`Balschmidt et al.
`
`I 111111111111111111111 lllll lllll lllll lllll lllll lllll lllll 111111111111111111
`US005164366A
`[11] Patent Number:
`
`5,164,366
`Nov. 17, 1992
`
`[45] Date of Patent:
`
`[54] HUMAN INSULIN ANALOGUES
`[75]
`Inventors: Per Balschmidt, Espergaerde; Jens
`J.V. Brange, Klampenborg, both of
`Denmark
`[73] Assignee: Novo Nordisk A/S, Bagsvaerd,
`Denmark
`[21] Appl. No.: 453,445
`[22] Filed:
`Dec. 20, 1989
`
`[63]
`
`Related U.S. Application Data
`Continuation of Ser. No. 416,218, Oct. 2, 1989, aban(cid:173)
`doned, which is a continuation of Ser. No. 332,697,
`Apr. 3, 1989, abandoned.
`[30]
`Foreign Application Priority Data
`Dec. 23, 1988 [DK] Denmark ............................. 7215/88
`Sep. 28, 1989 [DK] Denmark ............................. 4777/89
`Int. 0.5 ........................ C07K 7/40; A61K 37/26
`[51]
`[52] U.S. Cl. ........................................ 514/3; 530/303;
`435/69.4
`[58] Field of Search ............................ 530/303; 514/3;
`435/69.4, 68.1
`
`[56]
`
`References Cited
`U.S. PA TENT DOCUMENTS
`3,903,069 9/1975 Geregory ............................ 530/303
`
`4,320,196 3/1982 Morihara et al. ....................... 514/3
`4,701,440 10/1987 Grau ....................................... 514/3
`
`FOREIGN PATENT DOCUMENTS
`0254516 1/1988 European Pat. Off. ................ 514/3
`WO/8910937 11/1989 World Int. Prop. 0 ............... 514/3
`
`OTHER PUBLICATIONS
`Frank, B., "Self-Assocation and Confermational Stud(cid:173)
`ies on Human Poinsulin and Insulin Analogs", Abstract,
`Conference on Insulin, 1989.
`Chance, R., "Preparation of a New Series of Insulin
`Analogs", Conference on Insulin, Sep. 1989.
`Nakagawa, S. et al., Journal of Biological Chemistry,
`262(25): 12054-58, Sep. 1987.
`Primary Examiner-Merrell C. Cashion, Jr.
`Assistant Examiner-Susan M. Perkins
`Attorney, Agent, or Firm-Steve T. Zelson
`
`[57]
`ABSTRACT
`The present invention relates to novel human insulin
`analogues exhibiting a low ability to associate in solu(cid:173)
`tion, a method for the preparation of such insulin ana(cid:173)
`logues, insulin preparations containing the human insu(cid:173)
`lin analogues of the invention and a method of treating
`Diabetes Mellitus using these human insulin analogues.
`
`35 Oaims, 5 Drawing Sheets
`
`MPI EXHIBIT 1072 PAGE 1
`
`MPI EXHIBIT 1072 PAGE 1
`
`Apotex v. Novo - IPR2024-00631
`Petitioner Apotex Exhibit 1072-0001
`
`
`
`1427G
`Hjndl/1
`
`Hind II I
`
`Pygaba
`14276
`
`....
`g~
`
`~1
`~ -("'
`
`~ •
`00
`•
`
`~ = t"'t'-
`tD = t"'t'-
`
`z 0
`
`~
`~
`~-l
`
`~
`IC
`IC
`N
`
`r.n =-('I)
`
`('I)
`.-+-
`
`SalI
`
`g-•ooo
`
`~
`
`0 ....
`
`U1
`
`FIG/
`
`th
`
`.... ...
`°' ~ .... w
`°' °'
`
`~~
`
`//
`
`.........._
`
`~
`
`BODO
`
`GOOO
`
`I I
`EcoRI
`HJncJIII
`
`Hindlll~~
`EcoRI
`JOOOO
`
`_
`
`MPI EXHIBIT 1072 PAGE 2
`
`MPI EXHIBIT 1072 PAGE 2
`
`Apotex v. Novo - IPR2024-00631
`Petitioner Apotex Exhibit 1072-0002
`
`
`
`U.S. Patent
`
`Nov. 17, 1992
`
`Sheet 2 of 5
`
`5,164,366
`
`....
`....
`....
`... ....
`" C:
`...
`
`0'l
`
`'O
`
`C"'l
`
`l:
`
`....
`
`....
`
`...
`
`....
`....
`....
`C: ·-
`:i:
`
`'t:)
`
`0
`0
`0
`
`0 ...
`
`....
`....
`....
`'t:)
`....
