2686
`
`Highly Methylated Genes in Colorectal Neoplasia:
`Implications for Screening
`
`Hongzhi Zou,1 Jonathan J. Harrington,1 Abdirashid M. Shire,1 Rafaela L. Rego,1
`Liang Wang,2 Megan E. Campbell,3 Ann L. Oberg,3 and David A. Ahlquist1
`
`1Division of Gastroenterology and Hepatology, 2Department of Laboratory Medicine, and 3Division of Biostatistics,
`Mayo Clinic, Rochester, Minnesota
`
`Abstract
`
`Discriminant markers are required for accurate cancer
`screening. We evaluated genes frequently methylated
`in colorectal neoplasia to identify the most discriminant
`ones. Four genes specifically methylated in colorectal
`cancer [bone morphogenetic protein 3 (BMP3), EYA2,
`aristaless-like homeobox-4 (ALX4), and vimentin] were
`selected from 41 candidate genes and evaluated on 74
`cancers, 62 adenomas, and 70 normal epithelia. Meth-
`ylation status was analyzed qualitatively and quantita-
`tively and confirmed by bisulfite genomic sequencing.
`Effect of methylation on gene expression was evaluated
`lines. K-ras and BRAF
`in five colon cancer cell
`mutations were detected by sequencing. Methylation
`of BMP3, EYA2, ALX4 , or vimentin was detected
`respectively in 66%, 66%, 68%, and 72% of cancers;
`74%, 48%, 89%, and 84% of adenomas; and 7%, 5%, 11%,
`
`and 11% of normal epithelia (P < 0.01, cancer or
`adenoma versus normal). Based on area under the curve
`analyses, discrimination was not significantly im-
`proved by combining markers. Comethylation was
`frequent (two genes or more in 72% of cancers and
`84% of adenomas), associated with proximal neoplasm
`site (P < 0.001), and linked with both BRAF and K-ras
`mutations (P < 0.01). Cell line experiments supported
`silencing of expression by methylation in all four study
`genes. This study shows BMP3, EYA2, ALX4, and
`vimentin genes are methylated in most colorectal neo-
`plasms but rarely in normal epithelia. Comethylation of
`these genes is common, and pursuit of complementary
`markers for methylation-negative neoplasms is a rational
`(Cancer
`strategy to optimize screening sensitivity.
`Epidemiol Biomarkers Prev 2007;16(12):2686 – 96)
`
`Introduction
`
`Colorectal cancer is the second leading cause of cancer-
`related death in the United States, and currently, f40%
`of affected individuals die from this cancer (1).Colorectal
`cancer mortality can be reduced by screen detection of
`premalignant adenomas and early stage cancers (2-5). An
`emerging approach to cancer screening involves the
`assay of tumor-specific DNA alterations in bodily fluids
`from cancer patients, such as stool, serum, and urine
`(6-15).
`It
`is important
`to select markers with high
`accuracy if efficiency and effectiveness are to be achieved
`in a cancer screening application. Due to the molecular
`heterogeneity of colorectal neoplasia, high detection rates
`will likely require a panel of markers.
`Several methylated genes have been detected in the
`stool and serum/plasma samples from colorectal cancer
`patients (8, 9, 11, 14, 16-20). Whereas some methylated
`genes have been found in a majority of colorectal cancers,
`the yield of bodily fluid – based assays remains subopti-
`mal (8-11, 13-20). It is unclear as to what extent biological
`or technical factors account for such observations.
`
`Received 6/7/07; revised 8/29/07; accepted 9/17/07.
`Grant support: Charles Oswald Foundation.
`The costs of publication of this article were defrayed in part by the payment of page
`charges. This article must therefore be hereby marked advertisement in accordance
`with 18 U.S.C. Section 1734 solely to indicate this fact.
`Requests for reprints: David A. Ahlquist, Division of Gastroenterology and
`Hepatology, Mayo Clinic, Rochester, MN 55905. Phone: 507-266-4338;
`Fax: 507-266-0350. E-mail: ahlquist.david@mayo.edu
`Copyright D 2007 American Association for Cancer Research.
`doi:10.1158/1055-9965.EPI-07-0518
`
`A subset of colorectal cancers exhibiting gene methyl-
`ation and associated with proximal tumor site has been
`described as the CpG island methylator phenotype
`(CIMP; refs. 21, 22). Reported prevalences of CIMP in
`colorectal cancer vary (21-28). CIMP has been associated
`with BRAF mutations and microsatellite instability
`(26-30), but the relationship to other gene alterations is
`less studied. The degree to which CIMP may influence
`tumor detection is incompletely understood.
`This study was designed to (a) evaluate high-yield
`methylated genes as candidate markers for screening
`colorectal neoplasia, (b) explore the effect of combining
`gene markers on detection sensitivity, and (c) examine
`the relationship of aberrant promoter methylation to the
`expression of bone morphogenetic protein 3 (BMP3), EYA2,
`aristaless-like homeobox-4 (ALX4), and vimentin genes.
`
`Materials and Methods
`
`Approval of this study was obtained from the Institu-
`tional Review Board of Mayo Foundation.
`
`Subjects. Two hundred and six colon tissues, includ-
`ing 74 cancers, 62 adenomas, and 70 normal colon epi-
`thelia, were collected at the Mayo Clinic and evaluated
`in two studies. Tissue study I comprised 104 tissues,
`including 43 cancers, 32 adenomas, and 29 normal
`epithelia. Tissue study II comprised 102 tissues, includ-
`ing 31 cancers, 30 adenomas, and 41 normal epithelia.
`Samples in study I included 22 frozen and 82 paraffin-
`embedded tissues; methylation markers were assayed
`
`Cancer Epidemiol Biomarkers Prev 2007;16(12). December 2007
`
`Downloaded from
`
`on March 5, 2016. © 2007 American Association for Cancercebp.aacrjournals.org
`
`
`Research.
`
`Geneoscopy Exhibit 1052, Page 1
`
`

