NATURE VOL 301 21 APRIL 1983
`
`=n.6-'----- -- - - - -- - - - - - -Lll IERSTONATORE
`amino acid precurSor contains the sequence ol glucagon and
`two 1th1cagon°11k.e polypepddes arranged h• tandem. The pre(cid:173)
`cursor also contains the sequences of se-veral non-pancreatic
`~uCllgon-containing polypeptides which suggests that, in mam•
`mals, both pancreatic and non-pancreatic glucagon and
`ducagon-containing polypeptides may be derived from II com(cid:173)
`mon precursor by tissue-specific processing. We have tenta•
`tively Identified each of the glucagon-llke immunoreactants
`which have been described with respect Co the sequence of
`pro1tlucaaoo and have proposed a scheme for the processing
`of pancreatic proalucagon.
`The structure of pre-proglucagon mRNA was deduced from
`the 1,118 base pair (bp) sequence of the insert in colony pshglu 1
`(Fig. 1). The sequertce contains a single open reading frame
`beginnirtg at the methiouine codon at nucleotides 104-106 (the
`only one in any o( the thretl frames) wh.ich predicts the sequence
`of the 180-amino acid preproglucagon. Thus, the coding region
`of hamster preproglucagon mRNA is 540 nucleotides. The
`3'-untranslated region of the mRNA is 475 bases and contains
`two polyadenylation signals, AAUAAA6 •7 , nucleotides 811-
`816 and 1,098-1,103, beginning 408 and 21 bases, respectively,
`before thi, poly(A) tract. The 5'-untranslated region is at least
`103 nucleotides. Electrophoresis of glyoxylated isld RNA in
`an agarose gel 8 and subsequent hybridization 9 indicated that
`hamster prcproglucagon mRNA is 1,250 bases (data not
`shown). As the cloned cDNA insert is 1,118 nucleotides exclus-
`
`Hamster preproglucagon contains
`the sequence of
`glucagon and two related peptides
`
`Graeme I. BeU, Robert F. Santerre*
`& Guy T. Mullenbach
`
`Chiron Corporation, 4560 Horton Street, EmeryVJlle,
`California 94608, USA and •Division of Molecular and Cell Biology,
`Lilly Research Laboratories, Indianapolis, Indiana 46285, USA
`
`Glucaaon is a 29-amino add polypeptide hormone synthesized
`by the A cells ol the endocrine pancreas1 .... Its primary site of
`action
`Is
`the
`liver wh.ere
`it stimulates glycogenolysts,
`gluconeogenesls and k.etogenesls. In mammals, blosynthetk
`studies have shown that glucaaoo l.s derh•ed from a precursor
`of molecular weight (M,) appronmately 18.000 which Is 6ve
`to six times lar1ter than glucaaon5• Glucagon-conlainine poly•
`peptides and immunoreactants ol various size11 have also been
`de11cnoed from stomach. intestine, brain and salivary &landl,
`Here, we have determined the structure of hamster pancreatic
`preproglucagon from the sequence of its cDNA. This 180·
`
`f ys ar g I la
`"re t
`Angt ortldi
`met lys a!iir,
`I I (!
`Ha111st.,-
`CAe,.OCUlr.<iGCACAGMCACAUCCAMGUUCCCMGl,JQGGCUCCUUCGUCUGCACCUGCUCACCIIGf.UCUCCGCUCAGIJCACMlCIIGf.AGGCAC·,•,!IAAMA,\ ~00 A,\G M C AW
`
`11)
`
`hi! ser hu .ale .g l y
`
`:5t:'!,.