`C:
`:i:
`
`MPI EXHIBIT 1072 PAGE 3
`
`MPI EXHIBIT 1072 PAGE 3
`
`Apotex v. Novo - IPR2024-00631
`Petitioner Apotex Exhibit 1072-0003
`
`
`
`U.S. Patent
`
`Nov. 17, 1992
`
`Sheet 3 of 5
`
`5,164,366
`
`10
`20
`30
`40
`50
`60
`I
`I
`I
`I
`I
`I
`GAATTCCATTCAAGAATAGTTCAAACAAGAAGATTACAAACTATCAATTTCATACACAAT
`
`70
`80
`90
`100
`110
`120
`I
`I
`I
`I
`I
`I
`ATAAACGACCAAAAGAATGAAGGCTGTTTTCTTGGTTTTGTCCTTGATCGGATTCTGCTG
`MllLysAlaValPheLeuValLeuSerLeuileGlyPheCysTrp
`
`130
`• 140
`150
`160
`170
`180
`.
`I
`I
`I
`I
`I
`I
`GGCCCAACCAGTCACTGGCGATGAATCATCTGTTGAGATTCCGGAAGAGTCTCTGATCAT
`AlaGlnProValThrGlyAspGluSerSerValGluileProGluGluSerLeuileile
`
`190
`200
`210
`220
`230
`240
`I
`I
`I
`I
`I
`I
`CGCTGAAAACACCACTTTGGCTAACGTCGCCATGGCTAAGAGATTCGTTAACCAACACTT
`AlaGluAsnThrThrLeu.AlaAsnValAlaMtl'.AlaLysArgPheValAsnGlnHisLeu
`
`250
`260
`270
`280
`290
`300
`I
`I
`I
`I
`I
`I
`GTGCGGTTCCCACTTGGTTGAAGCTTTGTACTTGGTTTGCGGTGAAAGAGGTTTCTTCTA
`CysGlySerHisLeuValGlu.AlaLeuTyrLeuValCysGlyGluArgGlyPhePheTyr
`
`310
`320
`330
`340
`350
`360
`I
`I
`I
`I
`I
`I
`CACCAAGGCTGCTAAGGGTATTGTCGAACAATGCTGTACCTCCATCTGCTCCTTGTACCA
`ThrLysAlaAlaLysGlyileValGluGlnCysCysThrSerileCysSerLeuTyrGln
`
`370
`3oO
`390
`400
`I
`I
`I
`I
`ATTGGAAAACTACTGCAGCTAGACGCAGCCCGCAGGCTCTAGA
`
`LeuGluAsnTyrCysser
`
`FIG3
`
`MPI EXHIBIT 1072 PAGE 4
`
`MPI EXHIBIT 1072 PAGE 4
`
`Apotex v. Novo - IPR2024-00631
`Petitioner Apotex Exhibit 1072-0004
`
`
`
`U.S. Patent
`
`Nov. 17, 1992
`
`Sheet 4 of 5
`
`5,164,366
`
`BamH I
`
`pMT608 PQT.Nr)
`LEU2
`
`'J;
`R
`~ Soll
`lSal I
`
`Sphl
`
`Hpa I
`
`/"l)Jori
`
`2
`
`pMT 621
`
`/
`SphI
`
`Clo I
`
`~
`
`p8R322
`
`/
`
`Clo!
`SphI
`
`NcoI
`
`I
`
`T
`R pMT 479 MF
`p
`
`RI
`
`ba!
`
`~
`Sol I
`
`Sal I
`
`POT
`
`T
`
`Nru I lHpa I
`
`FIG 4
`
`Ncol
`Sal I
`
`MPI EXHIBIT 1072 PAGE 5
`
`MPI EXHIBIT 1072 PAGE 5
`
`Apotex v. Novo - IPR2024-00631
`Petitioner Apotex Exhibit 1072-0005
`
`
`
`U.S. Patent
`
`Nov. 17, 1992
`
`Sheet 5 of 5
`
`5,164,366
`
`l
`~ pMT 623
`
`l
`
`Nco I
`Sal I
`~
`pMT 636
`
`Xbal
`
`TP
`
`POT
`
`Neel+
`Xbol
`
`Neel+
`EcoRI
`
`bal
`
`sign.-leader
`insulin analogue
`precursor
`pKFN-864
`
`¼_
`
`EceR I+
`Xbal ♦
`
`Neel
`~EcoRI
`0,
`TPip
`iµ sign.-leader
`insulin analogue
`precursor
`pKFN-866
`
`FIG 4(CONT)
`
`MPI EXHIBIT 1072 PAGE 6
`
`MPI EXHIBIT 1072 PAGE 6
`
`Apotex v. Novo - IPR2024-00631
`Petitioner Apotex Exhibit 1072-0006
`
`
`
`1
`
`HUMAN INSULIN ANALOGUES
`
`5,164,366
`
`This is a continuation of Ser. No. 07/416,218 filed
`Oct. 2, 1989 which is a continuation of Ser. No. 332,697 5
`filed Apr. 3, 1989, both abandoned.
`
`TECHNICAL FIELD
`The present invention relates to novel human insulin
`analogues exhibiting a low ability to associate in solu- 10
`tion, a method for the preparation of such insulin ana(cid:173)
`logues, insulin preparations containing the human insu-
`lin analogues of the invention and a method of treating
`Diabetes Mellitus using these human insulin analogues.
