Cancer Letters 253 (2007) 258–264
`
`www.elsevier.com/locate/canlet
`
`Detecting K-ras mutations in stool from fecal occult blood
`test cards in multiphasic screening for colorectal cancer
`
`Gad Rennert a,b,*, Dimitry Kislitsin c, Dean E. Brenner d,e,
`Hedy S. Rennert a,b, Zeev Lev c
`
`a Department of Community Medicine and Epidemiology, CHS National Cancer Control Center,
`Carmel Medical Center, Technion, Haifa 34362, Israel
`b B. Rappaport Faculty of Medicine, Technion, Haifa 34362, Israel
`c Department of Biology, Israel Institute of Technology – Technion, Haifa, Israel
`d Departments of Internal Medicine and Pharmacology, University of Michigan Medical School, Ann Arbor, MI, USA
`e VA Medical Center, Ann Arbor, MI, USA
`
`Received 28 December 2006; received in revised form 30 January 2007; accepted 31 January 2007
`
`Abstract
`
`Fecal occult blood testing (FOBT) is proven an efficient way of reducing mortality from colorectal cancer but has a
`relatively low positive predictive value (PPV). This study evaluated the ability to detect K-ras mutations in stool DNA
`from FOBT cards and to improve the PPV of the screening process. Two hundred and five consecutive positive FOBT
`cards and an arbitrary sample of 38 negative cards from a population-based screening program were included. K-ras muta-
`tions in FOBT card stool were sought using allele-specific hybridization. DNA was successfully amplified from 87.2% of
`cards. In 130 cases with positive FOBT and amplifiable DNA 23 malignancies and 25 adenomas were detected. In 34.8% of
`the malignancies, a mutation in K-ras was detected. The PPV for malignancies increased from 17.7% (all positive cards) to
`60.0% if cards with four or more fields were positive and K-ras was positive (RR = 2.66, 95% CI: 1.2–6.1). Testing for K-
`ras mutations in DNA extracted from stool from positive FOBT cards is feasible. Sequential detection of cancer-associated
`genetic markers from FOBT-based stool samples may potentially help separate true from false positives in a FOBT-based
`screening process.
`Ó 2007 Elsevier Ireland Ltd. All rights reserved.
`
`Keywords: Colorectal cancer; Screening; Molecular testing; Fecal occult blood tests (FOBT); K-ras; Positive predictive value (PPV)
`
`* Corresponding author. Address: Department of Community
`Medicine and Epidemiology, CHS National Cancer Control
`Center, Carmel Medical Center, Technion, Haifa 34362, Israel.
`Tel.: +972 4 825 0474; fax: +972 4 834 4358.
`E-mail address: rennert@tx.technion.ac.il (G. Rennert).
`
`1. Introduction
`
`Three randomized controlled trials have been
`conducted over the last 30 years to evaluate the con-
`tribution of periodic screening with fecal occult
`blood tests (FOBT) to the reduction in mortality
`of colorectal cancer in the studied population [1–
`5]. The results of these studies demonstrate signifi-
`
`0304-3835/$ - see front matter Ó 2007 Elsevier Ireland Ltd. All rights reserved.
`doi:10.1016/j.canlet.2007.01.023
`
`Geneoscopy Exhibit 1040, Page 1
`
`

`

`G. Rennert et al. / Cancer Letters 253 (2007) 258–264
`
`259
`
`cant reduction in mortality with biennial as well as
`annual testing after 8–18 years of follow-up. Yet,
`despite the cost effectiveness of this screening tool,
`these tests carry a high false positive rate resulting
`in the need for many unnecessary colonoscopies.
`To improve upon FOBT,
`stool-based tests
`detecting common colorectal neoplasia-associated
`DNA mutations were developed by Sidransky
`et al. [6], refined by Jen et al. [7] and subsequently
`validated in a prospective screening clinical trial
`[8]. The DNA-based diagnostic panel enhanced
`diagnostic sensitivity for colorectal adenocarcinoma
`but not
`for colorectal adenoma [8]. If applied
`sequentially, stool DNA testing might improve the
`differentiation of true positive from false positive
`FOBT results, thus increasing the positive predictive
`value of the FOB test.
