CANCER GENOMICS & PROTEOMICS 4: 1-20 (2007)
`
`Transcriptomic Molecular Markers for Screening
`Human Colon Cancer in Stool and Tissue
`FARID E. AHMED1*, PAUL VOS2, STEPHANIE IJAMES3, DONALD T. LYSLE3,
`RON R. ALLISON1, GORDON FLAKE4, DENNIS R. SINAR5, WADE NAZIRI6,
`STEFAN P. MARCUARD7 and RODNEY PENNINGTON8
`
`Departments of 1Radiation Oncology, LSB 003, Leo W. Jenkins Cancer Center and
`5Internal Medicine, The Brody School of Medicine (BSOM)
`at East Carolina University (ECU), Greenville, NC 27858;
`2Department of Biostatistics, School of Allied Health Sciences, ECU, Greenville, NC 27858;
`3Department of Psychology, University of North Carolina, Chapel Hill, NC 27599;
`4Laboratory of Experimental Pathology, National Institute of Environmental
`Health Sciences, Research Triangle Park, NC 27709;
`6Carolina Physicians PA, Greenville, NC 27834;
`7Carolina Digestive Disease, Greenville, NC 27858;
`8Roche Applied Science, Indianapolis, IN 46250, U.S.A.
`
`Abstract. There is a need for sensitive and specific diagnostic
`molecular markers that can be used to monitor early patterns
`of gene expression in non-invasive exfoliated colonocytes shed
`in the stool, and in situ in adenoma-carcinoma epithelium of
`the colon. RNA-based detection methods are more
`comprehensive than either DNA-, protein- or methylation-based
`
`Abbreviations: ATCC, American Type Culture Collection; cDNA,
`copy deoxyribonucleic acid; CD, Crohn’s disease; CEA,
`carcinoembryonic antigen; CGAP, Cancer Genome Anatomy
`Project; CP, comparative cross point; CRC, colorectal cancer; CT,
`computed tomography; DEPC, Diethyl pyrocarbonate; DGED,
`Digital Gene Expression Displayer; E-Method, also referred to as
`Second Derivative Maximum or CP method; EST, expressed
`sequence tag; FOBT, fecal occult blood test; GI, gastrointestinal;
`GLS, Gene Library Summarizer; H&E, Hematoxylin and Eosin
`staining; IBD, inflammatory bowel disease; LCM, laser capture
`microdissection; mRNA, messenger ribonucleic acid; NCI,
`National Cancer Institute; OR, odd ratio; QC, quality control; RT-
`qPCR, reverse transcriptase quantitative polymerase chain
`reaction; rRNA, ribosomal ribonucleic acid; SAGE, Serial Analysis
`of Gene Expression; ss, single stranded; UC, ulcerative colitis;
`UDG, uracil-DNA glycosylase.
`
`Correspondence to: Dr. Farid E. Ahmed, Clinical Professor of
`Molecular Oncology, The BSOM at ECU, Greenville, NC 27858,
`U.S.A. Tel: +252 744 4636, Fax: +252 744 3775, e-mail:
`ahmedf@ecu.edu
`
`Key Words: Adenocarcinoma, colonocyte, diagnosis, IBD, LCM,
`genes, QC, RT-qPCR, RNA.
`
`screening methods. By routinely and systematically being able
`to perform quantitative gene expression studies on these samples
`using less than ten colon cancer genes selected by the enormous
`resources of the National Cancer Institute’s Cancer Genome
`Anatomy Project, we were able to monitor changes at various
`stages in the neoplastic process, allowing for reliable diagnostic
`screening of colon cancer particularly at the early, pre-
`malignant stages. Although the expression of some of the genes
`tested in tissue showed less variability in normal or cancerous
`patients than in stool, the stool by itself is suitable for screening.
`Thus, a transcriptomic approach using stool or tissue samples
`promises to offer more sensitivity and specificity than currently
`used molecular screening methods for colon cancer. A larger
`prospective clinical study utilizing stool and tissue samples
`derived from many control and colon cancer patients, to allow
`for a statistically valid analysis, is now urgently required to
`determine
`the
`true sensitivity and specificity of
`the
`transcriptomic screening approach for this preventable cancer.