`BACKGROUND ART
`Ever since the discovery of insulin in 1922 many
`different types of insulin preparations have been used
`for the treatment of Diabetes mellitus. At the beginning
`exclusively insulin solutions exhibiting a rapidly com- 20
`mencing and relatively rapidly ceasing insulin activity
`were used, but later on insulin preparations exhibiting a
`wider profile of activity procured by lowering the solu(cid:173)
`bility of insulin by means of additions as e.g. zinc salt
`and/or protamines have been produced. For reasons of 25
`availability the insulin used herefor has normally been
`recovered from Pancreas from domestic animals, most
`frequently oxes, pigs and sheep, however, recently
`preparations containing human insulin of biotechnologi(cid:173)
`cal origin have also appeared on the market.
`The structure of human insulin is shown in the fol(cid:173)
`lowing formula
`
`2
`meric, hexameric and even polymeric insulin. The equi(cid:173)
`librium can e.g. be determined by ultracentrifugation,
`by osmometry or by gel filtration methods, vide e.g. R.
`Valdes Jr. and G. A. Ackers, "Methods in enzymol(cid:173)
`ogy", vol. 61 (Enzyme Structure, part H. eds.; Hirs &
`Timasheff), Academic Press 1979, pages 125-142. In
`normal formulations of insulin preparations this equili(cid:173)
`bration is shifted in such a way that the insulin to a very
`high degree is on a hexameric form.
`Substitutions in the insulin molecule can be intro-
`duced with the purpose of improving the profile of
`activity of the insulin in the treatment of Diabetes.
`Thus, Published International Application No. WO
`86/05497 discloses that one or more substitutions of Glu
`15 in the insulin molecule by a neutral amino acid residue
`causes a shifting of the zone of precipitation of the insu(cid:173)
`lin in such a way that a slow release after injection is
`obtained.
`Moreover, Published European Application No. EP
`214 826 discloses insulin analogues being particularly
`rapidly absorbed after injection. This effect is a result of
`the fact that by means of certain substitutions in particu-
`lar in the B9-Bl2 region and in the B26-B28 positions in
`the insulin molecule a suppression of the association
`tendency of the insulin is obtained so that it is essentially
`present as monomer or dimer. However, a number of
`these insulin analogues exhibits a reduced biological
`activity.
`Throughout the years a large number of artificially
`30 prepared analogues of human insulin has been de(cid:173)
`scribed, usually with the purpose of elucidating the
`influence of the structure on the activity, vide e.g.
`
`S - - - - - - - - -S
`
`I 7
`
`I
`
`A-0~
`
`B-Chain
`
`H-Gly-Ile-Val-Glu-Gln-Cys-Cys-Thr-Ser-Ile-Cys-Ser-
`I
`1
`2
`3
`4
`5
`6
`8
`9
`10
`11
`12
`s
`~
`I
`H-Phe-Val-Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val
`I
`2
`3
`4
`5
`6
`7
`8
`9
`10
`JI
`12
`
`A-Chain (contd.)
`
`20
`Leu-Tyr-Gln- Leu-Glu-Asn-Tyr-Cys-Asn-OH
`I
`13
`14
`1s
`16
`11
`18
`19
`21
`
`is
`
`B-Chain (contd.)
`
`s
`I
`Glu-Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Phe-
`13
`14
`15
`16
`17
`18
`19
`20
`21
`22
`23
`24
`
`B-Chain (contd.)
`
`Phe-Tyr-Thr-Pro-Lys-Thr-OH
`"25
`26
`27
`28
`29
`30
`
`The insulins from certain domestic animals are very
`similar in structure to human insulin. Thus dog and pig
`insulin differ from human insulin only by containing Ala Marke et al., Hoppe-Seyler's Z. Physiol Chem. 360
`in position 30 in the B-chain and rabbit insulin only by
`(1979), 1619-1632. Investigations of the influence of
`containing Ser in the same position. These insulins may 60
`substitutions in the (B22-B26)-sequence of the insulin
`be converted into human insulin by replacement of the
`on the receptor binding have been of particular interest,
`B30-amino acid residue with Thr by semisynthetic pro(cid:173)
`as said sequence is considered to be an essential site of
`cedures as described by Morihara et al, Nature 280
`binding for the insulin receptor, and as naturally occur(cid:173)
`(1979), 412-413 and Marcussen
`(U.S. Pat. No.
`ring mutations have been found with substitutions in
`4,343,898).