`
`~~=-~ru~===-~-~~~~=~~=--~~-~= • ~ m
`
`!ys arg Jils s.er g i n gly 1'~r phe thr ser as,:i tyr- Sf!f'"
`
`60
`tvr le4J _gto .asp arg lyi ala gl ri glu pl'I• val erg •rp l •u met- H I'),.. !ltn
`
`l y11 erg ser gly vat ~la g1 \J
`l ys
`tvr ,eu &sp ser- 1rg llrg al ■ gin asp pt,• ~• t glt1 1rp lau Mt &'in -thr
`l'f8 arg 11nn arg .a&n u ·n f l e id.a
`l y ~ arg hi s asp glu
`G A~ MC AOO AAC ;.1,c A(I\J ace .... coc CAC GAU GAG
`~~~-*™~~~~~=~M~~~
`
`Gl ucagon -l lk•
`70
`r ~ : :l : :1 ~=~ :2;
`
`lys
`
`100
`90
`80
`l
`pep tlO•
`:: ; : : : :t: his !I& a:1p gly t~r-- ph@ t hr aer Hp val !81"" sar tyr ll!llu
`ly!,
`l y S' l!!ISp gtn !Ila I le l,rs- ssp ph !! va l a-sp ar g l eu
`pti• g h.1 eirg h(s ela glu g l y 1P,r pt,e 1hr se,. -e:.ip vol ser ser tyr-
`!11.11 1'rp 111,1 wiit
`leu glu g l y g!n .era e j n ,'f5 glu pt, ■ H i
`UU\J GMJc Af;G c~c GCU GAA 00(; /..CC uuo ACC AGC GAU GOO AG: LCU UAC U'JG GA,; G0C CAG GW (,CA MG GM uuc Al)\J GCU JJGG C,\!G r,:_o
`
`}85
`
`4 7S
`
`110
`
`illl ■ glv g1ri va l
`lys 91y M9 gly
`
`~=•~
`
`u AM
`p phe pr o 91 u glu ••I t a, 11• v• I gl v g l u lou gl y
`
`h i s •f • osp 9 ly , -., phe ~er a>o glu
`
`c~~--~~~~ww=• ~===~-~ ~=
`
`120
`
`Gl u~•gon -1 lk• pep lid" ;
`
`1eo
`1~0
`1~0
`I lQ gin t hr l y5i 1 le. t1lr o~ ly.s ly~ OC
`le.u
`i le 1eu esp ~vr te.u 4!13 tt1r- o g '0~0 phe 11 OSI'\
`tP\r
`,-,at -oSrl
`t'i"p
`All(; Mi. l,f.G AUil CIJC GAU AGU CUU GCC I-CI'. AGG GAC UUC AUC AAC UGG CUG AW CAA ACC AM AUC ACU GAC MG AAA UAA GllGUGUCAGCAU 6'8
`
`OCACAACOl.(;UIK:ACM CUOCla:CGCCAG\.CACCIJGGGAUGUAGAUUUAAGUllCUAUACAUUUMGAGCUAUAUUUUUGAAGC\JGCAUUC,CUUIJGCAUO l,IGGAUGAAUACAIJ UUCCCU 778
`
`UlMGCAIIUG\IGUAOCCAAI.AGAIJUGUAAA IJGMAUAAA<;UA\IIJI.JCCAGr.-At...Ul/i.AUMGAUAACMCUL<;,\OOAUA UGAAl,GL(lCt.r.,O.,.LiOCACAWUOOc;c~LJCI.Wl.l'J.1AAGOUCC 398
`
`CACCC\IGUUIJAOOUGIJAGCAGCGAGAUUAl/llCIIUCI.IGUGAUAUAAAU\JGUAAAIJCAUllAU\IACAGIJCAC{'.AUCl'.UGCAWGUAAUMCAGMGACAUl1AUGC0UOO!JAGCCGCAGUGG 1018
`
`lJG>.AQCUG('.AGAGAGA(lCUIX:UIICC IIOOAGU::CUUUA~UAMIJGCACtJCA(;CUUIJCAAUGUAIX:G('.GGAI IAGAUUI/A~GAIIOCC AliCCIJUCIIIIAMMAAAAAAAA
`
`00i8---0836/U/ 160716---0JSOl ,llO
`
`© 1983 M•cmill•n Jcumili Ltd
`
`1
`10
`-10
`)eu rri• t gin g l u 111a ssp t)ro se.r ser ser lou
`t:ys sr_g ve l
`l eu Ti a g I"! ser
`ll!lu g l y
`I l e Jeu Jeu vaf
`poroJ n gf l co l\ tl f\ < 1-69)
`es n
`i'l:r g
`t'{t1 Aer .l!tir(J s~u- phe pro
`111 g1y ph• pt, ■ cy11 g f y afa gly gln gfy ier trp g i n 1,1s sier l eu gf" 85p ttu· glu ~ILi
`tVr lh 't' o l ■ 1
`~~-a-~~==~~~=~~=~~~~=-~•w ~ -~ ~ ~ •
`20
`10
`Gluc•!lO"
`40
`tt,r leu ly!i "D51) glu pro erg glu h,u :;a:r ~~m Ale
`iys ar_g hi!: .s ■r g l u Ql'f 1hr pha !ier ,3i:,n asp tyr ~er
`gl'3 al.ii. -1111p 5tt r-
`asp
`met th r-
`pl'-o
`e I e !.f!!!:r gin Thr ewp pr-0 l •u gl u B'5p pro a5p g l11 ) Iv. 115n !)IU 85-p
`
`ly5
`
`l y1
`
`Fig. 1 Primary struc(cid:173)
`ture of hamster pancre(cid:173)
`atic
`preproglucagon
`mRNA
`and
`protein
`ar,d coll\patison with
`anglerlish
`prepro•
`glucagon and porcine
`GLI-1. The predicted
`amino acid ~equence
`of
`ham5ter
`prepro·
`Is numbered
`glucagon
`by desii:,nating the first
`ernino acid of hamster
`GLI•l es 1, The amino
`acids constituting
`the
`signal peptide are given
`negative numbers. The
`basic dipeptides which
`may be involved in pro(cid:173)
`ce45ing are boxed. The
`regions corresponding
`to glucagon and GLP-1
`and -2 are indicated.