`

`Cancer Epidemiology, Biomarkers & Prevention
`
`2687
`
`Table 1. Clinical characteristics of subjects
`
`No.
`
`Median age (range), y
`
`Sex (M/F)
`
`Location (proximal/distal)
`
`Dukes stage (A/B/C/D)
`
`Grade (1/2/3/4) or dysplasia (low/high)
`
`Study
`
`I
`II
`Total
`I
`II
`Total
`I
`II
`Total
`I
`II
`Total
`I
`II
`Total
`I
`II
`Total
`
`Cancer
`
`43
`31
`74
`66 (27-93)
`66 (34-90)
`66 (27-93)
`20/23
`17/14
`37/37
`21/22
`12/19
`33/41
`2/21/19/1
`6/9/15/1
`8/30/34/2
`1/10/28/4
`0/4/26/1
`1/14/54/5
`
`Adenoma
`
`32
`30
`62
`67 (42-87)
`65 (37-86)
`66 (37-87)
`17/15
`15/15
`32/30
`19/13
`18/12
`37/25
`
`25/7
`21/9
`46/16
`
`Normal
`
`29
`41
`70
`67 (22-84)
`65 (31-82)
`66 (22-84)
`13/16
`17/24
`30/40
`
`qualitatively. Samples in study II were all frozen, and
`markers were assayed quantitatively. The demographic
`and clinical characteristics of these subjects are shown in
`Table 1.
`
`Microdissection and DNA Extraction. Tissue sections
`were examined by a pathologist who circled out histo-
`logically distinct lesions to direct careful microdissection.
`Genomic DNA was extracted using Qiagen DNA minikit
`(Qiagen) or DNAzol (Invitrogen).
`
`Conventional Methylation-Specific PCR. DNA was
`bisulfite treated using the EZ DNA methylation kit
`(Zymo Research) and eluted in 30 AL of elution buffer.
`One microliter of bisulfite-modified DNA was amplified
`in a total volume of 25 AL containing 1 PCR buffer
`(Applied Biosystem), 1.5 mmol/L MgCl2, 200 Amol/L of
`each deoxynucleotide triphosphate, 400 nmol/L of each
`primer, and 1.25 unit of AmpliTaq Gold polymerase
`(Applied Biosystem). Amplification included hot start at
`95jC for 12 min, denaturing at 95jC for 30 s, annealing at
`certain temperatures for 30 s, extension at 72jC for 45 s
`for 35 cycles, and a final 10-min extension step at 72jC.
`Primer sequences and annealing temperatures were
`listed in Table 2, and primer locations were shown in
`Fig. 1. Bisulfite-treated human genomic DNA (Novagen)
`and CpGenomeTM universal methylated DNA (Chem-
`icon) were used as positive controls for unmethylation
`and methylation, respectively.
`
`Real-time Quantitative Methylation-Specific PCR.
`Bisulfite-treated DNA above was used as a template for
`methylation quantification with a fluorescence-based
`real-time PCR as described previously (31). Primers and
`probes were designed to target the bisulfite-modified
`methylated sequences of gene promoters (Fig. 1; Table 2).
`A region without CpG site in b-actin gene was also
`quantified with real-time PCR using primers and probe
`recognizing bisulfite-converted sequence as a reference
`of bisulfite treatment and DNA input (31). PCR reactions
`were done in a volume of 25 AL consisting of 600 nmol/L
`of each primer, 200 of nmol/L probe, 0.75 units of
`platinum Taq polymerase (Invitrogen), 200 Amol/L each
`of deoxynucleotide triphosphate, 16.6 mmol/L ammo-
`nium sulfate (Sigma), 67 mmol/L Trizma (Sigma),
`
`6.7 mmol/L MgCl2, 10 mmol/L mercaptoethanol, and
`0.1% DMSO. One microliter of bisulfite-treated DNA was
`used in each PCR reaction. The gene methylation level
`was defined as the ratio of the fluorescence emission
`intensity value of target gene PCR product to that of
`b-actin PCR product multiplied by 1,000 (31).
`Amplifications were done in 96-well plates in a real-
`time iCycler (Bio-Rad) under the following conditions:
`95jC for 2 min, followed by 45 cycles of 95jC for 10 s and
`62jC for 60 s. Bisulfite-treated CpGenomeTM universal
`methylated DNA (Chemicon) was used as positive
`control and serially diluted to create standard curve for
`all plates. Each plate consisted of bisulfite-treated DNA
`samples, positive and negative controls, and water
`blanks.
`
`Selection of Tumor-Specific Methylated Markers.
`Forty-one genes were analyzed with methylation-specific
`PCR (MSP). These genes consisted of seven candidates
`identified in colorectal cancer by our group, including
`EYA2, EYA3, BMP1, BMP2, BMP3, SIX2, and SIX6, and
`16 commonly methylated genes, including p16, hMLH1,
`MGMT, CDH1, HIC1, GSTP1, RASSF1A, RUNX1,
`SLC5A8, SFRP1, vimentin, EYA4, BMP3b, TPEF, GATA4,
`and GATA5 (refs. 9, 32-46), as well as 18 methylated
`genes reported recently in the SW480 colon cancer cell
`line, including ALX4, FOXF1, SHH, ZNF677, RASL11A,
`PAX6, ADAM12, KIAA0789, TGFB2, ZNF566, CDCA2,
`RPS27L, FLJ25439, TAZ, LOC283514, DAP, GATA3, and a
`predicted gene (47). Methylated primers for the common
`methylated genes were from the literature, and the rest
`were designed by us with at least four CpGs and four
`Cs on each primer to discriminate methylated DNA
`sequence from unmethylated and wild-type ones.
`The specificity of the primers to methylated sequence
`was first tested with bisulfite-treated universally meth-
`ylated DNA, unmethylated human genomic DNA, and
`wild-type human genomic DNA. Primers that only
`amplified bisulfite-treated universally methylated DNA
`were further triaged in an age-matched independent set
`of colon tissues, including four cancers and four normal
`mucosa. Four genes, BMP3, EYA2, ALX4, and vimentin,
`were found to be methylated in three or more of the
`cancers but in none of the normal tissues (Fig. 2); thus,
`
`Cancer Epidemiol Biomarkers Prev 2007;16(12). December 2007
`
`Downloaded from
`
`on March 5, 2016. © 2007 American Association for Cancercebp.aacrjournals.org
`
`
`Research.
`
`Geneoscopy Exhibit 1052, Page 2
`
`

