Significance of CD44 gene products for cancer
`diagnosis and disease evaluation
`
`1053
`
`With increasing emphasis on the early detection of
`cancer, the search is on for reliable markers that will
`be clinically helpful in the diagnosis of small tumours
`and in the assessment of their metastatic potential.
`This report presents evidence that an abnormal
`pattern of activity of the CD44 gene is a promising
`candidate for both of these purposes in various types
`of malignancy. By a mechanism known as alternative
`splicing this gene can produce different messenger
`RNA molecules (transcripts) which are detectable,
`after
`amplification,
`separate bands in
`as
`electrophoretic gels. In neoplasia many abnormal
`variant transcripts are produced. A previous finding
`in animal experiments, that one such variant might be
`important in metastasis, prompted our study of
`human tumour tissue, benign and malignant, and of
`corresponding normal tissues.
`We studied tumour tissue from 34 patients with
`neoplastic disease (mostly breast or colon cancer)
`and normal or non-malignant diseased breast or
`colonic tissue from 11 patients and peripheral blood
`leucocytes from 4 healthy volunteers. CD44 gene
`activity was studied by amplifying messenger RNA
`with the polymerase chain reaction (PCR) followed
`by electrophoresis and blot hybridisation. In
`malignant tissues there was gross overproduction of
`each of 9 or more alternatively-spliced large
`molecular variants in all samples, whereas in the
`control samples only the standard product was
`routinely detected with occasional minimal
`quantities of one or two small variants. Furthermore,
`the band pattern permitted differentiation between
`the 23 cases with metastatic tumours of the breast or
`colon and the 8 with no detectable metastases.
`Calibration studies seeding blood with tumour cells
`showed that the technique can detect as few as 10
`tumour cells among 107 leucocytes (1 ml of blood).
`Analysis of CD44 splice variants may prove to
`have applications not just to the early detection of
`metastatic potential in surgical biopsy specimens but
`also, if our findings are confirmed, in readily available
`bodily fluids, to the early diagnosis of cancer in
`screening programmes, to the assessment of
`remaining disease in the body and to the early
`detection of recurrences.
`
`Lancet 1992; 340:1053-58.
`
`Introduction
`In a recent Lancet review1 it was noted that there is so far
`nothing that a malignant tumour cell can do that is not a
`routine activity of normal cells somewhere in the body. To
`illustrate the point the authors noted that metastatic tumour
`cells express a variant of glycoprotein CD44 "that is believed
`to play a part in normal lymphocyte migration and binding".
`
`The human CD44 gene codes for a group of proteins originally
`defined as sharing determinants recognised by the CD44
`monoclonal antibody (mAb). Our studies highlight the clinincal
`potential of the products of this gene. First of all, however, it is
`necessary to describe the CD44 gene and the functions of some of its
`products. The members (isoforms) of this group which have so far
`been purified and characterised are located at the cell surface and
`differ in properties such as size and glycosylation. This variation in
`the proteins produced from one gene is possible because the coding
`sequences (exons) in DNA are transcribed (expressed) in different
`combinations, according to the prevailing requirements of the cell.
`Messenger RNA (mRNA) consists of the transcribed sequences
`from the exons which can be spliced together in different
`combinations ("alternative splicing")2 once the segments
`transcribed from non-coding regions have been excised.’ A single
`cell may thus contain at the same time two or more variant mRNA
`from the same gene. These splice variants can be translated into
`proteins which are structurally related because they contain some
`sections with identical aminoacid sequences but whose functions
`may or may not be similar.
`
`Fig 1-Map of CD44 gene products showing exons, probes, and
`primers.
`
`Primer P1 =5’GACACATATTGCTTCAATGCTTCAGC
`Primer P2 = 5’GATGCCAAGATGATCAGCCATTCTGGAAT
`Primer D3=5’TGAGATTGGGTTGAAGAAATC-3.
`Probe S1 =5C’CTGAAGAAGATTGTACATCAGTCACAGAC.
`Primer D1 =5’GACAGACACCTCAGTTTTTCTGGA.
`Primer D5 = 5’TTCCTTCGTGTGTG G GTAATGAGA
`
`Fig 1, summarising what is known about alternatively-spliced
`products transcribed from the CD44 gene, shows that the basic or
`"standard" protein can be modified by the insertion of transcripts
`from any, some, or all of at least five extra exons.3,4 32 possible
`variants could be derived from these components alone. Some may
`be inadmissible combinations; on the other hand, differing degrees
`of modification of allowable ones, by attachment of carbohydrate,
`glycosyl side-chains, could create a much larger family of molecules.