`
`Colorectal cancer (CRC) is the second and third most
`common malignancy in men and women, respectively, in
`developed and developing countries, including the United
`States of America (USA) (1, 2). In the USA, an estimated
`106,680 cases of colon and 41,930 cases of rectal cancer are
`expected to occur in 2006, of which 55,170 deaths are
`estimated to materialize, which account for ~10% of all
`cancer deaths. Incidence rates decreased by 1.8% per year
`during 1998-2002 in the USA (Table I), partially reflecting
`increased screening and polyp removal during colonoscopy
`screening. CRC
`incidence rates have been steadily
`
`1109-6535/2007 $2.00+.40
`
`1
`
`Geneoscopy Exhibit 1074, Page 1
`
`

`

`CANCER GENOMICS & PROTEOMICS 4: 1-20 (2007)
`
`Table I. Estimated new and Existing CRC cases, deaths and ncidence rates in the ten States in the USA with the greatest prevalence†.
`
`State
`
`New CRC cases
`in 2006#
`
`Estimated CRC
`deaths in 2006*
`
`CRC Incidence rates,
`1998-2002**
`
`CRC Death rates,
`1998-2002***
`
`California
`Florida
`New York
`Texas
`Pennsylvania
`Illinois
`Ohio
`Michigan
`New Jersey
`Virginia
`
`14,820
`9,970
`9,540
`9,510
`8,000
`6,760
`6,730
`4,930
`4,850
`3,690
`
`5,500
`3,700
`3,540
`3,530
`2,970
`2,510
`2,500
`1,830
`1,800
`1,370
`
`Male
`
`57.2
`64.6
`71.9
`58.5
`74.6
`72.1
`67.1
`64.6
`75.5
`58.5
`
`Female
`
`Male
`
`Female
`
`42.0
`47.9
`52.8
`41.1
`52.3
`51.0
`94.2
`47.9
`53.7
`41.1
`
`21.0
`22.4
`26.2
`23.7
`28.0
`28.0
`27.6
`24.7
`27.4
`25.0
`
`15.2
`15.8
`18.4
`16.2
`19.4
`19.1
`19.2
`17.0
`19.4
`18.2
`
`†Source: Modified from Reference (2). #Estimated new colon cancer cases by sex for all locations in the USA in 2006 are: 106,680 for both sexes
`(49,220 for males and 57,460 for females). Estimated new colon cancer deaths by sex for all sites in the USA in 2006 are 55,170 for both sexes
`(27,870 for males and 27,300 for females). All estimates are rounded to the nearest 10. *Rounded to the nearest ten. **Per 100,000, age adjusted
`to the 2000 USA standard population. ***Per 100,000, age-adjusted to the 2000 US standard population.
`
`decreasing since 1985, from 66 to 52 per 100,000 in 2002 (3).
`Mortality rates from CRC have also decreased in both
`genders over the past two decades at an average of 1.8% per
`year, reflecting declining incidence rates and improved
`survival. The 1- and 5-year relative survival for CRC for all
`stages combined is 83% and 64%, respectively. Survival
`continues to decline beyond 5 years to 5% at 10 years after
`diagnosis (2); thus, early detection contributes significantly
`to the prevention of death from this cancer (4-7).
`The most commonly used screening tests in the USA for
`colon adenomas in men and women, aged ≥50 years old,
`are the fecal occult blood test (FOBT) and colonoscopy.
`The former, although convenient and relatively inexpensive,
`suffers from low sensitivity, whereas the latter – considered
`the gold standard for CRC screening – is expensive and
`requires cathartic preparation and patient sedation, which
`has resulted in a low rate of compliance (8). Computed
`tomographical (CT) colonography (virtual colonoscopy),
`which does not require bowel preparation may be
`considered an adequate alternative only for asymptomatic,
`not at risk individuals, and only if it can effectively improve
`the detection of small lesions (9, 10).