`

`2688
`
`Highly Methylated Genes in Colorectal Neoplasia
`
`these four methylation markers were selected for more
`extensive evaluation in the present
`investigation as
`described above. Primers for BMP3, EYA2, ALX4, and
`vimentin were presented in Table 2, and primers for other
`genes are available upon request. The schematic graphs
`of the 5¶ regions of BMP3, EYA2, ALX4, and vimentin
`were shown in Fig. 1.
`
`Bisulfite Genomic Sequencing. Methylation status of
`representative samples was confirmed by bisulfite
`
`genomic sequencing using primers (Table 2) that flank
`the MSP and/or real-time MSP regions of BMP3, EYA2,
`ALX4, and vimentin (Fig. 1). One microliter of bisulfite-
`modified DNA was amplified in a total volume of
`25 AL containing 1 PCR buffer (Applied Biosystem),
`3.0 mmol/L MgCl2, 200 Amol/L of each deoxynucleotide
`triphosphate, 400 nmol/L of each primer, and 1.25 unit of
`AmpliTaq Gold polymerase (Applied Biosystem). Am-
`plification included 95jC for 10 min, denaturing at 95jC
`for 30 s, annealing at certain temperatures for 30 s,
`
`Table 2. Primers used in this study
`
`Gene
`
`Primer
`
`Primer sequence (5¶!3¶)
`
`Product
`size
`(bp)
`
`Annealing
`temperature
`(jC)
`
`Note*
`
`BMP3
`
`EYA2
`
`ALX4
`
`Unmethylated
`
`Methylated
`
`Real-time MSP
`
`Bisulfite sequencing
`
`RT-PCR
`
`Unmethylated
`
`Methylated
`
`Real-time MSP
`
`Bisulfite sequencing
`
`RT-PCR
`
`Unmethylated
`
`Methylated
`
`Real-time MSP
`
`Bisulfite sequencing
`
`RT-PCR
`
`TTTAGTGTTGGAGTGGAGATGGTGTTTG
`AAACACAACCAAATACAACAAAATAACAA
`TTTAGCGTTGGAGTGGAGACGGCGTTC
`CGCGACCGAATACAACGAAATAACGA
`AATATTCGGGTTATATACGTCGC
`CCTCACCCGCGCAAAACG
`6FAM-TAGCGTTGGAGTGGAGACGGCGTTCG-TAMRA
`GAGGAGGGAAGGTATAGATAGA
`AATTAAACTCCAAACCAACTAAAAC
`CCCAAGTCCTTTGATGCCTA
`TGGTACACAGCAAGGCTCAG
`GGGAGGAGAAGGGGTTGGTTTTTTTG
`CCTAAAATAAACACCACTAACAATACTCACCA
`TTTCGGCGTAGGTAGTAGTCGC
`GACCTAAAATAAACGCCGCTAACGA
`TTTTCGGCGTAGGTAGTAGTC
`GACGAAACCGAACTAACTACGA
`6FAM-CGGTAACGGTAGAGATAGTAACGTGTTC-TAMRA
`GGTTTAGGGAGGAGAAGGGGT
`CCTCTACCCTTATACCTTCCTAAC
`GGACAATGAGATTGAGCGTGT
`ATGTCCCCGTGAGTAAGGAGT
`TGTGTTTTTTATTGTGAGTTGTTGGTT
`ACAACAACAACTAAAACTACAAAATCAAC
`TGCGTTTTTTATTGCGAGTCGTCGGTC
`GACGACGACTAAAACTACGAAATCGACGA
`TTGTAGAGGTTTCGTTTTTCGTC
`GCCTAAATTTCCCGTAAACTTTCGA
`6FAM-CGTCGTCGTAGGTGAGAGCGTCGT-TAMRA
`GGATAGTAGGATTGTAGAGGT
`CTAAAACCCTAAAATCTCTAACTC
`AGACCCACTACCCAGACGTG
`GCCAGGACGGGTTCTGAAT
`TTGGTGGATTTTTTGTTGGTTGATG
`CACAACTTACCTTAACCCTTAAACTACTCA
`TCGTTTCGAGGTTTTCGCGTTAGAGAC
`CGACTAAAACTCGACCGACTCGCGA
`GTTTTAGTCGGAGTTACGTGATTAC
`GAAAACGAAACGTAAAAACTACGA
`6FAM-CGTATTTATAGTTTGGGCGACGCGTTGC-TAMRA
`GTAGTTATGTTTATTAGGTT
`CATTCAACTCCTACAACTC
`GGACCAGCTAACCAACGACA
`CTGGATTTCCTCTTCGTGGA
`Real-time bisulfite PCR TGGTGATGGAGGAGGTTTAGTAAGT
`AACCAATAAAACCTACTCCTCCCTTAA
`6FAM-ACCACCACCCAACACACAATAACAAACACA-TAMRA
`CATCACCATCTTCCAGGAGCG
`TGACCTTGCCCACAGCCTTG
`AAGGCCTGCTGAAAATGACTGAAT
`CTGTATCAAAGAATGGTCCTGCACC
`CCACAAAATGGATCCAGACA
`TGCTTGCTCTGATAGGAAAATG
`
`Vimentin Unmethylated
`
`Methylated
`
`Real-time MSP
`
`Bisulfite sequencing
`
`RT-PCR
`
`b-actin
`
`GAPDH RT-PCR
`
`K-ras
`
`BRAF
`
`PCR
`
`PCR
`
`146
`
`143
`
`87
`
`256
`
`147
`
`209
`
`190
`
`97
`
`370
`
`90
`
`295
`
`293
`
`132
`
`188
`
`222
`
`188
`
`216
`
`97
`
`342
`
`247
`
`Unknown
`
`442
`
`179
`
`173
`
`60
`
`68
`
`62
`
`60
`
`62
`
`60
`
`66
`
`62
`
`60
`
`60
`
`60
`
`68
`
`62
`
`60
`
`63
`
`60
`
`68
`
`62
`
`55
`
`60
`
`62
`
`60
`
`64
`
`60
`
`Ref. (57)
`
`Ref. (9)
`
`Ref. (31)
`
`Ref. (50)
`
`Abbreviation: GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
`*Oligos were designed by us except those with references.
`
`Cancer Epidemiol Biomarkers Prev 2007;16(12). December 2007
`
`Downloaded from
`
`on March 5, 2016. © 2007 American Association for Cancercebp.aacrjournals.org
`
`
`Research.
`
`Geneoscopy Exhibit 1052, Page 3
`
`