`The number of
`the
`nucleotide at the end of
`each line is indicated,
`The
`two AAUAAA
`in
`the 3' -
`sequences
`untranslated region are
`underlined. Hamster
`and anglerfish 14 pre pro~
`glucagon are aligned
`and oolons indicate gaps
`introduced to maximize homolo§s· The amino acid differences between halD8ter and porcine GLt-1 10 (proglucagon (i- 69)) are 111dlcated.
`from islets of Langerhans obtained from the pancreases of 400 female Syrian hamsters (Mesocrice/lls
`Methods: RNA was prepared
`a~ratus)'14 • The tissue preparation was 50% islel:5 and contained ~2 x 107 cells. The yield of poly(A)-containing RNA was 35 µ.g, Double(cid:173)
`stranded eDNA was prepared as described by Land et at." and inserted into the Pstl site of pBR322 using the QC-tailing technique26•
`Transformation of Escherichia coli strain HB101 generated a library or 25,000 letracycline-rcsistant transformants: 1,000 of these were, grown
`in arrays on Whatman 54 I fllter paper27 • Following amplification of the plasmid DNA In situ, the colonies were screened Ior those containing
`glucagon
`sequences
`by
`hybridizationie with
`a
`32P-hibelled
`beptadecadeoxynucleotide29
`pool whose
`sequences
`3'
`GT(T /C) ACC (G/ A)A(A/G/C/T) TAC TA(A/G) TO 5' were complementary to all 32 possible sequences of mRNA encoding glucagon(24~
`29). Two colonies conlaining plasmids with inserts of 1,200 and 1,000 bp hybridized: pshglu 1 and 2, respectively. The colonies were rescreened
`with the insert in -pshglul and no additional hybridizing colonies were observed. The frequency of colonies containing plasmids coding for
`hamster insulin and somatostatin Wllli also determined by hybridization with human insulin3O and somatostatin 15 probes: 20/ 500 and 2/1,000
`colonies hybridized with the insulin and som11tostatin probes, respectively. The sequence of the insert in pshglu1 was determined by the
`procedure of Maxam and Gilbcrt' 1 on both strands except for 165 bp and 210 bp at the S' and 3' ends, re~pectivcly, and across ~ll re5triction
`sites 115ed to initiate sequence determinations. A p.itrial seq11ence of the rnsert in pshglu2 indicated no differences in the region Crom nu<.:leotides
`240 to 329.
