% CI, 34.8%–68.0%) to 72.5%
`(95% CI, 57.2%–83.9%; not statistically significant). The sensitivity of DIA when using buffer with
`gel-based purification was increased markedly from 3.2% (95% CI, 0.6%–16.2%) to 65% (95% CI,
`49.5%–77.9%) (P < .0001). Specificity was not affected significantly by the newer collection and
`purification methods.
`
`Table 3 Sensitivity and Specificity of Version 1 Assay
`
`Imperiale et al6
`
`Present studya
`
`No.
`positive/total
`
`% (95% CI)
`
`No.
`positive/total
`
`% (95% CI)
`
`Sensitivity
`
` All version 1
`markers
`
`16/31
`
` MuMu22
`
`16/31
`
`51.6 (34.8–
`68.0)
`
`51.6 (34.8–
`68.0)
`
`29/40
`
`17/40
`
` DIA
`
`1/31
`
`3.2 (0.6–16.2)
`
`26/40
`
`Specificity
`
` All version 1
`markers
`
`79/1423
`
` MuMu22
`
`65/1423
`
`94.4 (93.1–
`95.5)
`
`95.4 (94.2–
`96.4)
`
`13/122
`
`5/122
`
`a Using stabilization buffer + gel capture (postcolonoscopy stool samples).
`b P < .0001.
`
`72.5 (57.2–
`83.9)
`
`42.5 (28.5–
`57.8)
`
`65.0 (49.5–
`77.9)b
`
`89.3 (82.6–
`93.7)
`
`95.9 (90.8–
`98.2)
`
`https://www.cghjournal.org/article/S1542-3565(06)01044-5/fulltext
`
`
`
`
`
`10/26
`
`Geneoscopy Exhibit 1074, Page 10
`
`

`

`1/9/24, 11:12 AM
`Open table in a new tab
`
`Improved Fecal DNA Test for Colorectal Cancer Screening - Clinical Gastroenterology and Hepatology
`
`Performance of the DNA Integrity Assay
`
`The DIA was analyzed according to a previously determined requirement that 4 of 12 PCR
`fragments, excluding the 200-bp fragments, must be greater than the individual fragment thresholds
`for a sample to be positive. Additional analyses involved all combinations of fragments, including the
`200-bp fragment, to determine the optimal combination for maximum sensitivity and specificity. All
`combinations of DIA markers were similar with regard to sensitivity (60%–65%), with specificities
`ranging from 87.7% to 95.1% (Table 4). The DY combination had the highest overall sensitivity
`(65%; 95% CI, 49.5%–77.9%) and specificity (92.6%; 95% CI, 86.6%–96.1%).
`
`Table 4 Sensitivity and Specificity of DIA Combinations
`
`https://www.cghjournal.org/article/S1542-3565(06)01044-5/fulltext
`
`
`
`
`
`11/26
`
`Geneoscopy Exhibit 1074, Page 11
`
`