`

`Cancer Epidemiology, Biomarkers & Prevention
`
`2689
`
`Figure 1. Schematic graph of
`the 5¶ regions of BMP3, EYA2,
`ALX4, and vimentin genes. Ver-
`tical bars, CpG sites. Regions
`analyzed by MSP, quantitative
`MSP (qMSP), and bisulfite ge-
`nomic sequencing, and the start
`codons were indicated.
`
`extension at 72jC for 45 s for 40 cycles, and a final 10-min
`extension step. PCR products were cut
`from gels,
`purified using QIAquick gel extraction kit (Qiagen),
`and then ligated into pCR 2.1-TOPO cloning vector using
`a TOPO TA cloning kit (Invitrogen). For each cloning, six
`colonies were grown, extracted with Wizard Plus
`Minipreps DNA purification system (Promega), and
`then sequenced with ABI Prism 377 DNA sequencer
`(Perkin-Elmer) to get detailed methylation status of each
`CpG site.
`
`Mutation Detection. Mutations on K-ras at codons 12
`and 13 and on BRAF (V600E) were assayed by Sanger
`sequencing. Genomic DNA (100 ng) was amplified with
`primers flanking the mutant loci (Table 2). Five micro-
`liters of PCR products were incubated with 2 AL ExoSAP-
`IT (U.S. Biochemical Corporation) at 37jC for 30 min to
`get rid of residual deoxynucleotide triphosphates, pri-
`mers, and possible dimmers and then directly sequenced
`in an ABI Prism 377 DNA sequencer (Perkin-Elmer).
`
`Cell Lines and 5-Aza-Deoxycytidine Treatment. Five
`colon cancer cell lines, including SW480, SNUC4, HCT15,
`SW620, and WIDR, were used in this study. SW480,
`SW620, and WIDR were grown in DMEM supplemented
`with 10% fetal bovine serum, and SNUC4 and HCT15
`were grown in RPMI 1640 supplemented with 10% fetal
`bovine serum. These cells were split to low density in
`4-mL flasks, grown for 12 to 24 h, and then treated using
`5 Amol/L 5-aza-deoxycytidine or mock treated with PBS
`for 96 h. Medium containing 5-aza-deoxycytidine and
`with PBS was changed every 24 h. The dose and timing
`of 5-aza-deoxycytidine were based on prior tests show-
`ing optimal reactivation of gene expression and pub-
`lished studies (48, 49).
`
`Real-time Reverse Transcription – PCR. The mRNA
`expression of BMP3, EYA2, ALX4, and vimentin in these
`colon cancer cell lines with or without 5-aza-deoxycyti-
`dine treatment was quantified with real-time reverse
`transcription – PCR (RT-PCR). Briefly, RNA was
`extracted with RNeasy minikit (Qiagen). Reverse tran-
`scription was done on 2 Ag of total RNA using Omni-
`script RT kit (Qiagen). One microliter of cDNA was
`amplified in a real-time iCycler (Bio-Rad) using a
`
`reaction volume of 25 AL containing 1 iQ SYBR Green
`Supermix (Bio-Rad) and 200 nmol/L of each primer
`under the following conditions: 95jC for 3 min followed
`by 40 cycles of 95jC for 10 s and 60jC for 45 s. Primers
`for each gene were designed on different exons to
`
`Figure 2. Tumor-specific methylated gene markers selected for
`study. Among 41 candidate genes, BMP3, EYA2, ALX4, and
`vimentin were methylated in at
`least
`three of four of the
`colorectal cancers, but in none of four normal colon tissues
`screened. HIC1, TPEF, and FOXF1 as representative of less
`specific or less sensitive markers for comparison. Universally
`methylated DNA and water were amplified as positive control
`and negative control, respectively.
`
`Figure 3. Neoplasm-specific methylation of BMP3, EYA2,
`ALX4, and vimentin genes. Methylation status was determined
`by conventional MSP using methylation-specific primers.
`Representative tissues from normal colon epithelia, adenomas,
`and cancers. Universally methylated DNA and water were
`amplified as positive and negative controls, respectively.
`
`Cancer Epidemiol Biomarkers Prev 2007;16(12). December 2007
`
`Downloaded from
`
`on March 5, 2016. © 2007 American Association for Cancercebp.aacrjournals.org
`
`
`Research.
`
`Geneoscopy Exhibit 1052, Page 4
`
`

`

`2690
`
`Highly Methylated Genes in Colorectal Neoplasia
`
`Table 3. Gene methylation associated with tumor location in cancer subjects
`
`Study
`
`Study I
`
`Study II
`
`Gene
`
`BMP3
`
`EYA2
`
`ALX4
`
`Vimentin
`
`BMP3
`
`EYA2
`
`ALX4
`
`Vimentin
`
`Location
`
`Proximal
`Distal
`Proximal
`Distal
`Proximal
`Distal
`Proximal
`Distal
`Proximal
`Distal
`Proximal
`Distal
`Proximal
`Distal
`Proximal
`Distal
`
`Methylation rate or level (median; range)
`
`90% (19 of 21)
`32% (7 of 22)
`71% (15 of 21)
`32% (7 of 22)
`95% (20 of 21)
`55% (12 of 22)
`95% (20 of 21)
`59% (13 of 22)
`34 (0-628)
`1 (0-302
`155 (0-1082)
`2 (0-360)
`458 (17-1182)
`25 (0-379)
`418 (0-1055)
`10 (0-276)
`
`P
`
`0.0002
`
`0.02
`
`0.004
`
`0.01
`
`0.01
`
`0.03
`
`0.002
`
`0.005
`
`Figure 4. Methylation
`levels of BMP3, EYA2,
`ALX4, and vimentin mea-
`sured by quantitative real-
`time MSP in colorectal
`cancer, adenoma, and nor-
`mal epithelia. Each dot re-
`resents a sample.
`
`Cancer Epidemiol Biomarkers Prev 2007;16(12). December 2007
`
`Downloaded from
`
`on March 5, 2016. © 2007 American Association for Cancercebp.aacrjournals.org
`
`
`Research.
`
`Geneoscopy Exhibit 1052, Page 5
`
`