`Cells are continuously shed by colon tumors in the lumen of
`the gastro intestine (GI) (i.e., approximately 1010 normal adult
`colonic epithelial cells, each having a lifespan of 3-4 days, are
`shed daily from the lower two thirds of colon crypts) (11, 12),
`and their detection in the stool has allowed for the
`employment of mutation or other functional genomic
`techniques in their study (1, 6, 13-15). Since CRCs exhibit
`genetic heterogeneity, multitarget approaches employing
`mutations in K-ras, APC and p53, the microsatellite instability
`
`marker Bat-26 and "long" DNA (representing DNA of
`nonapoptotic colonocytes characteristic of cancer cells
`exfoliated from neoplasms, but not normal apoptotic
`colonocytes) have been examined and undergone clinical
`testing
`(13, 16). However, DNA alterations were
`disappointedly detected in only 16 of 31 (51.6%) invasive
`cancer, 29 of 71 (40.8%) invasive cancer plus adenoma with
`high-grade dysplasia, and 76 of 418 (18.2%) in patients with
`advanced neoplasia (tubular adenoma ≥1 cm in diameter,
`polyps with high grade dysplasia, or cancer) (17). Protein-
`based methods are not suited for screening and early diagnosis
`because they are generally not specific, although they may be
`of more value as prognostic markers (18). More recently, by
`employing commercial preparations, we have overcome
`RNA’s lability by stabilizing it within a short period of time
`after samples (e.g., stool, tissue or blood) were removed from
`the body, resulting in a total RNA that was readily reverse-
`transcribable by another commercial preparation making a
`high quality single-stranded (ss) copy (c) DNA suitable for
`expression profiling (19-21). Therefore, the identification of
`new transcriptomic molecular markers with high sensitivities
`and specificities in exfoliated stool samples is now possible.
`
`Materials and Methods
`
`Adenocarcinoma cell line and culture conditions. Adenocarcinoma
`cell line HT-29 is used for validating the range of gene expression
`measurements in stool spiking studies. Cells were obtained from
`the American Type Culture Collection (ATCC), Rockville, MD,
`USA. The cells were propagated in Iscore’s Modified Dulbeccos
`medium (IMDM) (Sigma, St. Louis, MO, USA), supplemented
`with 100 ml/L fetal calf serum, 105 IU/L penicillin and 0.1 g/L
`
`2
`
`Geneoscopy Exhibit 1074, Page 2
`
`

`

`Ahmed et al: Transcriptomic Molecular Markers for Screening Human Colon Cancer in Stool and Tissue
`
`streptomycin in an atmosphere of 5 % CO2 in a humidified
`incubator kept at 37ÆC. Cultures were passed twice per week as per
`ATCC recommendations.
`
`Acquisition of clinical specimens. Stool and tissue samples were
`obtained from twenty control subjects and thirty patients with various
`stages of colon adenocarcinoma (Dukes’ stages 0 to 3), five patients
`with ulcerative colitis (UC) and 5 patients with Crohn’s disease (CD)
`according to an approved ECU Medical Center Institutional Review
`Board (IRB) protocol. All laboratory work was carried out and
`standardized under blind conditions and in accordance with the
`guidelines for handling biohazardous material established by ECU’s
`Biological Safety and Hazardous Substance Committee.
`
`Control stool and tissue samples.
`(i) Fecal specimens. Control stool samples were collected from
`consenting individuals visiting our GI Clinic/Endoscopy Lab who did
`not show any polyps or inflammatory bowel diseases, such as colitis
`or diverticulitis. Stool samples were either processed immediately to
`extract RNA, or stored overnight at 4ÆC in a bacteriostatic
`preservative S.T.A.R medium (Roche Diagnostics, Indianapolis, IN,
`USA), and RNA was extracted within a few days. In situations where
`longer storage of fecal specimens was desired, the preservative
`RNALater®-ICE (Ambion, Austin, TX, USA) was added at 2.5 ml
`per 1 g of stool, followed by freezing of the stool sample at –70ÆC.
`(ii) Tissue specimens. Normal tissues were usually obtained from a
`small piece of colon tissue (about 0.5 cm3) removed >10 cm away
`from diseased patient tissue at surgery (22), or from biopsies taken
`during colonscopy from non-diseased areas of consenting
`individuals. For UC or CD patients, a small piece of tissue taken
`further away from the inflamed or diseased tissue was considered
`normal. Tissues were flash frozen in liquid nitrogen and stored at
`–70ÆC for subsequent laser capture microdissection (LCM) work.