`

`1/9/24, 11:12 AM
`
`Improved Fecal DNA Test for Colorectal Cancer Screening - Clinical Gastroenterology and Hepatology
`
`Sensitivity (N = 40)
`
`Specificity (N = 122)
`
`No. positive
`
`% (95% CI)
`
`No. positive
`
`% (95% CI)
`
`DEXY without 200 bp
`
`DEXY with 200 bp
`
`DEX
`
`DEY
`
`DXY
`
`EXY
`
`DE
`
`DX
`
`DY
`
`26
`
`25
`
`24
`
`25
`
`25
`
`26
`
`25
`
`26
`
`26
`
`65.0 (49.5–77.9)
`
`10
`
`91.8 (85.6–95.5)
`
`62.5 (47.0–75.8)
`
`6
`
`95.1 (89.7–97.8)
`
`60.0 (44.6–73.7)
`
`62.5 (47.0–75.8)
`
`62.5 (47.0–75.8)
`
`65.0 (49.5–77.9)
`
`62.5 (47.0–75.8)
`
`65.0 (49.5–77.9)
`
`13
`
`12
`
`10
`
`15
`
`11
`
`14
`
`89.3 (82.6–93.7)
`
`90.2 (83.6–94.3)
`
`91.8 (85.6–95.5)
`
`87.7 (80.7–92.4)
`
`91.0 (84.6–94.9)
`
`88.5 (81.7–93.0)
`
`65.0 (49.5–77.9)
`
`9
`
`92.6 (86.6–96.1)
`
`NOTE. DIA loci are D (5p21), E (17p13), X (HRMT1L1), and Y (LOC91199). DIA analysis was
`performed with and without the 200-bp fragment for DEXY. Because this did not change the results,
`remaining analyses were performed with the inclusion of the 200-bp fragment. The DY combination
`gave maximum sensitivity and specificity (shown in bold).
`
`Open table in a new tab
`
`Optimal Marker Combinations for Maximal Sensitivity and Specificity
`
`Of the methylation markers, HLTF was 2-fold less sensitive than vimentin, and did not significantly
`improve overall methylation marker sensitivity and specificity when combined with vimentin (Table
`5). Vimentin alone gave a sensitivity of 72.5% (95% CI, 57.2%–83.9%) and a specificity of 86.9%
`
`(95% CI, 79.8%–91.8%)—values that are nearly identical to the composite version 1 panel of
`
`https://www.cghjournal.org/article/S1542-3565(06)01044-5/fulltext
`
`12/26
`
`Geneoscopy Exhibit 1074, Page 12
`
`

`

`1/9/24, 11:12 AM
`Improved Fecal DNA Test for Colorectal Cancer Screening - Clinical Gastroenterology and Hepatology
`MuMu22 plus DIA (see Table 3). Examples of vimentin methylation in normal and cancer specimens
`are shown in Figure 1. We explored marker combinations to determine which formulation would
`provide maximum sensitivity and specificity. As noted earlier, DIA-DY alone gave a sensitivity and
`specificity of 65% and 92.6%, respectively. The least complex assay consisted of hypermethylation
`of vimentin and DIA-DY (vim + DY), yielding a maximum sensitivity of 87.5% (95% CI, 73.9%–
`94.5%), with a specificity of 82.0% (95% CI, 74.2%–87.8%) (Table 5). Importantly, among the 40
`cancers, vim+DY detected cancers regardless of stage.
`
`Table 5 Sensitivity and Specificity of Different Marker Combinations
`
`Sensitivity (n = 40)
`
`Specificity (n = 122)
`
`No.
`positive/total
`
`% (95% CI)
`
`No.
`positive/total
`
`Methylation (total):
`
`31
`
` HLTF
`
` Vimentin
`
`DIA-DY (from Table
`4)
`
`15
`
`29
`
`26
`
`Vimentin + DYa
`
`35/40
`
` Stage I
`
`6/8
`
`77.5 (62.5–
`87.7)
`
`37.5 (24.2–
`53.0)
`
`72.5 (57.2–
`83.9)
`
`65.0 (49.5–
`77.9)
`
`87.5 (73.9–
`94.5)
`
`75.0 (40.9–
`92.8)
`
`% (95% CI)
`
`84.4 (77.0–
`89.8)
`
`92.6 (86.6–
`96.1)
`
`86.9 (79.8–
`91.8)
`
`92.6 (86.6–
`96.1)
`
`82.0 (74.2–
`87.8)
`
`19
`
`9
`
`16
`
`9
`
`22/122
`
`—
`
`—
`
`a Vimentin + DY was the optimal marker combination.
`
`https://www.cghjournal.org/article/S1542-3565(06)01044-5/fulltext
`
`
`
`
`
`13/26
`
`Geneoscopy Exhibit 1074, Page 13
`
`