`

`Cancer Epidemiology, Biomarkers & Prevention
`
`2691
`
`guarantee specific amplification of cDNA (Table 2).
`Glyceraldehyde-3-phosphate dehydrogenase was used
`as an internal reference gene for normalizing the cDNA
`input (50). The mRNA expression ratios of the four genes
`were defined as the ratio fluorescence emission intensity
`value of target gene PCR products to that of b-actin PCR
`products multiplied by 1,000. Amplification was done in
`96-well plates. Each plate consisted of cDNA samples
`and multiple water blanks, as well as positive and
`negative controls. Each assay was done in duplicate.
`
`Serial dilutions of positive controls were used to make
`standard curves for each plate. Melt curve was con-
`ducted for each reaction to guarantee that only one
`identical product was amplified, and the PCR products
`were further confirmed by agarose gel electrophoresis.
`
`Statistical Analysis. m2 test was used to compare gene
`methylation frequencies between each of
`the three
`different tissue groups in study I, and Fisher exact test
`was used to analyze the association of gene methylation
`
`Figure 5. A, receiver operating curves for gene methylation levels in colorectal cancers or adenomas versus normal controls. For
`cancers versus normal controls, AUC values were 0.85, 0.9, 0.89, and 0.88 for BMP3, EYA2, ALX4, and vimentin, respectively; for
`adenomas versus normal controls, AUC values were 0.87, 0.79, 0.93, and 0.89 for BMP3, EYA2, ALX4, and vimentin, respectively. B,
`predicted receiver operating curves of best combinations of methylated markers in cancers or adenomas versus normal controls. AUC
`values were 0.92 for the predicted combination (BMP3, EYA2, and ALX4) in cancers and 0.94 for the predicted combination (ALX4,
`BMP3, and vimentin) in adenomas, which are not significantly higher than with single markers.
`
`Cancer Epidemiol Biomarkers Prev 2007;16(12). December 2007
`
`Downloaded from
`
`on March 5, 2016. © 2007 American Association for Cancercebp.aacrjournals.org
`
`
`Research.
`
`Geneoscopy Exhibit 1052, Page 6
`
`

`

`2692
`
`Highly Methylated Genes in Colorectal Neoplasia
`
`Figure 6. Methylation
`status of
`representative
`colon tissues confirmed
`by bisulfite genomic se-
`quencing. The analyzed
`regions of the four CpG
`islands evaluated with
`the methylation status of
`each. Six clones were
`sequenced for each sam-
`ple. Closed circles, meth-
`ylated CpGs; open circles,
`unmethylated CpGs.
`
`frequencies with clinical characteristics of tumor patients
`in study I. Wilcoxon rank-sum test was used to compare
`the methylation levels between each of the three different
`tissue groups and evaluate the association of methylation
`levels with tumor location, gender, Dukes stage, and
`differentiation grade in study II. Correlation of methyl-
`ation levels with tumor size and patient age in study II
`was calculated with logistic procedure. Receiver operat-
`ing curve was constructed to compare methylation level
`in cancers or adenomas versus normal subjects for each
`of the four markers and their combinations in study II,
`and area under the curve (AUC) value was also
`calculated for each curve. The association of gene
`comethylation with clinical characteristics of
`tumor
`patients and K-ras or BRAF mutations were calculated
`with m2 test. Statistical analysis was conducted with SAS
`software (SAS Institute).
`
`Results
`
`Methylation of BMP3, EYA2, ALX4, and Vimentin
`Genes in Colorectal Tumors. From a total of 41
`candidates, four genes (BMP3, EYA2, ALX4, and vimentin)