`
`MPI EXHIBIT 1019 PAGE 1
`
`Apotex v. Novo - IPR2024-00631
`Petitioner Apotex Exhibit 1019-0001
`
`

`

`N _A_T_UR_ B_V_OL_._J_o2 _ __ , 1_A_P_RIL_ 1_98_3 _
`
`_
`
`h i s ser- g In g I y thr phe thr ser esp
`hi s asp g l u phe glu arg his ala glu gly thr phe t hr ser asp
`his ala us~ gly s•r phe '"' "'P glu
`his sar asp gly t hr phtt thr .&er- g l u
`his se,. asp a I is v~ 1 phe. 'f'tiir ~sp asn
`tyr ala glU gly thr phe ii" ser asp
`h 1 s e I a asp g I y va I pfte thr ser asp
`tyr ala '.OSp ale i l e phe thr aso ser
`
`GI ucagon
`CLP- I
`GLP-2
`Secretln
`VIP
`GIP
`Pfil-27
`~GRf
`
`tyr ser lys tyr leu asp •~• arg arg a l • gin esp ph• v•I gin
`v<1I sor ser tyr l eu 91u 91y 91n "'" ala l y s glu phc I le ala
`ll'l9t asn t hr H e le.lJ asp se,.. teu -alf thr- -erg as,p phe i la asn
`101.1 se:r- arg leu arg asp s.ar iJta ar"g teu gtn arg fnu
`l@f,l gin
`-t-yr t hr arg leu ar9 ly" gin mat ala va l tys t y• +yr leu "'"
`tyr ser ile •I• mot asp l ys l i e arg gin gin asp pha val asn
`leu l ou g ly gin l eu ~or a la l ys lys tvr leu glu
`ph• ••r org
`tyr •rs lys v el !eu gly gin leu sor ale 8rQ lys l•u l eu gin
`
`Glucagon
`GLP-1
`GLP-2
`Secrdln
`VIP
`GIP
`PHl-,7
`pGRF
`
`t rp I eu .. et as11 thr
`trp IOU va l
`lys 1,1ly arg gly
`trp leu I le g i n thr lys- I le thr- b5P l y s lys
`9!y l ~u v o l
`ser i le leu asn-
`tr.p IAI/ leu •la gin 1)'5 g l y
`ser lev I le
`esp 1 le ,net ser arg ~In g i n gly glu see asn g i n glu org 91y
`
`l ys l~s ser asp trp lys: hi• a,n
`
`G1ucegc>n
`GLP-t
`Gl.P-1
`S..cret I n
`VIP
`GIP
`PH l -27
`pGRF
`
`I I• thr gin
`GIP
`a ls ar.9 a l a erg l eu
`pGRf
`Fig. 2 Comparison of the sequences of ham~ter glucagon-like
`polypeptides with other members of the glncagon-secretin family.
`The peptides are: human glucagon (all mammalian glucagons seem
`to have identical sequence~)32; hamster GLP-1 and -2 (thi.s paper);
`porcine ~ecretin, vasoactive intestinal polypeptide (VIP) gastric
`inhibitory polypeptide (GIP) and PHI- 32- 30 ; and human pGRF35 .
`
`ive of the poly(A) tract, it may represent a nearly full-length
`copy of the mRNA. Also, as an approximately 900-base form
`of hamster pancreatic preproglucagon mRNA was not obser(cid:173)
`ved, the proximal AAUAAA, nucleotides 811-816, is not a
`normal signal for polyadenylation.
`The organization of hamster preproglucagon was determined
`by comparing its sequence with that of other glucagon(cid:173)
`containlng polypeptides. This analysis suggested that the first
`20, mainly hydrophobic, amino acids constitute the signal pep(cid:173)
`tide. Thus, hamster preproglucagon is 160 amino acids and its
`predicted molecular weight of 18,675 is in good agreement
`with the value of 18,000 determined by Patzelt et al.i for the
`rat precursor. Glucagon is proglucagon(33- 61) and is flanked
`by S2 and 99 amino acids at its amino and carboxy terminus,
`respectively. Proglucagon(l-69) possesses 90% homology with
`porcine intestinal glucagon-like immunoreactant 1 (GLI-1) or
`
`_ ______ LE 11 rnstoNATtJRt~ - - - - - -- -- - - - -- ---..:..:11;:..1
`glicentinrn and is probably the corresponding hamster protein
`(Fig. 1). Proglucagon(l-30) is 80% homologous to a porcine
`polypeptide, called glicentin-related pancreatic polypeptide
`(GRPP), which is secreted from the pancreas concomitantly
`with gJucagon 11
`. Proglucagon(33-69) h; the pancreatic glucagon
`precwsor initially described by Tager and Steiner12 and which
`Bataille et al. n recently cbaracterized from porcine intestine.