`

`1/9/24, 11:12 AM
`Open table in a new tab
`
`Improved Fecal DNA Test for Colorectal Cancer Screening - Clinical Gastroenterology and Hepatology
`
`Figure thumbnail gr1
`
`Figure 1 Detection of vimentin methylation in fecal DNA analyzed by VIM-29 PCR primers. Amplification of fecal DNA from 9
`
`normal () and 5 colon cancer () patients. Upper panel (VIM-29M) shows vimentin gene methylation and the lower panel
`
`(VIM-29U) shows control wild-type amplification of unmethylated vimentin sequences derived from normal cells in all
`
`samples. Positive (+) vimentin methylation is noted next to the sample identification number. Assay controls include
`
`unmethylated () and methylated () DNA samples, and negative water blank (deionized water).
`View Large Image | Download Hi-res image | Download (PPT)
`
`Influence of Tumor Location and Patient Age on Marker Expression
`
`There was a significant predilection for left-sided cancers to be DY positive (Table 6). However,
`vimentin detected cancers regardless of the location (Table 6). Thus, the combination of vim+DY
`detected cancers regardless of the location.
`
`Table 6 Association Between Marker Detection and Cancer Location
`
`Version 1
`
`DIA-DY
`
`HLTF
`
`Vimentin
`
`HLTF +
`Vimentin
`
`Vimentin
`+ DIA-DY
`
`54.5%
`
`36.4%
`
`36.4%
`
`72.7%
`
`81.8%
`
`90.9%
`
`79.3%
`
`75.9%
`
`37.9%
`
`72.4%
`
`75.9%
`
`86.2%
`
`Right (N =
`11)
`
`Left (N =
`29)
`
`P value
`
`NS
`
`.03
`
`NS
`
`NS
`
`NS
`
`NS
`
`Open table in a new tab
`
`https://www.cghjournal.org/article/S1542-3565(06)01044-5/fulltext
`
`
`
`
`
`14/26
`
`Geneoscopy Exhibit 1074, Page 14
`
`

`

`1/9/24, 11:12 AM
`Improved Fecal DNA Test for Colorectal Cancer Screening - Clinical Gastroenterology and Hepatology
`We observed that among individuals with NC, those with a positive methylation marker (either
`vimentin or HLTF) were significantly older than those with a negative test (Table 7). A similar trend
`was noted among the CRC patients. There were 22 subjects (18%) with false-positive vimentin
`and/or DY in the NC group (Table 5). Among these, 14 were positive for vimentin alone (specificity,
`88.6%), 6 were positive for DIA alone (specificity, 95.1%), and 2 were positive for DIA and vimentin
`(specificity, 98.4%). The mean age of subjects in these groups was 65.1, 58.5, and 59 years,
`respectively, indicating that false-positives for vimentin methylation were associated with older age.
`
`Table 7 Association Between Markers and Patient Age
`
`Version 1
`
`DIA-DY
`
`HLTF
`
`Vimentin
`
`HLTF +
`Vimentin
`
`Vimentin
`+ DIA-DY
`
`Normal colonoscopy
`
` 
`Negative
`
`58.3
`
` Positive
`
`58.9
`
` P value
`
`NS
`
`Colon cancer
`
` 
`Negative
`
`67.5
`
` Positive
`
`65.0
`
` P value
`
`NS
`
`58.4
`
`58.4
`
`NS
`
`68.3
`
`64.2
`
`NS
`
`58.0
`
`63.0
`
`.04
`
`65.1
`
`66.5
`
`NS
`
`57.5
`
`64.3
`
`.00
`
`60.3
`
`67.7
`
`.04
`
`57.6
`
`62.6
`
`.03
`
`59.8
`
`67.4
`
`.05
`
`57.4
`
`62.7
`
`.01
`
`69.0
`
`65.2
`
`NS
`
`NOTE. Values represent mean age (in years).
`
`Open table in a new tab
`
`https://www.cghjournal.org/article/S1542-3565(06)01044-5/fulltext
`
`
`
`
`
`15/26
`
`Geneoscopy Exhibit 1074, Page 15
`
`