`Longitudinal sectioning of the tissue before LCM use was employed
`in order to pick up only the epithelial cells that would eventually be
`shed as colonocytes into the lamina propria from the bottom of
`epithelial cells among the proliferative enterocyte crypt lineage.
`
`Experimental stool and tissue samples from cancerous or inflamed
`patients.
`(i) Fecal specimens. A 10 g sample of feces (bowel movement) was
`collected the night before surgery or earlier, before administering
`any bowel preparation, in a plastic container containing either: a)
`a bacteriostatic preservative S.T.A.R. medium, which was then
`covered and either processed immediately to extract total RNA or
`stored overnight at 4ÆC then processed the next day for RNA
`extraction, or b) RNALater®-ICE to allow longer storage at –70ÆC,
`then the sample followed either RT-PCR processing or storage of
`the extracted RNA at –70ÆC until further manipulation and PCR
`analysis. Stool processing was standardized for all samples by
`scraping and employing the surface mucinous layer, which is
`usually rich in colonocytes (13).
`(ii) Tissue specimens. A small piece of tissue sample (about 0.5 cm3)
`was obtained after colonoscopy for adenoma, or at surgery for
`carcinoma. Samples were processed after flash freezing in liquid N2
`and storage at –70ÆC for subsequent microdissection. Longitudinal
`LCM sectioning was performed (Figure 1A, B), and the marked
`areas of the crypt indicated where the transformed cells (i.e.,
`adenoma, carcinoma) were to be captured by laser microdissection
`(Figure 1C-E) for subsequent RNA extraction.
`
`For the current study, stool and normal tissue samples were
`obtained from 20 non-cancerous non IBD control individuals, 20
`patients having adenomatous polyps ≥1 cm with high grade
`dysplasia (stage 0-1), 5 patients with stage 2 carcinoma, five
`patients with stage 3 carcinoma, five non-cancerous patients with
`severe UC, and five non-cancerous patients with severe CD. Each
`subject provided a stool sample for a total of 60 stool samples.
`Tissue samples were obtained from only one of the UC patients
`and only one of the CD patients, but were obtained for each of the
`remaining patients, for a total of 52 tissue samples.
`
`Selection of cancerous or inflamed cells from colon tissue of patients
`by LCM. LCM was employed as an enrichment technique for
`tumors isolated from colon adenocarcinoma patients to separate
`transformed cells from nonneoplastic stromal and inflammatory
`cells (23). The frozen tissues, embedded in Tissue Tek OCT
`compound (Sakura, MI, USA) were transported in cold packs to
`Laboratory of Experimental Pathology, National Institute of
`Environmental Health Sciences (NIEHS), Research Triangle Park,
`North Carolina. There, LCM was performed using an Arcturus
`PixCell II system (Arcturus Engineering, Inc., Mountain View,
`CA, USA), which employed a 15 Ìm diameter infrared (IR) laser
`pulse (220 mV, 49 mW) with a duration of 2.2 ms to microdissect
`only the tumor cells (24). Approximately 20,000 cells were
`captured for each preparation. The LCM samples, adhering to the
`thermoplastic polymer film on the plastic cap (Figure 1C-E), were
`sectioned at 6-Ìm in a cryostat and picked up on non-charged
`microscopic slides (Fisher Scientific, Pittsburgh, PA, USA). The
`slides were kept in a slide holder on dry ice, fixed for 30 sec in
`70% ethanol, dipped in distilled water for 15 sec, stained in
`Mayer’s Hematoxylin for 15 sec, rinsed for 15 sec in 1X
`automation buffer, pH 7.5 (Biomeda Corp. Foster City, CA,
`USA), again rinsed in distilled water followed by 70% ethanol for
`30 sec each, counterstained in Eosin Y (Cell Point Scientific,
`Gaithersburg, MD, USA) for 30 sec, followed by dehydration in
`graded ethanol solutions (95, 100 and 100%), 30 sec each, cleared
`by two rinses in xylene, 1 min each, air dried for 5 min, and stored
`in a slide box in a dessiccator for up to 3 h before LCM. Captured
`cells were fitted to a 0.5 ml sterile microcentrifuge tube, and
`returned to ECU in cold packs for RNA extraction.