`Because pancreatic; proglucagon contains ll:te sequences of both
`pancreatic and intestinal glucagon-contctining polypeptides, a
`common precursor may be synthesized in both tissues. The
`carboxy-terminal segment of proglucagon, residues 70-160,
`contains two glucagon-like peptides (GLP) of 37 and 35 amino
`acids, GLP-1 and -2 (Fig. 1). Each polypeptide is flanked by a
`pair of basic amino acids which can be -sites of proteolytic
`processing. However, there is no evidence to suggest that the
`Arg-Arg at residues 109, 110 and 124, 125 are cleaved. In
`fact, tbc Arg- Arg ill rtsidues 49, 50 in the glucagon moiety is
`not cleaved. In addition, spacer oligopeptides of 6 and 13
`residues separate glucagon and GLP-1, and GLP-1 and GLP-2,
`respectiveJy. GLP-1 and -2 are related but not identical to
`other members of the glucagon-secretin family of gastro•
`intestinal hormones which have been described (Fig. 2).
`Lund et al. 14 have characterized an anglerfish pancreatic
`preproglucagon. This 124-amino acid preclJfsor (M, 14,500) is
`S6 amino acids smaller than hamster preproglucagon and this
`difference is due to the absence of the 13-antino acid spacer
`peptide and second glucagon-like peptide (GLP-2) in the
`anglerfish precursor (Fig. 1). Interestingly, this is the first
`example in which the organization of a prohormone has not
`been conserved during vertebrate evolution (compare mam(cid:173)
`16
`malian and fish preproinsulin and preprosomatostatin 15
`•
`).
`Also, in contrast to mammals, anglerfish has another prepro(cid:173)
`glucagon of - 12,500 M, (refs 17, 18); however, its sequence
`has not been reported. Thus, there may be at least three
`different types of pancreatic proglucagon in vertebrates. Com(cid:173)
`paring hamster and anglerfish preproglucagon, the signal pep(cid:173)
`tide, the amino-termin;il pe.ptide (corresponding to GRPP),
`glucagon and GLP-1 possess 25, 10, 69 and 48% amino acid
`homology and 47, 33, 76 and 66% nucleotide liomology,
`respectively. The low level of sequence conservation in the
`signal peptide region is not unexpected because the absolute
`sequence of this region is not as important as the maintenance
`
`of its hydtophohic character 19• Although the sequence of the
`amino-terminal peptide, that is, proglucagon(l-.30), is not con(cid:173)
`served, the size is and this segment may be required for proper
`processing of the precursor. Interestingly, in mammals, the
`
`I '
`
`(Oaal
`
`GlP·1 <.<7~l
`
`...
`2'
`""
`_; 5
`I I
`
`I I
`
`69 72
`
`I 11
`e,
`
`GLP· 2 (3.$H)
`
`113aa)
`
`I
`"'
`:
`~
`I
`
`I
`
`I
`
`I
`..
`~
`2'
`I
`
`I
`
`I
`
`11
`...
`~
`s
`I j1M,•10.0001
`
`160
`
`'"° I 1i,..,,,3<ooo)
`
`100
`-rl,1w,~•.soo)
`
`(Al,~3,600)
`
`6'"°°9on (~oa>
`11
`2'
`""
`2'
`I ""
`11
`I
`11
`I
`11
`I
`11
`I
`
`S ectol,ed
`
`a ?ra· l20a;,)
`~
`
`NH2- P-,,lirJe 13Qaa)
`
`I .. ,l
`" !
`I
`
`Soerr-1~
`
`30 3J
`
`I
`
`33
`
`t
`
`,;i
`
`I
`
`Fii:, 3 Schematic representation
`of !he processing of pancreatic pre•
`proglucagon and the structure of
`glucagon-conlaining polypeptides.
`a, Pos~ible pathway for the pro(cid:173)
`teolytic processing of pnncreatic
`proglucagon. The ba~ic dipeptldes
`are indicated and those which arc
`potential sites for cleavage a.re
`dark boxes. The numbers io paren(cid:173)
`theses ar the end of each line are
`the
`sizes of
`the glucagon(cid:173)
`containing
`intermediates deter(cid:173)
`mined by Patzelt et at.5. The nwn(cid:173)
`bers above the lines are the amino
`acids at tbe ends of the polypeptide
`in relation lo the sequence of pre,
`proglucagon (Fig. 1). b, Structure
`of
`non-pancreatic
`glucagon(cid:173)
`containing polypeptides. GU
`8,000 and GLI 12,000 are major
`polypeptide.s in the intestine and
`GLI 9,000 accumulates in the
`serum of animal$ with
`renal
`10
`failure 3
`•
`.