`were found to be methylated in at least three of four colon
`cancers but in none of four normal colon epithelia on
`prestudy triage. Methylation of these four selected genes
`was evaluated more comprehensively in this investigation
`in two tissue studies.
`In tissue study I, using conventional MSP, methylation
`of BMP3, EYA2, ALX4, and vimentin was detected in
`60%, 51%, 74%, and 77% of 43 cancers; 72%, 44%, 91%,
`and 91% of 32 adenomas; and 7%, 3%, 17%, and 17% of
`29 normal mucosa samples, respectively. Methylation
`was more frequently detected in cancer or adenoma than
`in normal epithelia for each of the four genes (P < 0.01;
`Fig. 3). Methylation was significantly more frequent in
`cancer from proximal colon than from distal colon for
`BMP3, EYA2, ALX4, and vimentin (P < 0.05; Table 3), but
`not associated with age, sex, tumor size, Dukes stage, or
`grade for any of the four genes (P > 0.05). Methylation in
`adenomas was not associated with age, sex, tumor size,
`degree of dysplasia, or villous component (P > 0.05).
`
`In tissue study II, methylation levels were quantified
`using quantitative MSP. Mean methylation levels in
`31 cancers, 30 adenomas, and 41 normal colon epithelia
`were observed respectively as follows (Fig. 4): 116 (0-628),
`189 (0-712), and 0.3 (0-8.2) for BMP3; 158 (0-1082), 167
`for EYA2; 230 (0-1182), 335
`(0-1066), and 1.5 (0-51)
`(0-868), and 10.1 (0-113) for ALX4; and 193 (0-1055),
`258 (0-955), and 5.0 (0-144) for vimentin. Methylation
`levels were significantly higher in cancer or adenoma
`than in normal epithelium for each of the four genes
`(P < 0.01 for each gene) but were comparable between
`cancer and adenoma for each gene after stratification
`by tumor location (P > 0.05 for each gene). Methylation
`levels were significantly higher in cancers from the
`proximal colon than from the distal colon for all four
`genes (P < 0.05; Table 3) but higher in adenomas from
`proximal colon than from distal colon for ALX4 only
`(P = 0.02). Methylation levels in cancers correlated with
`larger size for ALX4 only (P = 0.004) but were not
`associated with age, sex, Dukes stage, and grade for any
`of the four genes (P > 0.05). Methylation levels of
`adenomas correlated with larger size for BMP3 only
`(P = 0.04) and with older age for vimentin only (P = 0.04)
`but not with other clinical characteristics, including sex,
`degree of dysplasia, and villous component, for any of
`the four genes (P > 0.05).
`For quantitative data obtained in study II, receiver
`operating curves were constructed for each of the four
`genes (Fig. 5). Comparing cancer to normal epithelia,
`AUC values were 0.85, 0.9, 0.89, and 0.88 for BMP3,
`EYA2, ALX4, and vimentin, respectively (Fig. 5A);
`comparing adenoma to normal epithelia, AUC values
`were 0.87, 0.79, 0.93, and 0.89 for BMP3, EYA2, ALX4,
`and vimentin, respectively (Fig. 5A). AUC value was not
`significantly improved by combining any or all markers
`compared with the best single marker (P > 0.05; Fig. 5B).
`At a specificity of 93%, methylation of BMP3, EYA2,
`ALX4, and vimentin detected 74%, 87%, 58%, and 65% of
`31 cancers and 77%, 53%, 93%, and 77% of 30 adenomas.
`Combining studies I and II, methylation of BMP3,
`EYA2, ALX4, and vimentin was detected in 66%, 66%,
`68%, and 72% of 74 cancers; 74%, 48%, 89%, and 84% of
`62 adenomas; and 7%, 5%, 11%, and 11% of 70 normal
`
`Cancer Epidemiol Biomarkers Prev 2007;16(12). December 2007
`
`Downloaded from
`
`on March 5, 2016. © 2007 American Association for Cancercebp.aacrjournals.org
`
`
`Research.
`
`Geneoscopy Exhibit 1052, Page 7
`
`