`This study was designed to test the feasibility of
`extracting, of amplifying, and of detecting normal
`and mutated K-ras DNA from stool samples that
`were submitted on guaiac-positive and guaiac-nega-
`tive FOBT cards.
`
`2. Materials and methods
`
`2.1. Study population
`
`The National FOBT Screening Program for Colorectal
`Cancer of Clalit Health Services in Israel (CHS, a non-
`profit HMO-type organization covering more than 70%
`of the Israeli older population), served as the source of
`FOBT cards for this study. The Screening Program invites
`all women and men, aged 50–74, members of CHS to have
`an annual, free-of-charge, FOBT. Of 5000 cards screened,
`205 consecutive positive (traces or any positive field)
`FOBT cards and 38 arbitrarily assigned negative FOBT
`cards were included in this study. The study was approved
`by the IRB Committee of Carmel Medical Center.
`
`2.2. FOBT screening process
`
`Following suggested diet and medication restriction,
`subjects applied feces to two windows on a Hemoccult
`Sensa test card (Beckman Coulter Inc.) on each of three
`consecutive days for a total of six test windows). The card
`was then mailed to the CHS National Cancer Control
`Center laboratories in a pre-paid, pre-addressed envelope
`supplied as part of the FOBT kit to each subject. In order
`to eliminate peroxidases from dietary vegetables and fruits
`known to be responsible for false positive test results [9],
`the cards were not processed earlier than a week from first
`stool application. The test was analyzed by applying the
`supplied developing solution (a stabilized mixture of less
`than 4.2% hydrogen peroxide and 80% denatured ethyl
`
`alcohol and enhancer in an aqueous solution) in a single
`laboratory. A test was called positive if at least one of
`the six tested fields showed the typical color change fol-
`lowing the guaiac reaction.
`
`2.3. Laboratory methods
`
`2.3.1. DNA extraction
`After development for the guaiac reaction, FOBT
`cards were kept dry at 20 °C until DNA isolation. Stool
`samples were then excised from all six windows of the
`FOBT cards and agitated overnight in 5 ml preservation
`solution containing
`1.2 M guanidium thiocyanate,
`100 mM sodium acetate, pH 5.2, 0.5% Triton X-100.
`The next morning, the samples in the preservation solu-
`tion were extracted briefly with 3 ml of chloroform:iso-
`propanol (94/6, v/v) and then centrifuged at 8000g for
`10 min at room temperature. The top 4 ml were then
`diluted with an equal amount of 6 M guanidium hydro-
`chloride. DNA purification resin (Promega) was added
`and the mix was applied onto a vacuum column. The resin
`was washed twice with total 6 ml Wash-1 solution (40%
`isopropanol, 3 M guanidium hydrochloride, 50 mM NaO-
`Ac, pH 5.2) and then twice with a total of 6 ml Wash-2
`solution (60% ethanol, 100 mM sodium acetate, pH 5.2).
`The DNA was eluted with 100 ll of 10 mM Tris–hydro-
`chloride, pH 7.6. Approximately 200 mg of stool was nor-
`mally available from the six card-windows of stool, with a
`varying yield between 100 and 1000 ng of apparently
`mixed bacterial and human DNA.
`
`2.3.2. K-ras mutation analysis
`After extracting DNA from the stool samples the first
`exon of K-ras was amplified by PCR. Primers used were:
`Ki-ras 11 primer aggaattcatgactgaatataaacttgt; Ki-ras 12
`primer atcgaattcctctattgttggatcatatcc. Five to ten microli-
`ters of DNA purified from feces (10–100 ng) was added to
`50 ll of PCR mix containing PCR-buffer, 200 lM dNTP,
`1 lM of Ki-ras 11 and Ki-ras 12 primers. The mix was
`heated up to 80 °C for 1 min. One and half units of Taq
`polymerase was added. The tubes were sealed and reac-
`tion continued for 60 cycles as follows: 56 °C for 30 s,
`72 °C for 15 s, 94 °C for 15 s. Samples were spotted on
`nylon membrane (Hybond-N, Amersham or Gene Screen,
`NEN). Thirty microliters PCR product was diluted with
`150 ll of 0.15 N sodium hydroxide and allowed to melt
`for 20 min at room temperature. Two hundred microliters
`of 0.5 M phosphate buffer (pH 7) was added into each
`well of a dot apparatus, and 12–15 ll of a DNA sample
`in alkali were transferred into each of the wells before
`the vacuum was applied. DNA was fixed with UV cross-
`linking (1200 mW/cm2).