`
`b
`
`GuiWOO(GU~nllnl
`
`I
`
`ou'~.ooo
`
`GUgooo
`
`I
`
`I
`
`••
`11 17
`
`IL i I
`
`61
`
`I
`
`11
`
`© Nature Publishing Group
`1983
`
`108
`
`I
`
`MPI EXHIBIT 1019 PAGE 2
`
`Apotex v. Novo - IPR2024-00631
`Petitioner Apotex Exhibit 1019-0002
`
`

`

`718
`
`[El I ERSTONATURE- - - - --
`
`-
`
`-------'-N-'-""A--TU_ RE_ V_O--L_. J __ 02--'-2l_ A_P_RIL_l_983
`
`sequence of proglucagon(l-30) is conserved to a greater extent
`than the C-peptide of proinsulin. For example, there is 80%
`homology between hamster and porcine proglucagon(l-30) and
`oruy 48% homology between their insulin C-peptides. The
`corresponding values 1n a comparison of hamster and human
`are 83% and 65%, respectively (G.I.B., unpublished). The
`spacer peptide whicb separates glucagon and GLP-1 is 6 amino
`iicids in hamster and 5 in angJerfish and the sequence is different.
`The GLP-1 region possesses extensive homology between ham(cid:173)
`ster and anglerfish, especially the segment corresponding to
`hamster proglucagon(78- 100). However, hamster GLP-1 has
`a 6-amino acid amino-terminal extension which is absent in
`anglerfisb. The sequence conservation in the GLP-1 region
`suggests that this peptide has a biological function. We have
`also compared hamster GLP-2 with the anglerfish OLP and
`they possess only 29% amino add sequence homology. The 5'(cid:173)
`and 31 -untranslated portions of hamster and anglerfish mRNA
`possess no significant regions of homology.
`The pancreas and intestine are the major sites of synthesis
`of glucagon and glucagon -containing polypeptides. Figure 3 is
`a possible scheme for the processing of proglucagon in the
`pancreas. This model is based on the structure of prepro(cid:173)
`glucagon presented here, the sizes and order of appearance of
`intermediates in the proce~sing of ml proglucagon and the
`assumption that processing occurs at basic dipeptides. As indi (cid:173)
`cated, both glucagon and proglucagon(l - 30) are secreted 11.
`However,
`the fate of proglucagon(72-160) and the two
`glucagon-like polypeptides is unknown. Intestinal glucagon(cid:173)
`containing polypeptides are present at less than 1 % the levels
`of pancreatic glucagon and the major polypeptides have Mrs
`of 8,000 and 12,000 (ref. 20). The 8,000-M, protein is GLI-1
`to proglucagon(l-69) (Figs 1, 3). The
`and corresponds
`sequence of the 12,000~M, polypeptide has not been deter(cid:173)
`mined but its size, biochemical and immunological properties3•20
`are consistent wi.th it being proglucagon(l - 108), and thus it
`would include both glucagon and GLP-1 (Figs 1, 3). Io addition,
`a 9,000-M , peptide with glucagon-like immunoreactivity bas
`been described which accumulates in the plasma of animals
`with renal failure 1- 3•20 • Its size, biochemicaJ and immunological
`properties suggest that it may correspond to proglucagon(l - 61)
`(Fig. 3).
`Glucagon and insulin have a major role in the regulation of
`plasma glucose levels. The hlological role(s) of the intestinal
`glucagon•containing polypeptides is unclear although GLl-1
`seems to inh.ibit gastric acid secretioni1. Both the pancreatic
`and intestinal glucagoa-containing polypeptides are probably
`derived from a common precursor which is processed differently
`in these two tissues. The processing of proglucagon can poten(cid:173)
`tially generate at least 11 unique polypeptides, 8 of which have
`been identified biochemically or immunochemically. As the
`sequence of proglucagon !s now known, it will be possible to
`ize polypeptides and to produce antisera to sg ecific
`synth
`segments or polypeptides contained within the precursor 2 • The
`processing of the precursor in different tissues and the function
`of this family of glucagon-containing polypeptides in nonnal
`and disease states can then be critically examined. The
`difference in structure between mammalian and anglerfish pro(cid:173)
`gJucagon is unusual. The presence of an additional glucagon.
`like peptide in the mammalian precursor suggests that duplica(cid:173)
`tion or los of a segment of the proglucagon gene has occurred.