`

`epithelia, respectively (P < 0.01, cancer or adenoma
`versus normal for each gene).
`Using representative samples, bisulfite genomic se-
`quencing confirmed that these four genes are densely
`methylated in cancer and adenoma but rarely or not
`methylated in normal colon mucosa (Fig. 6).
`
`Comethylation in Colorectal Tumors. BMP3, EYA2,
`ALX4, and vimentin genes were commonly comethylated
`in colorectal neoplasms, and the subset of subjects with
`neoplasms showing comethylation shared certain char-
`acteristics. Methylation levels in study II were dichoto-
`mized to simplify panel assembly and to allow easier
`
`Figure 7. Heat maps demonstrating relationship of specific
`gene methylation, K-ras and BRAF mutations, and categoriza-
`tion as CIMP in colorectal cancer and adenoma. Red bars,
`methylated samples for the corresponding gene. The methyl-
`ation levels across all cancer or adenoma samples are indicated
`from low to high using a long bar with increasing depth of red
`color. Blue bars, BRAF and K-ras mutations.
`
`Cancer Epidemiology, Biomarkers & Prevention
`
`2693
`
`translation of quantitative to qualitative panels as ob-
`tained in study I (27). The dichotomization threshold at a
`methylation level of 10 was chosen as a point sufficiently
`above background levels measured with quantitative
`MSP but well below the much higher levels for the four
`markers in both colorectal cancers and adenomas (27).
`Methylation of one or more of four (at least one), two or
`more of four, three or more of four, or four of four genes
`was noted in 88%, 72%, 53%, and 41% of 74 cancers
`(Fig. 7; Table 4) and 98%, 84%, 60%, and 39% of 62
`adenomas (Fig. 7; Table 5) compared with 24%, 7%, 3%,
`and 0% of 70 normal epithelia, respectively. Thus,
`comethylation is much more common in neoplasia than
`in normal epithelia, and comethylation is associated,
`progressively so with increasing specificity but decreas-
`ing sensitivity for colorectal neoplasia. Comethylation of
`two or more of four and three or more of four genes in
`cancer was significantly associated with older age
`(P < 0.05) and proximal colon location (P V 0.001) but
`not with other clinical characteristics (Table 4); comet-
`hylation of four of four genes in cancer was associated
`location only (P = 0.0004; Table 4).
`with proximal
`Comethylation of two or more of four and three or more
`of four genes in adenoma was significantly associated
`location (P < 0.01; Table 5), and
`with proximal
`comethylation of four of four genes in adenoma was
`associated with older age (P = 0.008; Table 5).
`
`Association of BRAF and K-ras Mutations with
`Tumor Methylation. BRAF V600E and K-ras codons 12
`and 13 mutations were found in 20% (15 of 74) and 27%
`(20 of 74) of cancers and were mutually exclusive. All
`BRAF and K-ras mutations occurred in tumors exhibiting
`methylation in at least one of the four study genes, and
`addition of neither BRAF nor K-ras mutations improved
`sensitivity over the most informative methylation marker
`alone. BRAF was strongly associated with gene comet-
`hylation; each of the 15 cancers with BRAF mutations
`also showed methylation in all four study genes (odds
`8; Fig. 7; Table 4). Most cancers (19 of
`20) with mutant K-ras also showed methylation of two or
`more genes (odds ratio, 11.2; P = 0.007; Fig. 7; Table 4),
`but this association was not apparent when tumors were
`dichotomized into those with all four genes methylated
`and those with less than four genes (Fig. 7; Table 4).
`
`ratio, 1; P = 9  10
`
`Re-expression of Methylated Genes in Colon Cancer
`Cell Lines by Demethylation. In SNUC4, HCT15, and
`WIDR cell
`lines, all
`four genes were found to be
`methylated;
`in the SW620 cell
`line, methylation was
`found in BMP3 and ALX4 genes; and in the SW480
`cell line, only the ALX4 gene was methylated (Fig. 8).
`Suppression of mRNA expression in these genes was
`generally observed in the methylated cell lines without
`5-aza-deoxycytidine treatment. With the 5-aza-deoxycy-
`tidine treatment, BMP3 mRNA was re-expressed from an
`undetectable level in HCT15 and increased by 22-fold,
`26-fold, or 3225-fold in SNUC4, SW620, and WIDR cell
`lines, respectively. No changes in mRNA expression of
`BMP3 were observed in the unmethylated cell SW480.
`EYA2 mRNA was increased or re-expressed by 5-aza-
`deoxycytidine in methylated cell lines SNUC4 and WIDR
`line SW620. ALX4
`but also in an unmethylated cell
`mRNA was re-expressed from an undetectable level in
`four of five methylated cancer cells, SNUC4, HCT15,
`
`Cancer Epidemiol Biomarkers Prev 2007;16(12). December 2007
`
`Downloaded from
`
`on March 5, 2016. © 2007 American Association for Cancercebp.aacrjournals.org
`
`
`Research.
`
`Geneoscopy Exhibit 1052, Page 8
`
`