`Probe labeling for point mutation detection were
`labeled by a primer extension approach. A short template
`was designed that complements the nine last nucleotides
`of the 30-end of the allele-specific oligodendronucleotide
`
`Geneoscopy Exhibit 1040, Page 2
`
`

`

`260
`
`G. Rennert et al. / Cancer Letters 253 (2007) 258–264
`
`(ASO) probe detailed below, plus three extending thymi-
`dine triphosphate nucleotides at its 50-end, 12 nucleotides
`in total. After annealing, Klenow DNA polymerase is
`added in the presence of [32P]-deoxyadenine triphosphate,
`and the ASO probe is labeled by extension upon the tem-
`plate. In this way the final product is the ASO probe con-
`taining three labeled dAs at its 30-end. Dotted nylon
`sheets had been incubated in 20–30 ml of hybridization
`solution containing 100 mg/ml of herring sperm DNA
`and 200 pmol of normal sequence competitor oligo for
`1 h before the labeled probe was added. Blots were rou-
`tinely hybridized overnight at 56–59 °C. Hybridized filters
`were briefly washed 2–3 times with a washing solution
`containing 3· SSC and 0.2% SDS at room temperature,
`and washed 3–4 times (each time for 15 min) with a wash-
`ing solution pre-warmed to 50 °C. The washed filters were
`briefly air-dried and exposed to the Phosphoimager plate
`for 1–3 h.
`Mutations were detected by ASO hybridization. Two
`copies of each membrane were prepared: one hybridized
`with a general probe from outside the mutated region
`detecting any amplified K-ras DNA. The second mem-
`brane was hybridized with an ASO probe. Since most of
`the mutations in codons 12 and 13 in the Israeli popula-
`tion are found in four out of 12 possible mutations [10],
`we used only four different ASO probes, representing
`86% of the available mutations, as follows: codon12,
`AGT cctacgccactagctcca; codon12, GAT cctacgccatcag
`ctcca;
`codon12, GTT cctacgccaacagctcca;
`codon13,
`GAC cctacgtcaccagctcca; competitor oligo, cctacgccaccag
`ctcca; tailer, ttttggagctgg.
`
`2.3.3. Signal evaluation
`Due to some background expected with normal
`sequence, a strong signal may be obtained from either
`the presence of mutated sequences or the presence of high
`amount of normal sequences. Also, the efficiency of the
`different probes was variable. Accordingly, the signals
`on a given membrane were divided by eye into three levels
`of intensity: background (the majority of signals), weak
`(slightly above background), and strong (significantly
`above weak). A signal was considered positive if it was
`in the strong class of signals, and if it was not highly
`strong with the general probe.
`
`2.4. Follow-up
`
`All screened positive cases were referred to primary
`care physicians and appropriate subspecialists. Recom-
`mended evaluation of a positive case was either a full
`colonoscopy or a flexible sigmoidoscopy with a double
`contrast barium enema. Post-evaluation findings were
`coded as: (a) no neoplasia (e.g. hemorrhoid, diverticulosis,
`inflammatory bowel disease, gastritis), (b) hyperplastic
`polyp (non-neoplastic), (c) adenomas, of all types (tubu-
`lar, tubulo-villous, villous), (d) invasive neoplasm. The
`
`rest of the cards were summarized as no finding (or false
`positives). Evaluation of the upper GI tract was not man-
`datory in cases with positive occult blood and no findings
`from colonoscopy.
`
`2.5. Statistical analysis
`
`Positive predictive value (and 95% confidence intervals)
`of the addition of K-ras results to a positive FOBT was cal-
`culated by dividing the number of cases with a positive
`FOBT result in which a pathological finding was found in
`follow-up by the total number of positive FOBT. This
`was done separately for each type of pathologic finding in
`follow-up. The analysis was performed separately for (a)
`any FOBT positivity and (b) FOB finding of four or more
`positive fields (out of six). The later was shown to carry a
`much higher probability of cancer [11]. No measures of sen-
`sitivity or specificity were calculated because this pilot study
`evaluated only K-ras performance as a sequential adjunct
`to the guaiac test results. The K-ras outcome is not intended
`to be interpreted independently.