`65 said site. Vide e.g. S. Shoelson et al. PNAS 80 (1983),
`When such an insulin is dissolved at physiological pH
`7390-7394 and M. Kobayashi et al.: Biomed. Res. 5 (3)
`value a concentration-dependent association equilib(cid:173)
`(1984), 267-272. Very low biological activities were
`rium is established between monomeric, dimeric, tetra-
`found for analogues in which Phe (B24) or Phe (B25)
`
`MPI EXHIBIT 1072 PAGE 7
`
`MPI EXHIBIT 1072 PAGE 7
`
`Apotex v. Novo - IPR2024-00631
`Petitioner Apotex Exhibit 1072-0007
`
`
`
`5,164,366
`
`3
`are substituted, and therefore it was concluded that the
`presence of these two amino acids is of decisive impor(cid:173)
`tance to the receptor binding
`The present invention is based on the surprising rec(cid:173)
`ognition that certain human insulin analogues in which
`one of the amino acid residues [PheB24] or [PheB25] is
`not present exhibit a low association tendency in solu(cid:173)
`tion and at the same time exhibits an unchanged or even
`
`4
`the side chain (C-y) is sp2-hybridized (the bonds having
`a planar structure).
`Also with the purpose of stabilizing the molecule
`against chemical degradation, Asn in position A2 l and(cid:173)
`s /or B3 may furthermore be replaced by another amino
`acid residue.
`The present human insulin analogues can be charac(cid:173)
`terized by the following formula I
`
`s - - - - - - - - -S
`
`(I)
`
`I
`
`I
`
`A-Chain
`
`B-Chain
`
`H-Gly-Ile-Va!-Glu-Gln-Cys-Cys-Thr-Ser-l!e-Cys-Ser-
`1 s
`J
`I
`H-Phe-Val-Y2-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val
`A-Chain (contd.)
`
`Leu-Tyr-Gln-Leu-Giu-Asn-Tyr-Cys-Y 1-0H
`
`I Is
`
`B-Chain (contd.)
`
`S
`I
`Glu-Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Phe-
`
`B-Chain (contd.)
`
`higher in vitro biological activity than human insulin.
`The deletion of either [PheB24] or [PheB25] will have the
`effect that [LysB29] is transferred into [LysB28]. The
`position of a positive charge in this position in the
`human insulin molecule is considered to be the impor- 35
`tant aspect of the present \nvention.
`
`SUMMARY OF THE INVENTION
`In its broadest aspect the present invention is there(cid:173)
`fore related to human insulin analogues in which there 40
`is a positively charged amino acid residue, i.e. Lys or
`Arg in the position B28, i.e. in position 8 in the B-chain
`calculated from [GJyB20].
`The present insulin analogues have surprisingly a low
`association tendency and at the same time an increased 45
`physical stability compared to other insulin analogues
`with low association tendency. Introduction of a posi(cid:173)
`tive charge in position B28 may be accomplished in two
`ways. Either by deleting one of the amino acid residues
`in position B24, B25, B26, B27 or B28 in the human 50
`insulin molecule leading to a human insulin analogue
`with a Lys in position B28 or by substituting [ProB28]
`the human insulin molecule with a Lys or Arg. If an
`Arg is preferred in position B28 the deletion of one of
`the amino acid residues in position B24, B25, B26, B27 55
`or B28 may furthermore be combined with a substitu(cid:173)
`tion of the original [LysB29] with an Arg residue.
`The present human insulin analogues may further(cid:173)
`more contain one or more modifications in the C-termi-
`nal end of the B-chain compared to human insulin. 60
`Thus, the amino acid residues in position B25 to B27
`and the amino acid residue(s) following the [LysB28] or
`[ArgB28] may be arbitrarily chosen among the naturally
`occurring amino acid residues or B29 or B30 or both
`may be Jacking.
`According to one aspect of the present invention
`[TyrB26] may be substituted by another uncharged
`amino acid residue wherein the second carbon atom in
`
`wherein Xi, X2, X3, Xs, Y1 and Y2may be any naturally
`occurring amino acid residue, ~ is Lys or Arg, X6 may
`be any naturally occurring amino acid residue carrying
`the C-terminal hydroxy group or -OH or Xs and X6
`together form the C-terminal hydroxy group.
`In an embodiment of the invention Xs is selected from
`the group consisting of any naturally occurring amino
`acid residue except Pro.
`In the above formula Y1 and/or Y2 may in one em(cid:173)
`bodiment be selected from the group consisting of any
`naturally occurring amino acid residue except Asn.
`In the above formula I X1 may more specifically be
`Phe, Ala, His, Thr, Ser, Asn or Tyr,
`X2 may more specifically be Tyr, Thr, Glu, Asp, Ala,
`His, Ser or Phe,
`X3 may more specifically be Pro, Glu, Asp, Ser, Thr
`or His,
`Xs may more specifically be Lys, Thr, Ser, Ala, Asp
`or Glu,
`X6 may more specifically be Thr-OH, Ser-OH, Ala(cid:173)
`OH, Asp-OH, Glu-OH or -OH,
`Y1 may be Asn, Glu, Asp, His, Ser, Thr, Val, Leu, lie,
`Ala, Met, Trp, Tyr, Gin or Gly, more preferably Gly,
`Asp, Glu or Ala, and
`Y2maybeAsn, Glu, Asp, His, Ser, Thr, Val, Leu, lie,
`Ala, Met, Trp, Tyr, Gin or Gly, more preferably Glu or
`Asp.