`Two of the commonest proteins produced by this gene consist of a
`90 kDa form with a heavily glycosylated central 37 kD protein core5
`
`ADDRESS Nuffield Department of Pathology, University of
`Oxford, John Radcliffe Hospital, Headington, Oxford OX3
`9DU, UK (Y Matsumura, MD, D Tarin, MD). Correspondence to Dr
`David Tarin
`
`Geneoscopy Exhibit 1061, Page 1
`
`

`

`1054
`
`TABLE I-CLINICAL AND PATHOLOGICAL DETAILS
`
`TABLE II-SUMMARY OF RESULTS
`
`than normal colonic epithelium did. Further work by two other
`groups8,9 indicated that the CD44 gene has a role in metastasis of
`certain human tumour cell lines when implanted in nude mice.
`Meanwhile. Gunthert et apo had obtained results indicating that a
`newly identified variant of cell surface glycoprotein CD44, is
`required for metastatic behaviour of rat pancreatic adenocarcinoma
`cells. Using an antibody to these metastatic tumour cells, they
`cloned a cDNA sequence corresponding to a new variant of rat
`CD44 glycoprotein. It contained previously unidentified exons.
`The introduction of a piece of DNA specially constructed to
`overexpress this unique sequence into non-metastatic rat tumour
`cells, appeared to induce metastatic behaviour.lO
`Therefore, might metastatic human tumours and ones
`without clinically detectable metastases, encountered in
`routine clinical practice, express CD44 products,
`particularly the new sequence mentioned above,
`differentially? An accurate and reliable way to study this
`question, when the tissue available is limited, would be to
`use the polymerase chain reaction (PCR) to amplify cDNA
`made from whole cellular mRNA. Publication of sequence
`data on further portions of the CD44 gene 34,6 allowed us to
`examine the expression of various parts of CD44, especially
`the portion (exon 3, fig 1) identified by Gunthert et apo as
`relevant to metastasis, in fresh surgical resection specimens
`from patients with benign and malignant tumours of the
`breast and colon and from metastases. We compared the
`findings with patterns of expression in normal tissues from
`the same and other patients and in blood from healthy
`volunteers. When results began to accumulate it became
`apparent that the appreciable differences in CD44
`expression between metastatic tumours and locally invasive
`tumours with no clinical evidence of metastasis and benign
`tumours would be important for choice of treatment, while
`differences between locally or benign tumours and normal
`tissue would be important for early diagnosis and screening.
`
`Materials and methods
`
`Materials
`Fresh tissue samples, 05-1 cm in diameter, were obtained from
`surgical resection specimens from 33 patients with breast or colon
`tumours and 1 with thyroid carcinoma. The samples were
`snap-frozen in liquid nitrogen within 10 min of arrival in the
`pathological specimen reception area and were kept frozen until use.
`Portions of any lymph node metastases or blood-borne metastases
`in the resected tissue were also collected. Normal breast tissue,
`colonic mucosa, lymph node and normal liver were obtained from
`the periphery of specimens surgically resected for treatment of
`cancer and from other specimens removed for non-neoplastic
`conditions, including fibrocystic disease of the breast, sigmoid,
`volvulus, and appendicitis. Normal peripheral blood leucocytes
`were obtained from 4 healthy volunteers. The patient details, the
`histological features of the tumours and the particulars of their
`clinical and pathological staging are described in table i.
`
`*Uver metastasis in C3; nodes and liver in C4, lymph node in T1
`tDC!S=ducta! carcinoma-m-situ, IDC=infiltraUng ductal carcinoma (mucinous In
`B4),
`I LC infiltrating
`lobular
`Adeno=weH-d!fferentiated
`carcinoma.
`adenocarcinoma; (Adeno) = moderately differentiated adenocarcinoma
`tLetters refer to Dukes stage for colon carcinoma.