`
`3. Results
`
`3.1. Feasibility
`
`Of the 243 FOBT cards included in this study, 205
`(84.4%) tested positive and 38 (15.6%) tested negative.
`Two hundred and twelve of the 243 (180 positive and 32
`negative) samples (87.2%) were successfully amplified.
`Most of the unamplified samples had insufficient stool
`mass resulting in insufficient DNA recovery for amplifica-
`tion. Amplification failures were not dependent upon the
`FOBT reaction (non-amplified, negative FOBT cards (6/
`38, 15.8%); non-amplified positive FOBT cards (25/205,
`12.2%) p = 0.6 (Fig. 1). Mutations in K-ras were found
`in 48 amplified samples; 39 among 180 positive FOBT
`amplified samples (21.7%) and 9 among 32 negative
`FOBT amplified samples (28.1%) p = 0.42.
`
`3.2. Follow-up evaluation
`
`Follow-up on cases with positive FOBT was complete
`in 130 of the 180 positive amplified samples (72.2%).
`Among these, 23 malignancies in the colon and rectum,
`25 adenomatous polyps and 14 hyperplastic polyps were
`detected. Among the 50 amplified samples with positive
`FOBT who did not have an evaluation procedure, 31
`cases (62.0%) had one positive FOBT field and 11 cases
`(22.0%) had two positive fields. The main reasons for
`incomplete follow-up were, in equal proportions, patient
`refusal, and primary care physician decision not to pro-
`ceed. This was most commonly the case when only one
`positive field was found. After a median of 6 years fol-
`low-up, no colorectal cancer cases were detected among
`
`Geneoscopy Exhibit 1040, Page 3
`
`

`

`G. Rennert et al. / Cancer Letters 253 (2007) 258–264
`
`261
`
`243 FOBT cards (out of 5000 screening tests)
`
`FOBT results negative
`
`positive
`
` 38
`
` 205
`
`Amplification no yes
`
`no
`
`yes
`
` 6 32 25 180
`
`K-ras
`
`mutation
`
`no mutation mutation
`
`no mutation
`
`
`
` 9
`
` 23 39 141
`
`Follow-up
`
`no yes no
`
`yes
`
` 7 32 43 98
`
` 130 cards included
`
`Fig. 1. K-ras in stool from FOBT cards study flow chart.
`
`hemoccult-negative subjects. Four more cancers were
`detected 3–5 years after the index-positive FOBT in cases
`with either no findings or adenomas only in colonoscopy.
`The proportion of K-ras positive tests differed between
`cases with positive and negative FOBT, and by the type of
`finding in follow up (p = 0.07) (Table 1). No differences
`were noted in the distribution of the specific K-ras muta-
`tions between the different diagnostic groups. AGT was
`the most commonly identified K-ras mutation and was
`noted in 50% of the mutated stools of cases with or with-
`out tumor findings.
`
`3.3. Impact of adding K-ras detection upon FOBT detection
`of colorectal neoplasia
`
`The positive predictive value for cancer diagnosis of
`the combined test (FOBT + K-ras) approximately dou-
`bled that of a single FOBT measure. For adenomas, K-
`ras improved FOBT’s positive predictive value when the
`FOBT tested positive in less then four of the six test slides.
`Such a situation is common because adenomas usually
`bleed less. The positive predictive value of FOBT in four
`or more fields reached 60% (positive/negative cards
`
`Geneoscopy Exhibit 1040, Page 4
`
`

`

`262
`
`G. Rennert et al. / Cancer Letters 253 (2007) 258–264
`
`Table 1
`Proportion of K-ras positivity in stool from positive FOBT cards with amplified DNA, by type of finding in the colon
`
`Finding in colon
`
`Number of cases with positive
`FOBT and DNA amplification
`
`Number of cases
`with K-ras mutation
`
`Proportion of K-ras
`positivity (%)
`
`Carcinoma + adenoma
`Adenocarcinoma
`Adenoma
`
`48
`
`23
`25
`
`16
`
`8
`8
`
`All othera
`82
`16
`No follow-up
`50
`7
`Total positive FOBT
`180
`39
`a Includes non-adenomatous polyps, diverticuli, IBD, hemorrhoids, and upper GI findings.