`One group of the present human insulin analogues
`can be characterized as such in which one of the amino
`acid residues in position B24 or B25 has been deleted,
`that the amino acid residue in position B26, optionally,
`is substituted by another uncharged amino acid residue
`in which the carbon atom in the ')'-position is sp2-hybri(cid:173)
`dized, that, optionally, one or more of the amino acid
`65 residues in positions A21, B3 and B30 differ from the
`amino acid residue in the corresponding positions in
`human insulin, and that, optionally, no amino acid resi(cid:173)
`due is present in position B30.
`
`MPI EXHIBIT 1072 PAGE 8
`
`MPI EXHIBIT 1072 PAGE 8
`
`Apotex v. Novo - IPR2024-00631
`Petitioner Apotex Exhibit 1072-0008
`
`
`
`5,164,366
`
`5
`According to a more simple definition such analogues
`are human insulin analogues in which [TyrB26] is not
`present, in which [PheB25] has optionally been substi(cid:173)
`tuted by another uncharged amino acid residue in
`which the carbon atom in the y-position is sp2-hybri- 5
`dized, in which one or more of the amino acid residues
`in positions A21, B3 and B30, optionally, differ from the
`amino acid residues in human insulin and in which op(cid:173)
`tionally no amino acid residue is present in position B30.
`Examples of uncharged amino acid residues in which JO
`Cy is sp2-hybridized are Tyr, Phe, His, Trp and Asn.
`It is possible to introduce further substitutions or
`derivatizations in the human insulin analogues men(cid:173)
`tioned above if the properties do not change substan(cid:173)
`tially. Such further derivatizations could be esterifica- 15
`tion or amidation of carboxyl groups, acylation or alky(cid:173)
`lation of amino- or hydroxyl groups or could be deami(cid:173)
`dation of carboxamide groups. Further substitutions
`maybe exchange of [ThrA8] with His or of [HisBIO] with
`Asp. Moreover, it is possible to add or delete a single or 20
`a few amino acid residues at the C- and/or the N-termi-
`nal of preferably the B-chain.
`One group of the human insulin analogues according
`to the invention will have the structure shown in for(cid:173)
`mula II below, where X means Tyr, His, Phe or Asn, Y 25
`means Thr, Ser, Ala, Asp or Glu or a deletion and
`where optionally one or both of the underscored Asn
`have been changed to Asp by substitution or deamida(cid:173)
`tion or the underscored Asn in the A-chain may be Gly.
`
`6
`[AspA21 ]-des[PheB25],des[ThrB30]-human insulin
`[AspB28]-des[PheB25]-human insulin
`[AspB3]-des[PheB25]-human insulin
`[LysB28]-human insulin
`[LysB28,ThrB29]-human insulin
`[ArgB28]-des[LysB29]-human insulin
`The human insulin analogues according to the pres-
`ent invention may advantageously be used in the treat(cid:173)
`ment of Diabetes as the decreased ability to association
`leads to a faster uptake in the bloodstream than an ordi(cid:173)
`nary insulin not only after the normally used subcutane-
`ous injection but also by non-parenteral use, vide e.g.
`Published International Application No. WO87/06137.
`Also their improved physical stability will make them
`more advantagous in the Diabetes treatment.
`The insulin analogues according to the present inven(cid:173)
`tion may be prepared by altering the proinsulin gene
`through replacement of codon(s) at the appropriate site
`in the native human proinsulin gene by codon(s) encod(cid:173)
`ing the desired amino acid residue substitute(s) and/or
`by deleting the codon(s) corresponding to the desired
`deletion(s). Alternatively, the whole DNA-sequence
`encoding the desired insulin analogue may be synthe(cid:173)
`sized. The gene encoding the desired insulin analogue is
`then inserted into a suitable expression vector which
`when transferred to a suitable host organism, e.g. E.
`coli, Bacillus or yeast, generates the desired product.
`The expressed product is then isolated from the cells or
`the culture broth depending on whether the expressed
`30 product is secreted from the cells or not.
`
`S - - - - - - - -S
`
`(II)
`
`I
`
`I
`
`A-Chain
`
`B-Chain
`
`H-G!y-l!e-Va!-G!u-G!n-Cys-Cys-Thr-Ser-lle-Cys-Ser-
`1
`s
`~
`I
`H-Phe-Val-Asn-G!n-His-Leu-Cys-Gly-Ser-His-Leu-Val
`A-Chain (contd.)
`
`Leu-Tyr-Gln-Leu-Glu-Asn-Tvr-Cys-Asn-OH
`•
`I
`-
`,s
`S
`I
`Glu-Ala-Leu-Tyr-Leu-Val-Cys-G!y-Glu-Arg-Gly-Phe-
`
`B-Chain (contd.)
`
`B-Chain (contd.)