`Examination of the structure of the gene may elucidate the
`evolutionary history of this hormone,
`We thank our colleagues at Lilly Research Laboratories who
`helped in the isolation of the ,islets, Ms M. Quiroga and N.
`Fong for their technical assistance, Dr W. J . Rutter for his
`encouragement and suppport, Drs Ltislie B. Rall and Pablo
`Valenzuela (or their assistance in writing and Dr R. Najarian
`and Ms Maureen Appling who prepared the figures and typed
`the manuscript,
`Rccci.,.d 2 D=mbe.r JQK2; acceplcd 16 Fchr,lary 1983 .
`I l'"oa. P . B•i•i, J. & Foa. N. (e<l•) G/uc~if'n : /tJ R of, in Phy, fology and Clinl<al Medi<lnr
`(Spr1ng,:r, Berlin. ·J9?7).
`
`l , Unger. R . H. &. Orci, 1.,. (eds) 0 /ucaJ!On. Phy,io!ngi•. Pat/, ophyuolon ond M o,pnoloi y of
`1h, pm,maJic .4-C,u (61$,..ricr, ow York, 19U).
`l , Cnnkte, J. M. V/ab<toloRla lll, 85--88 (1980).
`4, U nr;er. R, It. & Orci, L N, w f!n~I. J, M,d. JIM. 15 18- 1524 11981 ).
`5, ll• tzeh. C .. ThMer, H, S .. Carroll, R, S. &( S1eincr. D, F. />lall.rt lNl, 260-266 (1979),
`6, P111udloot, N J. & Brownlee, G. G . Nm,ir, 163, 111--l 14 11976).
`7, FiUtgctald. M, & Shenk. T. C,/1 lf, '2.S 1-260 (1981)
`8. Cannich'lel. 0 . C. & McM0>1or, O, K. Mt1h. lln<Ym- 65, 380-Jlll ilYSO),
`9. Thum••· P. S. Prv,·. natn. A cud, Sd. U.S.A. 71, S20t- 5205 (1980).
`JO. Thim, L. & Moody, A . J. Rc¥11 //11Qt)' P, pa<1~1 1 , 139-- 15011981 ),
`11. Moody, A, J., Hui.t, J. J,. Thim, L. & Llndkoer. Jenson, S, Nollirt 189, 514-51 6 (1981),
`12, Tqer, H . S. & Stcint t, D. F. Ptoc. nuln. A rud. Sci, U ,S,A , 70, 2321- 2325 (19 73),
`13. BataiUc, 0 . ,r al. FEBS L en. J.46, 79-a6 (I 9821.
`J 4. Luad, P. K.. Goodman, R. H .. Dco. P. C. & Hob<n,· r. J. F. p.,,_ _ natn , Aead, Sci. U.5.A.
`79. 345- 349 (l 982).
`IS . Sben, J.. P .. Pic~et, R. L. & Rulle r. W. J. Prw. oulo. Acad. Sd . U.S,A. 19. 4S7S-4S79
`(IV82).
`16. Chan, S. J . ., al J. bioL Ch,01. 256, 1595- 1602 (1981 ).
`17, Lund. I'. K., Goodmn<>, IL H. & Hubcnor, l . I'. J. biol. Chcm. 2!6. 6515~518 (l98Jl.
`18, Shields, D .. Warren, T. G,, Roth,!,. E, & Drenner, M. J, Na,.,,. 211~, 51 1-514 \ 198 1).
`19_ Srelnier, D. F.1 Qu1 rin.J P. S,, Chan, S. J,, Ma.rah, J. & Tarcr. H. S. Ann. N. ) ". Atad, Sci.
`343, 1- )6 l1 98C1).
`20. To¥cr, H, S, & Mork...,, I . J. biol, Cl,, m, Uf, 2'2 29- 22J:l 11979),
`;! I Kirkeg,wd, P. <I ol, /VaM• .207, lS(,- 157 (l.982).
`22 . L<erner, R. A. Na tun ZY9, S9-2-S96 (1982).
`23. Chlrgwin, J, M,. Pn:ybyla , A. U., Macflnn>ld, R. J, ill.. Rut1er, W. J. Bioch«nl.rcry 18,
`5294 -:1199 (1979).