`
`34.8
`32.0
`
`33.0
`
`19.5
`14.0
`21.7
`
`Table 2
`Positive predictive values of FOBT alone or in combination with stool K-ras results, for the detection of malignancies, adenomas, any
`tumors or benign non-neoplastic findings in the colon
`
`Findings in colon
`
`Any FOBT+
`
`FOBT+ >4 fields
`
`Any K-ras+ In FOBT+
`
`FOBT >4 + K-ras+
`
`130
`
`41
`
`32
`
`10
`
`8
`25.0% (7.3–42.7)
`
`8
`25.0% (8.0–42.0)
`
`17
`53.1% (40.7–65.5)
`
`9
`28.1% (15.1–41.1)
`
`6
`18.8%
`
`6
`60.0% (40.0–80.0)
`
`2
`20.0% (4.3–35.7)
`
`8
`80.0% (70.0–90.0)
`
`1
`10.0% (1.3–18.7)
`
`1
`10.0%
`
`N
`
`Adenocarcinoma
`PPV
`
`Adenoma
`PPV
`
`All neoplasmsa
`PPV
`
`No-neoplastic GI diseaseb
`PPV
`
`23
`17.7% (2.1–33.3)
`
`25
`19.2% (3.8–34.7)
`
`62
`47.7% (35.3–60.1)
`
`46
`35.4% (21.6–49.2)
`
`13
`31.7% (12.7–50.7)
`
`9
`22.0% (5.7–38.2)
`
`25
`61.0% (48.8–73.1)
`
`13
`31.7% (18.3–45.2)
`
`Normal colonoscopyc
`22
`3
`PPV
`16.9%
`7.3%
`a Includes adenocarcinomas, adenomas, and polyps NOS.
`b Includes diverticulosis, hemorrhoids, and IBD.
`c Does not preclude upper GI findings.
`
`ratio = 2.66, 95% CI: 1.2–6.1). K-ras enhanced the posi-
`tive predictive value of FOBT in four or more fields to
`80% for
`all neoplastic
`lesions;
`cancer + adenoma
`(ratio = 1.46, 95% CI: 0.9–2.3). K-ras reduced the FOBT
`positive predictive value (from 35.4% to 10.0%) for non-
`neoplastic conditions (e.g. diverticulosis, hemmorhoids,
`ulcers) (Table 2).
`
`4. Discussion
`
`This study demonstrated that DNA extracted
`from a Hemoccult Sensa card is of sufficient quality
`and quantity to detect common mutations associ-
`ated with colorectal carcinogenesis progression.
`K-ras was chosen as the test gene for this new
`method of DNA isolation and amplification from
`stool guaiac cards due to its high mutational
`frequency in the earlier phases of
`the colonic
`epithelial transformation process [12]. Among the
`
`histologicall verified malignancies, K-ras was found
`in 32%. While we did not perform a concordance
`validation with tissue samples from the sample
`patients’ stool samples we amplified, the percentage
`of positive K-ras tests in the subjects who had sub-
`sequent neoplastic disease proven corresponds well
`with the available literature [12–15].
`K-ras mutations occurred in 28% of the stool
`samples of negative FOBT cards. Other groups have
`also demonstrated a similar rate of ‘‘false positive’’
`results for K-ras in urine [16] and in stool [14]. Ito
`et al. [14] reported that three out of six stools found
`positive for K-ras not to have K-ras in the corre-
`sponding tumor tissue. Jen et al. [17] showed 25%
`of hyperplastic polyps to be K-ras-positive. Others,
`such as Puig et al. [18] did not find any false positive
`samples for K-ras. The source of these positive tests
`without known tissue-based mutation is unclear
`[14,16,18].
`
`Geneoscopy Exhibit 1040, Page 5
`
`

`

`G. Rennert et al. / Cancer Letters 253 (2007) 258–264
`
`263
`
`Many somatic events have been reported to be
`part of the colorectal neoplastic progression pro-
`cess [10,12]. Testing for K-ras can only represent
`a partial approach towards colorectal cancer detec-
`tion from stool samples. It is conceivable that
`probing expression and mutations of other com-
`monly detected genes on the same DNA samples
`may improve the detection process further [19,20].