`
`X-Thr-Pro-Lys-Y-OH
`
`Preferred human insulin analogues according to the
`invention are the following:
`des[PheB25]-human insulin
`des[TyrB26]-human insulin
`des[ThrB27]-human insulin
`des[ProB28]-human insulin
`des[PheB25]-porcine insulin
`des[ProB28]-porcine insulin
`des[ProB28]-rabbit insulin
`des[PheB25],des[ThrB30].human insulin
`des[TyrB26],des[ThrB30]-human insulin
`[SerA2 I ]-des[ProB28]-human insulin
`[ GJyA2 I ]-des[ProB28]-human insulin
`[GJyA21]-des[PheB25]-human insulin
`[AspA21]-des[PheB25]-human insulin
`[HisB25]-des[TyrB26],des[ThrB30].human insulin
`[AsnB25]-des[TyrB26],des[ThrB30]-human insulin
`
`The novel insulin analogues may also be prepared by
`chemical synthesis by methods analogue to the method
`described by Miirki et al. (Hoppe-Seyler's Z. Physiol.
`55 Chem., 360 (1979), 1619-1632). They may also be
`formed from separately in vitro prepared A- and B(cid:173)
`chains containing the appropriate amino acid residue
`substitutions and deletions, whereupon the modified A(cid:173)
`and B-chains are linked together by establishing disul-
`60 phide bridges according to known methods (e.g.
`Chance et al., In: Rick DH, Gross E (eds) Peptides:
`Synthesis-Structure-Function. Proceedings of the
`seventh American peptide symposium, Illinois, pp.
`721-728).
`The insulin analogues may furthermore be prepared
`by a method analogue to the method described in EP
`patent application No. 0163529A, the disclosure of
`which is incorporated by reference hereinto. By such
`
`65
`
`MPI EXHIBIT 1072 PAGE 9
`
`MPI EXHIBIT 1072 PAGE 9
`
`Apotex v. Novo - IPR2024-00631
`Petitioner Apotex Exhibit 1072-0009
`
`
`
`5,164,366
`
`7
`method an insulin precursor of the human insulin ana(cid:173)
`logue wherein the basic amino acid in position B28 or
`B29 (if the final product shall have a basic amino acid in
`this position) is connected to GlyAI by means of either a
`peptide bond or a peptide chain of varying length is 5
`expressed and secreted by yeast with correctly posi(cid:173)
`tioned disulphide bridges and is then converted into the
`desired human insulin analogue by the Morihara
`method (Morihara supra) or the so-called transpeptida(cid:173)
`tion reaction (see U.S. Pat. No. 4,343,898).
`Accordingly the present insulin analogues may be
`prepared by inserting a DNA-sequence encoding a
`precursor of the insulin analogue in question into a
`suitable yeast expression vehicle which when trans(cid:173)
`ferred to yeast is capable of expressing and secreting the 15
`precursor of the insulin analogue in which [LysB28],
`[ArgB28], [LysB29] or [ArgB29] is connected to GJyA 1 by
`a peptide bond or a peptide chain with the formula III
`
`(III) 20
`
`8
`logues according to the present invention or a pharma(cid:173)
`ceutically acceptable salt thereof in aqueous solution or
`suspension, preferably at neutral pH. The aqueous me-
`dium is made isotonic, for example with sodium chlo(cid:173)
`ride, sodium acetate or glycerol. Furthermore, the
`aqueous medium may contain zinc ions, buffers such as
`acetate and citrate and preservatives such as m-cresol,
`methylparaben or phenol. The pH value of the prepara(cid:173)
`tion is adjusted to the desired value and the insulin
`10 preparation is made sterile by sterile filtration.
`The present insulin analogues may also be mixed with
`other insulin analogues having a protracted insulin ac(cid:173)
`tivity to prepare insulin preparations consisting of a
`mixture of rapid acting and protracted insulin.
`The insulin preparations of this invention can be used
`similarly to the use of the known insulin preparations.
`TERMINOLOGY
`The abbreviations used for the amino acids are those
`stated in J. Biol. Chern. 243 (1968), 3558. The amino
`acids are in the L configuration. Unless otherwise indi(cid:173)
`cated, the species of insulins stated herein is human.
`BRIEF DESCRIPTION OF THE DRAWINGS
`The invention is further illustrated with reference to
`the accompanying drawings in which
`FIG. 1 shows the expression plasmid pYGABA
`14276,
`FIG. 2 shows the yeast vector pAB24,
`FIG. 3 shows the DNA sequence of the 0.4 kb
`EcoRI-XbaI fragment from the plasmid pKFN-864, and
`FIG. 4 shows the preparation of the expression plas(cid:173)
`mid pKFN-866.