`
`and a 180 kDa form with 135 extra aminoacids in the proximal
`extra-membrane domain, that is even more heavily glycosylated.6
`Both are widely distributed in different cells and tissues. The 90
`kDa glycoprotein is the haemopoietic or standard form present on
`circulating leucocytes, bone marrow cells, and numerous other cell
`types.’ The epithelial variant6 (180 kDa) is detectable on several
`epithelial cell types and is formed by the intercalation of transcripts
`from exons 4 and 5. Both are thought to function as receptors
`mediating the adhesive interactions involved in attachment of cells
`to other cells or to the adjacent extracellular matrix.
`Some time ago, E. C. Butcher and colleagues (reviewed in Picker
`et at) reported that some CD44 epitopes, recognised by the
`Hermes-3 monoclonal antibody, function as lymph node receptors
`or "homing" molecules which enable circulating lymphocytes to
`recognise regional lymph nodes. When, in 1989 Stamenkovic et al,s
`using a different mAb, isolated and cloned a complementary DNA
`(cDNA) sequence coding for the standard form of the molecule they
`found that the gene was expressed not only by lymphoid cells but
`also by a variety of carcinoma cell lines and by a representative
`sample of solid tumours. Two colonic carcinomas expressed more
`
`Geneoscopy Exhibit 1061, Page 2
`
`

`

`1055
`
`Fig 2-Breast tissue probed with D3 (10 h exposure).
`(A) malignant primary breast carcinomas with metastases. Tracks 1,2,
`and 3= patient B1;4,5, and 6=B2;7,8, and 9 = B3; 10 and 11 =B4;12
`and 13= B5 Compared with normal breast tissue, primary breast
`carcinomas and metastatic deposits overexpress several spl ice-variants.
`Doublet (arrow in track 5) at 1500 and 1650 bp is present in all tumours
`and metastases but isfogged in other tracks by this time of exposure; it is
`not detectable in any normal sample, even at exposures of 23 h.
`(B) breast carcinomas with no clinical evidence of metastasis (tracks
`14-20 are from patients B15-B21): ): all overexpress several variants but
`show fewer bands and the signal intensity is less (except track 16, see
`text). The doublet (arrow) is easily recognisable in tracks 15 5 and 18 (it
`is blurred in 16 at this length of exposure) but became detectable in all
`other tracks on longer exposure, by which time there is fogging of
`tracks with stronger signals.
`(C) fibroadenomas (FA) and fibrocystic disease of the breast (Cyst).
`Benign tumours (samples B22 and 23) express more than non-
`neoplastic sample (B24).
`
`PCR method
`
`Total cellular RNA was extractedll and cDNA was synthesised
`with viral reverse transcriptase followed by amplification by PCR
`(Superscript preamplification system; BRL Life Technologies
`UK). For the 30 cycles of PCR the conditions were: 94°C for 1 min,
`55°C for 1 min, and 72°C for 2 min. Negative controls, with no
`template cDNA in the reaction mix, were run with every batch. We
`devised the primers and probes using information from the
`sequence for human CD44 cDNA2-4 (fig 1). 10 Itl PCR product was
`electrophoresed in a 1-2% agarose gel and transferred to Hybond
`N+ (Amersham UK) nylon membranes for hybridisation with
`32P-labelled
`oligonucleotide
`probe
`Blotting and
`D3.
`autoradiography according to standard protocols were performed to
`improve sensitivity of detection and resolution. Filters were
`exposed to Kodak X-ray film for 2-16 h and then boiled in 05%
`SDS before rehybridisation with another radiolabelled probe (SI)
`we designed to anneal to the standard portion of the CD44
`molecule. The conditions for hybridisation, washing, and
`autoradiography were as above.
`
`Fig 3-Breast tissue probed with probe S1 (1 h exposure).
`Filter used in fig 1 after probe D3 had been stripped off shows that
`differences in fig 1 are not due to unequal loading; that expression of the
`standard form is quantitatively greater than any of the variants; that the
`standard form is expressed in all tissues examined and that variants which
`do not contain exon 3 transcripts are also overexpressed in tumours.