`Other such markers [21,22] may identify K-ras neg-
`ative malignancies, thus further increasing the effi-
`cacy of
`the screening process. This process is
`similar in concept to several recently published
`studies of single or multiplexed, colorectal cancer
`associated gene mutations or gene silencing events
`on stool samples [8,13,23–27] and on colon tissue
`[28].
`The 205 positive cards in this study are the result
`of screening 5000 asymptomatic people (for a posi-
`tive test rate of 4.1%). A positive predictive value of
`5.5% for cancer and 26.6% for all tumors was for-
`merly reported for this screening program [11]. Of
`the 130 positive FOBT tests which amplified and
`for which a followed up was available, 23% or
`17.7% were later diagnosed with malignancy.
`In this pilot, proof of principle, study we demon-
`strated the ability to detect genetic events in the
`stool from FOBT cards and attempted to use these
`events to separate true from false positive FOBTs.
`On the basis of these preliminary data, we are pur-
`suing further validation by assaying stool samples
`and matched colonic neoplastic and flat mucosa
`obtained multi-center, case control trial. This work
`will allow us to more carefully evaluate the value
`of using K-ras and potentially other commonly
`mutated genes as adjuncts to FOBT testing prior
`to endoscopic evaluation.
`
`Acknowledgments
`
`This study was funded by NIH-CA86400, The
`Great Lakes New England Clinical Epidemiology
`Center of the Early Detection Research Network
`(EDRN) of the National Cancer Institute, the Gen-
`eral Clinical Research Center, University of Michi-
`gan Medical Center
`(M01-RR00047) and the
`Israel Science Foundation.
`
`References
`
`[1] J.S. Mandel, J.H. Bond, T.R. Church, et al., Reducing
`mortality from colorectal cancer by screening for faecal
`occult blood, N. Engl. J. Med. 328 (1993) 1365–1371.
`
`[2] J.S. Mandel, T.R. Church, F. Ederer, J.H. Bond, Colorectal
`cancer mortality: effectiveness of biennial screening for fecal
`occult blood, J. Natl. Cancer Inst. 91 (1999) 434–437.
`[3] J.D. Hardcastle, J.O. Chamberlain, M.H.E. Robinson, et al.,
`Randomised controlled trial of faecal occult blood screening
`for colorectal cancer, Lancet 348 (1996) 1472–1477.
`[4] O. Kronborg, C. Fenger, J. Olsen, O.D. Jorgensen, O.
`Sondergaard, Randomised study of screening for colorectal
`cancer with faecal occult blood test, Lancet 348 (1996) 1467–
`1471.
`[5] G. Rennert, Occult blood fecal (FOB) screening – trial
`evidence, practice and beyond. Recent results in cancer
`research, Tumor Prevention Genetics 163 (2003) 248–253.
`[6] D. Sidransky, T. Tokino, S.R. Hamilton, et al., Identifica-
`tion of ras oncogene mutations in the stool of patients with
`curable colorectal tumors, Science 256 (1992) 102–105.
`[7] J. Jen, C. Johnson, B. Levin, Molecular approaches to
`colorectal cancer screening, Eur. J. Gastro. Hepatol. 10
`(1998) 213–217.
`[8] T.F. Imperiale, D.F. Ransohoff, S.H. Itzkowitz, B.A. Turn-
`bull, M.E. RossColorectal Cancer Study Group, Fecal DNA
`versus fecal occult blood for colorectal-cancer screening in
`an average-risk population, N. Engl. J. Med. 351 (2004)
`2704–2714.
`[9] M. Pignone, M.K. Campbell, C. Carr, C. Phillips, Meta-
`analysis of dietary restriction during fecal occult blood
`testing, Eff. Clin. Pract. 4 (2001) 150–156.
`[10] E.R. Fearon, B.A. Vogelstein, genetic model for colorectal
`tumorigenesis, Cell 61 (1990) 759–767.
`[11] G. Rennert, H.S. Rennert, E. Miron, Y. Peterburg, Popu-
`lation colorectal cancer screening with fecal occult blood
`test, Cancer Epidemiol. Biomark. 10 (2001) 1165–1168.
`[12] B. Vogelstein, E.R. Fearon, S.R. Hamilton, et al., Genetic
`alterations during colorectal-tumor development, N. Engl. J.