`
`DETAILED DESCRIPTION
`DNA-sequences encoding modified insulin precur(cid:173)
`sors were constructed with basis in the expression cas(cid:173)
`sette, which is contained in the BamHI restriction frag(cid:173)
`ment from the expression plasmid pYGABA as shown
`in FIG. 1, has a lenght of 1103 basepairs and contains
`essentially the following (listed in succession starting
`from the 5'-end): The GAPDH promoter (Travis et al.,
`J. Biol. Chern., 260 (1985), 4384-4389) followed by the
`coding region consisting of: The 83 N-terminal amino
`acids of the MF al-leader sequence encoded by the
`wild-type yeast DNA-sequence as described by Kurjan
`& Herskowitz followed by the two codons AAA and
`AGA encoding Lys and Arg and again followed by the
`coding region for the insulin precursor single chain des
`[ThrB30J- human insulin (SCI), which is a synthetically
`constructed gene using preferred yeast codons. After
`two stop-codons, a Sall restriction site is positioned, and
`the rest of the sequence constitutes the MFal-sequence
`containing the terminator region. The sequence is con(cid:173)
`structed using entirely standard techniques.
`The method employed was "oligonucleotide site di-
`rected mutagenesis", which is described by Zoller &
`Smith, DNA, Vol. 3, No. 6 (1984), 479-488. The
`method is briefly described in the following, and is
`described thoroughly in Example 1. The insulin precur-
`sor sequence is isolated from the expression plasmid and
`inserted into a single-stranded genom, circular M 13
`bacteriophage vector. A chemically synthesized corn-
`65 plementary DNA-strand is then annealed to the single(cid:173)
`stranded genorn. The DNA-strand contains the desired
`sequence surrounded by sequences completely homolo(cid:173)
`gous to insulin sequences on the circurlar DNA. The
`
`wherein R is a peptide chain with n amino acid residues,
`n is an integer from O to 33 and R 1 is Lys or Arg when
`culturing the transformed yeast strain in a suitable nutri-
`ent medium. The precursor is then recovered from the 25
`culture broth and reacted with an amino compound
`with the formula IV
`
`Q-OR"
`
`(IV)
`
`wherein Q is a single amino acid residue, preferably 30
`Thr, or a dipeptide, and R" is a carboxy protecting
`group (e.g. methyl or tert-butyl), using trypsin or tryp(cid:173)
`sin-like enzyme as a catalyst in a mixture of water and
`organic solvents analogously as described in U.S. Pat.
`No. 4,343,898 (the disclosure of which is incorporated 35
`by reference hereinto) whereupon the carboxy protect-
`ing group is removed and the insulin analogue is iso(cid:173)
`lated from the reaction mixture.
`If the insulin analogues contain an amino acid residue
`different from Lys or Arg as the C-terminal residue in 40
`the B-chain, they may also be prepared by a method
`analogue to the method described in Published Euro(cid:173)
`pean Application No. EP 195 691 the disclosure of
`which is incorporated by reference hereinto. By this
`method insulin analogue precursors of the type having a 45
`bridge between the A- and B-chain consisting of a single
`pair of basic amino· acid (Lys, Arg) are made in yeast
`and then converted into the insulin analogue by an
`enzymatic conversion.
`If the C-terminal amino acid residue in the B-chain is 50
`Lys or Arg, then the insulin analogues can be prepared
`from the above biosyntetic precursors by enzymatic
`cleavage with trypsin.
`Human insulin analogues of the invention in which
`substitutions are only present within the last amino acid 55
`residues nearest to the C-terminal of the B-chain may
`moreover be prepared in a manner known per se from
`e.g. porcine insulin as described in K. Inoye et al.; JACS
`101 (3), (1979), 751-752, whereby the porcine insulin is
`first split with trypsin to des-(B23-30)-hurnan insulin, 60
`whereupon the latter, also enzymatically, is coupled
`with a synthetic peptide having the desired amino acid
`sequence.
`The present insulin analogues may be used for the
`preparation of novel insulin preparations with insulin
`activity to be substituted for human or porcine insulin in
`the insulin preparations heretofore known to the art.
`Such novel insulin preparations contain the insulin ana-
`
`MPI EXHIBIT 1072 PAGE 10
`
`MPI EXHIBIT 1072 PAGE 10
`
`Apotex v. Novo - IPR2024-00631
`Petitioner Apotex Exhibit 1072-0010
`
`
`
`5,164,366
`
`9
`primer is then extended in vitro into the entire length of
`the circular genom biochemically using Kienow poly(cid:173)
`merase. This strand will give rise to single-stranded
`phages, which when grown in E. coli give the possibility
`of isolating double-stranded DNA with the desired
`sequence. From this double-stranded DNA, a restric(cid:173)
`tion fragment can be isolated and reinserted into the
`expression vector.
`
`MODES FOR CARRYING OUT THE
`INVENTION
`The invention is further illustrated by the following
`Examples.
`
`30
`
`10
`merase. Then, the reaction was carried out for 16 hours
`at 16' C.
`Transformation of JMlOI:
`The reaction mixture above was transformed in dif-
`5 ferent dilutions into CaC!i-treated E. coli JM101 cells
`using standard techniques and plated in 2 X YT topagar
`on 2XYT agar plates. (2XYT=tryptone 16 g/liter,
`yeast extract 10 g/liter, NaCl 5 g/liter. 2 X YT topa(cid:173)
`gar= 2 X YT with 0.4% agarose added and autoclaved.