`(Doublet recognisable in panel A but needed longer exposure in panels B
`and C)
`
`Calibration of sensitivity
`Peripheral blood leucocytes (PBL) were purified from 20 ml
`whole blood by ammonium chloride lysis of packed red cells and
`centrifugation. The white cell pellet was divided into four tubes
`which were seeded with 0, 1, 10, and 100 uJ of a suspension of
`ZR75-1 breast carcinoma cells (5000 cells per ml). Total RNA was
`then extracted and dissolved in 20 J.ll water. cDNA synthesis was
`done on 4 J.ll samples of RNA representing 0,1,10, and 100 tumour
`cells. PCR was done on these samples and on positive (tumour cells
`only) controls using primers Dl and D5, we designed to anneal
`specifically to exons 1 and 5. ZR75-1 cells express both these exons
`(and others) in a pattern easily distinguishable from PBL, and we
`chose these primers to increase sensitivity by shortening the
`segment to be amplified. PCR conditions were as above, except that
`the reaction was continued for 35 cycles and 25 units ofAmpliTaq
`were added to each tube at the beginning and a further 25 units at
`the 15th cycle. The oligonucleotide sequence used for probing was
`32P-labelled D3.
`
`Results
`
`Overview (table II)
`Because primers PI and P2 amplify across the site in the
`mRNA at which extra segments may be inserted to produce
`different forms of CD44, the intervening "standard"
`portion of the molecule’will be amplified along with any
`transcripts from exons 1-5 spliced into it. PI has its
`
`Geneoscopy Exhibit 1061, Page 3
`
`

`

`1056
`
`origin 324 bp upstream from the insertion site in the cDNA
`of standard CD44 molecules and P2 is 158 bp downstream.
`Thus the amplified fragment will be 482 bp if a sample
`expresses standard (haemopoietic) CD44 only; a fragment of
`878 bp will be produced if it is the epithelial form of CD44;
`and there will be several other fragments if a sample contains
`alternatively spliced transcripts. These appear as bands of
`differing molecular size when resolved by gel
`electrophoresis and blot hybridisation with CD44 probes.
`The total number of different products theoretically
`detectable by a probe such as S 1 to the standard part of the
`molecule considering all possible combinations is calculated
`to be 32. Probe D3 will pick up at most only the 16 that
`contain D3 transcripts from exon 3. In practice, the full
`range of possible combinations was not detected, but 9 or
`more bands were seen in PCR products of neoplastic tissues
`hybridised with these probes. Normal breast, colon, and
`lymph nodes did very weakly express some small D3-
`containing transcripts besides the standard molecule but
`peripheral blood leucocytes and liver seemed only to express
`the latter with this combination of probes and primers.
`
`Breast tissue (figs 2 and 3)
`Metastatic tumour deposits and their corresponding
`primary tumours from all cases over-expressed several
`bands (alternatively spliced products) containing transcripts
`from exon 3 (fig 2A), reported by Gunthert et al10 to be
`relevant to metastasis. Nine bands were frequently seen,
`including a doublet at 1500 and 1650 bp that was present in
`all tumours. Normal breast tissue and normal lymph node
`produced two bands (1150 bp and 860 bp) with this probe;
`the doublet was not seen. Differences in the number and size
`of the bands and the intensity of signal from the bound
`probe, between tissues in normal and malignant categories,
`were obvious in all samples examined. For occasional
`tumour samples it was necessary to expose the filter to the
`photographic film for longer to see the distinctive
`differences, but this finding was confirmed in every case
`studied.
`Samples from locally invasive tumours with no associated
`clinical evidence of metastasis (fig 2B) and from the 2
`fibroadenomas (fig 2C), also overexpressed products
`containing transcripts from domain 3 relative to normal
`tissues, but the extent of this was easily distinguished from
`that in the tumours with metastases. Distinction from the
`patterns seen in normal tissues was also easy. However, a
`single sample gave a similar result to malignant tumours
`with metastases (lane 16, fig 2B). The two fibroadenomas
`showed band patterns that were similar to those from
`non-metastatic carcinomas and the sample from a case of
`fibrocystic disease of the breast resembled the pattern for
`normal non-neoplastic breast tissue (fig 2C). This is the first
`instance of definitive diagnosis by this method. The piece of
`tissue was handed to us by the duty pathologist as being
`from a benign tumour (fibroadenoma) on the basis of
`inspection with the naked eye. We characterised it as
`definitely non-neoplastic after PCR amplification of its
`cDNA (lane 23, fig 2C), and subsequent microscopic
`examination confirmed this.
`To ensure direct comparability of results, all samples
`from lanes 1-23, were dealt with in exactly the same manner
`and all PCR products were run in the same gel and blotted
`and probed on the same piece of filter membrane. Hence the
`differences seen between the groups of samples in fig 2A, B,
`and C are reliable, and every effort has been made to exclude
`variation due to differences in processing.