`Med. 319 (1988) 525–532.
`[13] S.M. Dong, G. Traverso, C. Johnson, et al., Detecting
`colorectal cancer in stool with the use of multiple genetic
`targets, J. Natl. Cancer Inst. 93 (2001) 858–865.
`[14] Y. Ito, S. Kobayashi, T. Taniguchi, O. Kainuma, T. Hara, T.
`Ochiai, Frequent detection of K-ras mutation in stool
`samples of colorectal carcinoma patients after improved
`DNA extraction: comparison with tissue samples, Int. J.
`Oncol. 20 (2002) 1263–1268.
`[15] D. Calistri, C. Rengucci, R. Bocchini, L. Saragoni, W. Zoli,
`D. Amadori, Fecal multiple molecular tests to detect
`colorectal cancer in stool, Clin. Gastroenterol. Hepatol. 1
`(2003) 377–383.
`[16] M. Wang, T.M. Block, l.L. Stee, D.E. Brenner, Y.H. Su,
`Preferential
`isolation of fragmented DNA enhances the
`detection of circulating mutated K-ras DNA, Clin. Chem. 50
`(2004) 211–213.
`[17] J. Jen, S.M. Powell, N. Papadopoulos, et al., Molecular
`determinants of dysplasia in colorectal lesions, Cancer Res.
`54 (1994) 5523–5526.
`[18] P. Puig, E. Urgell, G. Capella, F.J. Sancho, J. Pujol, J.
`Boadas, A. Farre, F. Lluis, F. Gonzalez-Sastre, J. Mora, A
`highly sensitive method for K-ras mutation detection is
`useful in diagnosis of gastrointestinal cancer, Int. J. Cancer
`85 (2000) 73–77.
`[19] D.E. Brenner, G. Rennert, Fecal DNA biomarkers for the
`detection of colorectal neoplasia: attractive, but is it feasi-
`ble?, J Natl. Cancer Inst. 97 (2005) 1107–1109.
`
`Geneoscopy Exhibit 1040, Page 6
`
`

`

`264
`
`G. Rennert et al. / Cancer Letters 253 (2007) 258–264
`
`[20] Z. Lev, D. Kislitsin, G. Rennert, A. Lerner, Utilization of K-
`ras mutations identified in stool DNA for the early detection
`of colorectal cancer, J. Cell Biochem. 77 (2000) 35–39.
`[21] E.R. Fearon, Human cancer syndromes: clues
`to the
`origin and nature of cancer, Science 27 (1997) 1043–
`1050.
`[22] H. Rajagopalan, A. Bardelli, C. Lengauer, K.W. Kinzler, B.
`Vogelstein, V.E. Velculescu, Tumourigenesis: RAF/RAS
`oncogenes and mismatch-repair status, Nature 418 (2002)
`934.
`[23] S. Eguchi, N. Kohara, K. Komuta, T. Kanematsu, Muta-
`tions of the p53 gene in the stool of patients with resectable
`colorectal cancer, Cancer 77 (Suppl.) (1996) 1707–1710.
`[24] K.S. Tagore, M.J. Lawson, J.A. Yucaitis, et al., Sensitivity
`and specificity of a stool DNA multitarget assay panel for
`
`the detection of advanced colorectal neoplasia, Clin. Colo-
`rectal Cancer 3 (2003) 47–53.
`[25] G. Traverso, A. Shuber, B. Levin, et al., Detection of APC
`mutations in fecal DNA from patients with colorectal
`tumors, N. Engl. J. Med. 346 (2002) 311–320.
`[26] H.M. Muller, M. Oberwalder, H. Fiegl, et al., Methylation
`changes in faecal DNA: a marker for colorectal cancer
`screening?, Lancet 363 (2004) 1283–1285
`[27] W.D. Chen, Z.J. Han, J. Skoletsky, et al., Detection in fecal
`DNA of colon cancer-specific methylation of the nonex-
`pressed vimentin gene, J. Natl. Cancer Inst. 97 (2005) 1124–
`1132.
`[28] Y. Samuels, Z. Wang, A. Bardelli, et al., High frequency of
`mutations of the PIK3CA gene in human cancers, Science
`304 (2004) 554.
`
`Geneoscopy Exhibit 1040, Page 7
`
`