`
`Manual extraction of total RNA from LCM cells and ss-cDNA
`preparation. This manual procedure was used for extracting RNA
`from a small number of LCM captured cells was carried out
`according to manufacture’s specifications using the RNeasy
`isolation Kit® from Qiagen, Valencia, CA, USA, as previously
`described (19, 21). The quality of RNA was determined on an
`Agilent 2100 Bioanalyzer (Agilent Technologies, Inc, Palo Alto,
`CA, USA) utilizing the RNA 6000 Nano LabChip®, or by
`electrophoresis on Superload (Viagen, Austin, TX, USA) agarose
`gels (25) and RNA quantitated with RiboGreen quantitation
`reagent (26) (Molecular Probes, Eugene, OR, USA). The
`"Sensiscript RT Kit®" from Qiagen was then employed for making
`a copy of ss-DNA, resulting in 40 Ìl of ss-cDNA, of which 2-3 Ìl
`was subsequently amplified by PCR. One hundred thousand
`captured cells on 5 plastic LCM caps (each accommodating 20,000
`cells) was enough to test all the 11 genes of interest, considering
`that each cell contains ~20 pg total RNA or 0.4 pg mRNA
`(equivalent to 0.36 pg ss-cDNA), as only a few picograms of cDNA
`are needed per PCR reaction (27).
`
`3
`
`Geneoscopy Exhibit 1074, Page 3
`
`

`

`CANCER GENOMICS & PROTEOMICS 4: 1-20 (2007)
`
`Figure 1. A) Longitudinal H & E cryostat section of colon adenoma exhibiting high grade dysplasia (i.e., carcinoma in situ, stage 0), 10X. B) As A x 40.
`C-E: LCM displaying dysplastic cells from the above section before being pulsed by an IR laser (C); the middle panel shows same area with dysplastic
`cells removed (D); and the right panel shows removed dysplastic regions on a film cap (E).
`
`Figure 2. A) Representative Superload agarose gel protocol for a stool sample showing a nondegraded RNA. Lane L is molecular marker, and lanes 1
`and 2 are replicas of a 4 ng total RNA of the same stool sample. B) An Agilent 2100 electrophoretogram showing the 28S, 18S and tRNA, 5.8S and 5S
`bands for the same stool sample as in panel A.
`
`4
`
`Geneoscopy Exhibit 1074, Page 4
`
`

`

`Ahmed et al: Transcriptomic Molecular Markers for Screening Human Colon Cancer in Stool and Tissue
`
`Figure 3. Two different relative quantification analysis of the same run for the 2–¢¢C
`T method, upper panel (a) or E-method (b). The final quantification
`results are automatically calculated from the crossing point (CP) values of the target and the reference gene (unknowns and calibrators) as shown in the
`bottom panel (c). Adapted from reference 29.
`
`In
`total RNA from stool samples.
`Automatic extraction of
`collaboration with colleagues at Roche Applied Science
`(Indianapolis, IN, USA), total RNA from stool was automatically
`extracted by the "MagNA pure LCì" automated system. The
`MagNA Pure LCì is a compact benchtop robotic workstation
`programmed to automatically perform separation of nucleic acids.
`Propriety magnetic glass particles are used for separation of RNA,
`followed by transfer of eluted RNA (in a 100 Ìl volume) into a
`storage cartridge, which keeps samples cool at 4ÆC until removed.
`
`The Roche RNA Isolation Kit IIì was used. The machine can
`automatically pipette purified RNA into borosilicate capillaries of
`a LightCycler’s PCR instrument in 2-3 Ìl volume (28) for high
`throughput qPCR analyses.