`
`Fig 4-Colon tissue samples probed with D3 (10 h exposure).
`Tracks 1, 2 and 3 = patient C1; tracks 4,5, and 6 = patient C2; tracks 7,8,
`and 9 = patient C3; tracks 10 and 11 = patient C4; tracks 12 and
`13= patient C5; track 14=normal liver sample. Picture shows features
`described in legend to fig 1-ie, findings apply to carcinoma of colon also.
`1500/1650 bp doublet (arrow) is easily recognisable in seven tumour
`tracks (2 and 8-12) and faint signal in corresponding position in tracks 3,
`5, 6, and 13 became stronger on longer exposure. However none
`appeared in this vicinity in tracks 1, 4, 7 or 14 (normal tissue).
`
`To confirm that the differences seen with probe D3 are
`not technical artifacts the same filter was hybridised with
`probe S 1. We found that all tissues examined expressed the
`standard form of the gene equally; splice variants not
`containing transcripts from domain 3 were present in
`tumours and metastases (ie, bands became visible with
`probe Sl that were not visible with probe D3), and the
`differences described above were not due to unequal loading
`of tracks in the panels and lanes on this composite filter but
`resulted from alternative splicing. All conditions in this
`experiment were the same as those in hybridisation with D3
`except for exposure time of filter to photographic film (10 h
`for fig 2, 1 5 h for fig 3). This difference in exposure time is
`necessary to avoid fogging the film completely in
`circumstances where more radioactive probe is bound to the
`filter.
`
`Colon samples
`The findings in colon carcinoma were identical to those in
`breast carcinoma (figs 4 and 5). In all cases the colon
`carcinoma tissues showed an increased number of more
`intensely labelled, larger molecular weight bands with probe
`D3 than normal colonic mucosa and other normal tissues.
`
`Fig 5-Colon tissue samples probed with S1 (1 °5 h exposure).
`This confirms that equal loading tracks and other points illustrated in fig
`2 apply to colon carinomas Normal liver expresses standard form of
`CD44.
`
`Geneoscopy Exhibit 1061, Page 4
`
`

`

`1057
`
`Fig 6-Normal PBL (from 3 different persons) and other normal tissues probed with D3 (panel A;
`8 h exposure) or S1 (panel B, 5 h exposure).
`Track 6 contains PCR product from breast cancer (B1) as positive control. With this combination of primers
`and probes, leucocytes express standard CD44 but notsplicevariants. Track 4= breast tissue obtained at necropsy
`from the body of a woman who died of bacterial endocarditis; track 5=colon resected for volvulus.
`
`Again the 1500/1650 bp was seen in all tumours and not in
`any normal colonic mucosal sample. As with breast
`carcinomas, hybridisation with probe S 1 showed no
`differences in the degree of expression of the standard form
`of the molecule between the various samples.
`
`PBL and other normal tissues
`PBL and liver expressed the standard form of CD44
`without splice variants (fig 6). Breast, colon and lymph
`nodes co-expressed the standard form and a trace of small
`D3 containing variant or two.
`
`Calibration of sensitivity
`Examination of autoradiograms of PCR products of
`peripheral blood leucocytes seeded with known numbers of
`ZR75-1 colon carcinoma cells showed the presence of
`additional bands characteristic of the tumour cells, down to a
`level of 10 tumour cells in a sample of 107 leucocytes.
`
`Discussion
`All samples of neoplastic tissue showed overexpression of
`many alternatively-spliced products of the CD44 gene
`whilst none of those from non-neoplastic tissue did so. The
`differences in pattern between metastatic tumours and ones
`without any clinical indication of metastasis also seemed
`distinct. This feature may provide a useful indicator of
`prognosis and deserves further evaluation. In one instance, a
`tumour from a patient with no clinical evidence of metastasis
`was found to have a pattern of expression indicating
`metastatic capability. We do not know yet whether this is a
`false-positive result, or a sign of imminent metastasis.