`

`2694
`
`Highly Methylated Genes in Colorectal Neoplasia
`
`Table 4. The association of gene comethylation with clinical variables and gene mutations in cancer subjects
`Comethylated genes z2
`Comethylated genes z3
`
`
`
`+
`
`P
`
`+
`
`P
`
`Comethylated genes = 4
`
`
`P
`
`+
`
`Total
`Age
`
`Sex
`
`Location
`
`Dukes stage
`
`Grade
`
`BRAF
`
`K-ras
`
`V60 y
`>60 y
`Male
`Female
`Proximal
`Distal
`A/B
`C/D
`1/2
`3/4
`Mutant
`Wild-type
`Mutant
`Wild-type
`
`53
`12
`41
`25
`28
`31
`22
`27
`26
`12
`41
`15
`38
`19
`34
`
`21
`11
`10
`12
`9
`2
`19
`11
`10
`3
`18
`0
`21
`1
`20
`
`0.01
`
`0.4
`
`0.0002
`
`0.9
`
`0.5
`
`0.006
`
`0.007
`
`39
`8
`31
`17
`22
`28
`11
`16
`23
`8
`31
`15
`24
`15
`24
`
`35
`15
`20
`20
`15
`5
`30
`22
`13
`7
`28
`0
`35
`5
`30
`
`0.04
`
`0.2
`
`6  10
`7
`
`0.06
`
`1.0
`
`1  10
`5
`
`0.02
`
`30
`6
`24
`12
`18
`21
`9
`11
`19
`5
`25
`15
`15
`8
`22
`
`44
`17
`27
`25
`19
`12
`32
`27
`17
`10
`34
`0
`44
`12
`32
`
`0.09
`
`0.2
`
`0.0004
`
`0.04
`
`0.5
`
`9  10
`8
`
`1.0
`
`SW620, and WIDR; vimentin mRNA expression was
`increased by 8-fold, 147-fold, and 346-fold, respectively,
`in the methylated cells SNUC4, HCT15, and WIDR, but
`only slightly changed in the unmethylated cells SW480
`and SW620 (Table 6).
`
`Discussion
`
`Methylated genes have been detected in the blood and
`stool of patients with colorectal cancer and proposed as
`candidate screening markers (8, 9, 11, 14-20). In this
`study, we found four genes, BMP3, EYA2, ALX4, and
`vimentin,
`to be methylated in the majority of both
`colorectal cancers and premalignant adenomas. As these
`methylated gene markers were rarely found in normal
`epithelia,
`their methylation seems to be neoplasm
`specific or cancer related (type C; ref. 51). Each of these
`candidate markers can be considered for further evalu-
`ation in screening or diagnostic applications for colorec-
`tal neoplasia because of their broad coverage and early
`onset in the tumorigenesis of colorectal cancer.
`Of note, the four methylation markers evaluated in the
`current study were found in the same subset of neo-
`plasms and were associated with certain clinical features
`and genetic alterations. Comethylation of these markers
`was particularly associated with BRAF mutations,
`proximal colon location, and older age, which is
`consistent with the previou