`24. SO/Ile.It<, R F. ,r al, Pto<, "4/11. A t ad. Sri U.S.A. 111, 43j9--4343 ( 198 1),
`25. Lao,d . .H,1 G te1., M., Houser, H., I.ind~n"'aier, W, & Schu1z. G. N1.4d'-lt: A clth Re,,. 9,
`2251- 2266 (1981 ).
`26, Villa- K0tt1 u ofl, L ,iQ/. Proc . •am Acn,( S, i. 1/.S. A 7!, 3 727-3731 (197M),
`27 . Go,.en. J. P .. Siem, R. ft&. Wen~l n) , P. C. N 1«-lel, Ad ru R.n 'T, 21 15- ZU6 (1979).
`28. Comb, M.. Secb" r~, P, H,. Adolm• n. J., Eido11, L. & Herbett, E. Na.n,r, 195, 663-<>66
`(1 98'2).
`29. BeauCllJe, S, L. & C""'lhen, M. I-!, T,•trahtdetm·lt 1t, li, 1859-1862 (l 98l ),
`30. Ben. G. t . ,, ol. Naru,, 212, s2s-sn (l 9·79J.
`31. Malr&m, A. M. & Gilbert, W. Mt1h. Enx, ,.,. 65, 49!> •560 11980),
`32. Day hoff. M. 0 , Arias of Prot,r,, S,q• • • « and Slrud • ,. Vol. 5, Suppl. 2. 125- 126 /Noiion•I
`mo me:d1cal Rcsc.ar~h f oundo ilun. W himdOn. DC. 1976J.
`33 , Tetemoto. K. &. Muu, V, P,r,c. nae•. Ar,,d, Sci. U.S.A. 78. 6603-M07 ( t 9S 11,
`34. Jomval, H.,, al, Rens lA!rL llJ, 205- 216 ll 98 l l.
`5, Gvillecntn, R. ,r at. S l•nu 218, SRS-587 I 1982).
`
`A new troponin T and cDNA clones
`for 13 different muscle
`proteins, found by shotgun sequencing
`Scott D. Putney*, Walter C, Bet_fihyt
`& PaoJ Schimmel*
`,. Department of Biology and t Depan ment of Chemistr y.
`Massachusetts Institute of Technology, Cambridge,
`Massachusetts 02139, USA
`
`Complete amino acid sequences ha'l-'e been established for 19
`muscle-related proteins and these proteins are each sllfficieotJy
`abundant to sugge!lt that their mRNA levels are about 0.4%
`or higber. Based on these considerations, a simple theoretical
`analysis shows that clones for most of these proteins can be
`identified within a complementary DNA library by sequencing
`cD.NA inserts from 150-200 randomly selected clones. This
`procedure shonld not only rigorously identify specific clones,
`but it could also onco'l-'er amino acid sequence '1-'arlants of major
`muscle proteins such u the troponin~•.<1. We have determined
`sequences for about 20,000 nucleotides within 178 randomly
`selected clones of Ii rabbit muscle cDNA library, and report
`here that in addition to firtding sequences encoding the two
`known skeletal muscle isotypes ol troponin C'-9, we have dis(cid:173)
`covered sequences encoding two lorm of troponln T. Over the
`region of nucleotide sequence overlap in the troponin T clones,
`the new isotype diverges slgnlftcantly from its counterpart10•
`Altogether, clones for 13 of the 19 known muscle-specific
`proteins were Identified, in addition to the clone for the new
`troponln T lsotype.
`To identify a clone for a particular protein by DNA sequen(cid:173)
`cing, the nucleotide sequence of a cDNA clone encoding a
`portion of the protein sequence musl be determined. We deter.
`mined sequences of cD A fragments isolated from a library
`or rabbit n1uscle cD A cloned into M 13 phage 11. Before clon(cid:173)
`ing, the cDNA wa.~ restricted with Msp1 , TaqT or Sau3Al so
`that cONA fragments or ~ 250 base pairs (hp) were actually
`cloned. Sequences of - 110 nucleotides from 178 different
`phage inserts were determined. The sequences were translated
`
`0028-0836/ SJ I 1607 J 8--04SO I ,Oil
`
`@ 1 Q8J Macmillan Journ•lf Ltd
`
`MPI EXHIBIT 1019 PAGE 3
`
`Apotex v. Novo - IPR2024-00631
`Petitioner Apotex Exhibit 1019-0003
`
`