`

`1/9/24, 11:12 AM
`Patient Satisfaction
`
`Improved Fecal DNA Test for Colorectal Cancer Screening - Clinical Gastroenterology and Hepatology
`
`Forty-one percent of the respondents to the satisfaction questionnaire were men, and 40% were
`older than age 60. The percentage that found it easy or very easy to (1) perform the test, (2) open
`the preservative bottle, or (3) add the preservative to the specimen was 97%, 96%, and 100%,
`respectively, and 93% of respondents felt very comfortable performing the stool test. Importantly,
`84% would repeat the test if recommended by their doctor.
`
`Discussion
`
`Screening is a cost-effective yet underused strategy for reducing CRC incidence and mortality.
`Concerns about test discomfort, invasiveness, embarrassment, and self-efficacy have been
`identified as important barriers to more effective screening.
`
` The availability of a noninvasive
`14, 15
`screening test that is convenient, safe, and easy to perform at home without bowel preparation or
`dietary restriction has the potential to significantly increase participation. Prior studies clearly have
`shown that fecal DNA testing fulfills these criteria and has distinct advantages over existing
`screening strategies, including the fecal occult blood test.
` In addition, because fecal DNA testing
`16
`involves mailing of specimens, geographic access becomes less of a barrier, there is no loss of time
`from work, and no formal health care visit. Improved performance data would further validate the
`role of fecal DNA testing as an alternative screening option.
`
`We herein report the results of a second-generation fecal DNA test that takes advantage of
`technical enhancements and new knowledge about molecular pathways of colon carcinogenesis.
`Our findings build on the promising results of the prototype (version 1) multitarget DNA panel that
`showed 52% sensitivity and 94% specificity for CRC in asymptomatic average-risk individuals. By
`6
`using improved methods for stabilizing DNA during specimen transport, and better extraction of DNA
`from stool, we now find that the sensitivity for the version 1 marker panel is increased from 52% to
`72.5%. This improvement was a direct result of an increase in DIA sensitivity from 3% to 65%,
`confirming the observations of Olson et al that the low sensitivity of DIA in the previous multicenter
`7
`study was as result of the DNA degradation. This increase in sensitivity for the full version 1 panel
`was achieved at the expense of a relatively minor decrease in specificity from 94.4% to 89.3%.
`Thus, even with the original markers, improved DNA preservation and extraction from stool resulted
`in a better screening test.
`
`This advance notwithstanding, the MuMu22+DIA panel is complex given its many target genes and
`the need to conduct numerous PCR reactions. It is noteworthy, therefore, that the 72.5% sensitivity
`
`
`
`https://www.cghjournal.org/article/S1542-3565(06)01044-5/fulltext
`
`16/26
`
`Geneoscopy Exhibit 1074, Page 16
`
`

`

`1/9/24, 11:12 AM
`Improved Fecal DNA Test for Colorectal Cancer Screening - Clinical Gastroenterology and Hepatology
`of the full version 1 mutation panel achieved in the present study by better preservation and
`purification methods also was achieved by using either the DIA-DY or vimentin methylation markers
`alone. Indeed, because the sensitivity of 72.5% (95% CI, 57.2%–83.9%) for vimentin methylation
`alone in the present study is higher than our previous finding of 46% (95% CI, 35%–56%) with this
`marker,
` this further suggests that better DNA preservation and extraction improves the results of
`10
`methylation marker assays in stool. The combination of vimentin plus DIA-DY resulted in an optimal
`sensitivity of 87.5% (95% CI, 73.9%–94.5%). This optimal combination detected most cancers,
`including early (stage I) lesions, regardless of their location in the colon. These results support the
`biological significance of abnormal apoptosis and aberrant gene methylation in colorectal
`carcinogenesis.
`
`It is not known how the new version 2 assay will perform in a screening setting where most cancers
`are detected at an earlier stage. Although only half the CRC cases in the present study were stage
`6
`