`Our findings relate to three organ systems and are not
`necessarily representative of tumours of other tissues but
`there is indirect evidence that changes in CD44 expression
`may occur in several types of cancer. Signs of overexpression
`of some parts of this gene can be seen in northern blots of
`RNA from pulmonary adenocarcinoma, colonic carcinoma,
`
`oesophageal carcinoma, mesothelioma, and melanoma,
`hybridised with appropriate CD44 probes.5,6 However,
`northern blotting requires the use of much more RNA and
`hence larger amounts of tissue (and time) than are practical
`for diagnostic purposes and is not nearly as sensitive as our
`cDNA/PCR/blot-hybrisation technique for detecting small
`amounts of diverse and unusual transcripts. With our
`different approach, we were able to examine a large series of
`tumours rapidly and have shown that analysis of CD44
`activity in small specimens is not only feasible but also
`provides information of clinical interest. PCR amplification
`of cDNA alone would not have revealed the same
`information. Many of the amplified PCR products resolved
`by electrophoresis were invisible in ethidium bromide-
`stained gels, and the subsequent hybridisation with various
`radioactive oligonucleotide probes enormously increased
`the sensitivity. This development opens the way to further
`work, using PCR, on patterns of CD44 expression in biopsy
`material from other types of common human tumour, to
`clarify the clinical significance of the abnormal expression of
`this gene.
`The possibility that some process other than neoplasia
`may sometimes produce similar changes in CD44
`expression necessitates caution in interpretation. The
`specificity of the correlation between overexpression of
`alternatively spliced CD44 transcripts and neoplasia will
`only emerge after exhaustive clinical testing and it would be
`wrong to draw more general conclusions or make
`extrapolations at this stage.
`In both normal colonic epithelium and bone marrow
`(unpublished) there is substantial cell turnover but we did
`not observe the band pattern seen with tumours, which
`suggests that overexpression observed in neoplasia is
`probably not simply reflecting a state of rapid cell
`proliferation.
`The strong association between altered CD44 expression
`and neoplasia should not be taken to imply that any of the
`individual exons are expressed only in neoplasia or in
`
`Geneoscopy Exhibit 1061, Page 5
`
`

`

`1058
`
`progression to metastasis. Instead, we think that an
`abnormal pattern of gene activity (overexpression and
`inappropriate splicing) such as that affecting the CD44 locus
`could play a part in malignancy and be a useful marker of
`that state. However, the finding that there is marked
`increase in the number and signal intensity of bands
`hybridising with radiolabelled probe D3 in the PCR
`products from human tumours capable of metastasis
`supports the findings of Gunthert et al/° that exons 2 and 3
`(fig 1) of the gene may be involved in this process. To know
`whether expression of splice variants containing transcripts
`from these exons actively contributes to or only incidentally
`accompanies metastatic behaviour of human tumour cells,
`further work is needed. The diagnostic significance of the
`findings reported here is unaffected by this issue.
`The test described is sensitive enough to detect as few as
`10 tumour cells in 1 ml of blood. With the right choice
`of primers and PCR conditions, it should be possible to
`detect a single tumour cell among 107 normal leucocytes.
`If this sort of sensitivity were to be achievable with
`sputum, urine, stools, blood, cervical smears, or other
`body fluids naturally seeded with small numbers of tumour
`cells, the observations and techniques reported would
`have wide, general applicability to cancer prevention
`and screening. We are now trying to find out if these
`techniques will facilitate the very early detection of common
`cancers.
`
`We thank Dr D. L. Darling for helpful clinical and scientific comments
`Prof J. I. Bell for advice in the early stages of this work; Mr J. Smith and Dr S.
`
`Herrington for suggestions which helped in manuscript revision; and Mrs L.
`Summerville for secretarial help.
`
`REFERENCES
`
`1. Frost P, Levin B. Clinical imlications of metastatic process. Lancet 1992;
`339: 1458-61.
`2. Smith CWJ, Patton JG, Nadal-Ginard B. Alternative splicing in the
`control of gene expression. Annu Rev Genet 1989; 23: 527-77.
`3. Hofmann M, Rudy W, Zoller M, Tolg C, Ponta H, Herrlich, P, Gunthert
`U. CD44 splice variants confer metastatic behavior in rats:
`Homologous sequences are expressed in human tumour cell lines.
`Cancer Res 1991; 51: 5292-97.
`4. Jackson DG, Buckley J, Bell JI. Multiple variants of the human
`lymphocyte homing receptor CD44 generated by insertions at a single
`site in the extracellular domain. J Biol Chem 1992; 267: 4732-39.
`5. Stamenkovic I, Amiot M, Pesando JM, Seed B. A lymphocyte molecule
`implicated in lymph node homing is a member of the cartilage link
`protein family. Cell 1989; 56: 1057-62.