`Stool samples preserved in bacteriostatic S.T.A.R. medium were
`shipped overnight to Roche in cold packs, and the RNA extracted
`from the samples (100 Ìl eluates kept in 0.5 ml sterile Eppendorf
`tubes) were returned to us overnight in cold packs. The quality and
`yield of the RNA extraction for each sample was determined in an
`
`5
`
`Geneoscopy Exhibit 1074, Page 5
`
`

`

`CANCER GENOMICS & PROTEOMICS 4: 1-20 (2007)
`
`Table II. Primers/universal probes tested in PCR gene amplifications for colon cancer detection in stool and tissue
`
`Primer
`
`Sequence (Sense/Antisense)
`
`Length
`
`Position
`
`Tm* %GC
`
`Amplicon
`
`Probe
`
`GenBank
`Accession #
`
`A. Housekeeping gene standard
`HPRT
`F 5'caacaggcttttcctggtt 3'
`R 5'ggctactctgcccatgaaga 3'
`
`B. Genes highly expressed in SAGE data set
`IGF2
`F 5' gctggcagaggagtgtcc 3'
`R 5' gattcccattggtgtctgga 3'
`F 5' tcgctctcaggaacagca 3'
`R 5' ttaattaaagtcgcaggcaccta 3'
`TGF≤-igh F 5' gacacctttgagacccttcg 3'
`R 5' cttcaagcatcgtgttgagc 3'
`
`FLNA
`
`C. Genes highly expressed in microarray data sets
`CKS2
`F 5' ttcgacgaacactacgagtacc 3'
`R 5' agcctagactctgttggacacc 3'
`F 5' agattctgctaacaaaccttttcaa 3'
`R 5'ggagagaaaaacttctcatgatagc 3'
`F 5' aaaatcatcgaaaagatactgaacaa 3'
`R 5' ggtaagggcagggaccac 3'
`
`CXCL3
`
`CSE1L
`
`22
`21
`
`18
`20
`18
`23
`20
`20
`
`22
`22
`25
`25
`26
`18
`
`114-135
`167-187
`
`653-670
`742-761
`38-55
`93-115
`798-817
`839-858
`
`132-153
`234-255
`1786-1810
`1857-1881
`445-470
`537-554
`
`59
`59
`
`59
`60
`59
`60
`59
`59
`
`59
`59
`59
`59
`59
`60
`
`41
`48
`
`67
`67
`56
`39
`55
`50
`
`50
`55
`32
`32
`27
`27
`
`74 nt
`
`#6 ttcctctg
`
`M21641.1
`
`109 nt
`
`#10 ggaggtgg
`
`NM_000612.3
`
`78 nt
`
`61 nt
`
`#32 ctgctccc
`
`NM_001456.1
`
`#5 tgtggctg
`
`NM_000358.1
`
`124 nt
`
`#25 tggaggag
`
`NM_001827.1
`
`96 nt
`
`#72 ttcctggc
`
`NM_001316.2
`
`110 nt
`
`#4 cttcctgc
`
`NM_002090.2
`
`D. Genes showing increased expression in CGAP cDNA DGED & SAGE DEGD databases
`DPEP1
`F 5' gaggtactcgggaccctgtc 3'
`20
`161-180
`60
`65
`R 5' gcagaaggatgagcttcagg 3'
`20
`209-228
`60
`55
`F 5' actgggagaagcctgtattcc 3'
`21
`133-153
`59
`52
`R 5' ctcatggccaggatctgc 3'
`18
`207-224
`60
`61
`
`KLK10
`
`E. Gene underexpressed in both SAGE and microarray data sets
`GUCA2B
`F 5' ggaccttcagcctgtctgc 3'
`19
`251-269
`R 5' gtcgtcgttagcgatggtc 3'
`9
`308-326
`
`63
`
`60
`59 58
`
`68 nt
`
`#53 tggcagag
`
`NM_004413.1
`
`92 nt
`
`#15 gagcagga
`
`NM_002776.3
`
`76 nt
`
`#11 cttccagc
`
`NM_007102.1
`
`F. Inflammatory gene
`IL-12
`F 5' cactcccaaaacctgctgag 3'
`R 5' tctcttcagaagtgcaagggta 3'
`
`*Melting temperature.