`10 2 X YT agar plates= 2 X YT with 2 % agar added and
`autoclaved). The plates were incubated at 37' C. over(cid:173)
`night.
`Identification of positive clones:
`The method used was plaque-lift hybridisation which
`15 is described in the following: a nitrocellulose-filter was
`placed on a plate with a suitable plaque-density, so that
`the filter was wetted. The filter was then bathed in the
`following solutions: 1.5 M NaCl, 0.5M NaOH for 30
`sec., 1.5 M NaCl, 0.5M Tris-HCI, pH 8.0 for 1 min.,
`2XSSC (0.3 M NaCl, 0.03M sodium citrate) till later
`use. The filter was dried on 3MM filter paper and baked
`for 2 hours at 80' C. in a vacuum oven.
`the sequence
`The mutagenisation primer with
`5'TIGGAGTGTAGAAACCTCTI-3' was labelled
`radioactively in the 5' end in a 30 µliters volume con(cid:173)
`taining 70 mM Tris-HCI, pH 7.5, 10 mM MgCl2, 5 mM
`DTI, 10 pmol oligonucleotide, 20 pmol y-32P-ATP and
`3.5 units of T4 polynucleotide kinase. The mixture was
`incubated at 37' C. for 30 min. and then for 5 min. at
`100' C.
`The dried filter was prehybridised for 2 hours at 65'
`C. in 6XSSC, 0.2% bovine-serum albumin, 0.2% Ficoll,
`0.2% polyvinylpyrrolidon, 0.2% sodium-dodecyl-sul(cid:173)
`phate (SDS) and 50 µg/ml salmon-sperm DNA. Then,
`the reaction mixture containing the labelled probe was
`added to 15 ml of fresh prehybridisation mix, and the
`filter was bathed herein overnight at 28' C. with gentle
`shaking. After hybridisation the filter was washed 3
`times for each 15 min. in 2 X SSC+ 0.1 % SDS and au-
`40 toradiographed. After wash in the same solution, but
`now at 52' C., and another autoradiography, plaques
`containing DNA-sequences complementary
`to
`the
`mutagenisation primer were identified.
`Re-screening of positive clones:
`Because the identified clone is a result of a heterodu(cid:173)
`plex, the plaque was plated again. The hybridisation and
`identification were repeated.
`Purification of double-stranded M13-phage DNA:
`A re-screened clone was used for infection of the E.
`50 coli strain JMlOl. A culture containing approximately
`lQS phages and 5 colonies of JM101 was grown for 5
`hours in a 5 ml 2XYT medium at 37' C. Then, double(cid:173)
`stranded, circular DNA was purified from the pellet
`according to a method described by Birnboim & Doly,
`55 Nucleic Acids Res., 2 (1979), 1513.
`Isolation of a restriction fragment containing modi(cid:173)
`fied insulin precursor:
`The DNA-preparation (appr. 5 µg) isolated above
`was digested with 10 units of the restriction endonucle(cid:173)
`ase BamHI in 60 µliters of 100 mM NaCl, 50 mM Tris(cid:173)
`HCI, pH 7.5, 10 mM MgC!i, and 1 mM DTI for 2 hours
`at 37' C. The DNA-products were separated on an
`agarose-gel, and the fragment was purified from the gel.
`Ligation to the yeast vector pAB24 (FIG. 2):
`The isolated restriction fragment was ligated to the
`yeast vector pAB24 digested with the restriction endo(cid:173)
`nuclease BamHI in the following reaction mixture:
`Fragment 0.2 µg, vector 0.02 µg, 50 mM Tris-HCI, pH
`
`25
`
`EXAMPLE I
`Construction of an expression plasmid, which can be
`used to express des[PheB25]-SCI.
`The expression cassette, which is contained in the
`expression plasmid pYGABA (shown in FIG. 1) on a
`BamHI restriction fragment, was isolated: The expres- 20
`sion plasmid was incubated with the restriction endonu-.
`clease BamHI. The conditions were: 20 µg of plasmid,
`50 units of BamHI, 100 mM NaCl, 50 mM TrisHCI, pH
`7.5, 10 mM MgC!i, and 1 mM DTI in a volume of 100
`µliters. ihe temperature was 37' C. and the reaction
`time 2 hours. The two DNA-fragments were separated
`on a 1 % agarose gel, and the desired fragment was
`isolated.
`Ligation to the Ml3 vector Ml3mpl8:
`The isolated restriction fragment was ligated to the
`bacteriophage vector MI 3mp 18 also cut with the re(cid:173)
`striction endonuclease BamHI in the following reaction
`mixture: Fragment 0.2 µg, vector 0.02 µg, 50 mM Tris(cid:173)
`HCI, pH 7.4, 10 mM MgC!i, 10 mM DTI and 1 mM 35
`ATP in a volume of 20 µliters. 5 µliters of this mixture
`were transformed into the E. coli strain JMlOl. The
`presence of fragment in the vector and the orientation
`of the fragment was determin