`6. Stamenkovic I, Aruffo A, Amiot M, Seed B. The hematopoietic and
`epithelial forms of CD44 are distinct polypeptides with different
`adhesion potentials for hyaluronate-bearing cells. EMBO J 1991; 10:
`343-48.
`7. Picker LJ, Nakache M, Butcher EC. Monoclonal antibodies to human
`lymphocyte homing receptors define a novel class of adhesion
`molecules on diverse cell types. J Cell Biol 1989; 109: 927-37.
`8. Birch M, Mitchell S, Hart IR. Isolation and characterization of humsan
`melanoma cell variants expressing high and low levels of CD44. Cancer
`Res 1991; 51: 6660-67.
`9. Sy MS, Guo Y-J, Stamenkovic I. Distinct effects of two CD44 isoforms
`on tumor growth in vivo. J Exp Med 1991; 174: 859-66.
`10. Gunthert U, Hofmann M, Rudy W, Reber S, Zoller M, HauBmann,
`Matzku S, Wenzel A, Ponta H, Herrlich P. A new variant of
`glycoprotein CD44 confers metastatic potential to rat carcinoma cells.
`Cell 1991; 65: 13-24.
`11. Chomzynski P, Sacchi N. Single-step method of RNA isolation by acid
`guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem
`1987; 162: 156.
`
`Continuous intravenous famotidine for
`haemorrhage from peptic ulcer
`R. P. WALT J. COTTRELL S. G. MANN N. P. FREEMANTLE
`M. J. S. LANGMAN
`
`Peptic ulcer bleeding often stops spontaneously
`but rebleeding may be catastrophic. Emergency
`surgery carries risks so safe medical therapies are
`needed. Since platelet function and plasma
`coagulation are both pH sensitive and since pepsin
`lyses clot at low pH the maintenance of gastric pH
`close to neutrality might influence rebleeding rates.
`Previous trials with H2 antagonists have been
`inadequate although a 1985 meta-analysis did
`support an important clinical effect. We report here a
`large multicentre trial of famotidine in ulcer bleeding.
`1005 patients admitted to one of sixty-seven
`hospitals in the UK or Eire with haemorrhage from
`peptic ulcer with endoscopic signs of oozing, black
`slough, fresh clot or visible vessel were randomly
`allocated to famotidine (10 mg bolus followed by
`3·2 mg/h intravenously) or matching placebo for
`72 h. This famotidine regimen had previously been
`shown to maintain pH near 7 in such patients. 497
`patients received famotidine and 508 placebo. The
`treatment groups were similar in respect of age, sex,
`ulcer site, and signs and severity of bleeding. Case
`fatality
`(6·2% famotidine vs 5·0% placebo),
`rebleeding (23·9% vs 25·5% placebo), and surgery
`(15·5% vs 17·1% placebo) rates were not
`
`significantly different between the two groups. This
`trial suggests that potent inhibition of gastric
`secretion does not influence the natural history of
`peptic ulcer haemorrhage.
`
`Lancet 1992; 340: 1058-62.
`
`Introduction
`Gastrointestinal haemorrhage carries a substantial risk of
`fatal outcome despite advances in surgery and endoscopy,
`and clinicians have been hoping for a simple medical therapy
`that might influence prognosis. One possibility is
`antisecretory therapy but few clinical trials have had
`sufficient statistical power to produce a clear-cut result:
`some have reported significant benefits from H2 antagonists
`while others have not.l-6 A meta-analysis on trials of H2
`receptor antagonists in bleeding gastric ulcer indicates that
`this treatment might reduce rebleeding by 32%, operation
`rates by 39%, and case fatality rates by 47%; a benefit in
`duodenal ulcer haemorrhage was less clear. We have shown
`that bolus doses of cimetidine and ranitidine produce only a
`modest increase in gastric pH in patients admitted with
`
`ADDRESSES. Department of Medicine, Queen Elizabeth
`Hospital, Birmingham B15 2TH (R. P. Walt, FRCP, Prof M. J. S.
`Langman, FRCP), and Medical Department, Merck Sharp and
`Dohme Ltd, Hoddesdon, Hertfordshire, UK (J. Cottrell, MSc, S. G.
`Mann, MB, N. P. Freemantle, MSc). Correspondence to Dr R. P. Walt.
`
`Geneoscopy Exhibit 1061, Page 6
`
`