`
`20
`22
`
`435-454
`501-522
`
`60
`59
`
`55
`45
`
`88 nt
`
`#50 gctccaga
`
`NM_000882
`
`Agilent 2100 Bioanalyzer and quantitated using RiboGreen RNA
`reagent. Good preparations showed two sharp ribosomal 18S and
`28S rRNA bands, which corresponded well to the expected sizes of
`1.9 kb and 3.7 kb, respectively, when electrophoresed on Superload
`formaldehyde-agarose gels (Viagen), in addition to smaller peaks
`of 5S rRNA and other micro rRNAs below 0.2 kb (Figure 2A, B).
`
`Extraction of total RNA from HT-29 Cells and ss-cDNA preparation.
`The extraction of total RNA from HT-29 cells to validate the
`detection ability of qPCR was carried out by adding 1 ml of cold
`(4ÆC) TRI REAGENT (TR-118, from Molecular Research Center,
`Inc., Cincinnati, OH, USA) to 106 cells, extracting the total RNA
`according to the manufacturer’s specifications. The extracted RNA
`was divided into several aliquots and stored at –20ÆC in diethyl
`pyrocarbonate (DEPC)-treated water, and screened for RNA
`integrity with the Agilent 2100 Bioanalyzer. RNA was quantitated
`using RiboGreen RNA quantitation reagent.
`Single-stranded-cDNA from RNA extracted from HT-29 cells
`was made by heating 54 Ìl of a solution containing 5 Ìg total RNA
`
`in DEPC-treated water at 94ÆC for 5 min, followed by placing the
`sample on ice and adding 3 Ìl of oligo dT12-18 primer (0.5 Ìg/Ìl),
`18 Ìl of first-strand buffer (Invitrogen Life Technologies, Carlsbad,
`CA, USA), 7.5 Ìl of ribonuclease inhibitor (10 Ìg/Ìl) (Invitrogen),
`4.5 Ìl of dNTP mix (2.5 mM), and 7.5 Ìl of Superscript III RNase
`H– reverse transcriptase (200 U/Ìl) (Invitrogen), total volume 90
`Ìl. The reaction was incubated at 37ÆC for 1 h and stopped by
`heating at 94ÆC for 5 min (20). The QIAquick® cleanup kit
`(Qiagen) was used to remove the RT enzyme and cDNA was
`eluted with two washes of 50 Ìl of kit buffer.
`
`Two-step polymerase chain reaction on ss-cDNA. Both conventional
`(qualitative end-point PCR) and real-time qPCR were used to
`study the expression of selected genes in a two-step RT-PCR, as
`this method is preferable to the one-step RT-PCR for experiments
`requiring the same RT product to be used for analysis of multiple
`transcripts (19, 24).
`(i) Qualitative end-point PCR. Qualitative endpoint PCR on
`representative samples was carried out in an Applied Biosystem
`
`6
`
`Geneoscopy Exhibit 1074, Page 6
`
`

`

`Ahmed et al: Transcriptomic Molecular Markers for Screening Human Colon Cancer in Stool and Tissue
`
`Table III. Genes tested for aberrant expression in stool and tissue samples.
`
`Gene
`
`Full Name
`
`Gene
`(cancer)*
`
`Total
`(cancer)*
`
`Gene
`(normal)*
`
`Total
`(normal)*
`
`OR
`
`p-value** GenBank #
`
`A. Housekeeping gene standard
`HPRT*** Hypoxanthine phosphoribosyl transferase
`
`M21641
`
`B. Genes highly expressed in SAGE data set (from reference 62)
`IGF2
`Insulin-like growth factor II
`0
`98089
`FLNA
`Filamin A, ·
`0
`98089
`TGF‚-igh
`Transforming growth factor
`‚-igh induced
`
`98089
`
`0
`
`179
`131
`
`59
`
`49
`
`41
`
`15
`
`643586
`643586
`
`Infinity
`Infinity
`
`0.00
`0.00
`
`NM_000612
`NM_001456
`
`643586
`
`Infinity
`
`0.00
`
`NM_000358
`
`643586
`
`Infinity
`
`0.00
`
`NM_001827
`
`643586
`
`Infinity
`
`0.00
`
`NM_001316
`
`643586
`
`Infinity
`
`0.12
`
`NM_002090
`
`C. Genes highly expressed in microarray data sets (from references 66 to 81)
`CKS2
`CDC28 protein kinase
`0
`98089
`regulatory subunit
`2
`Chromosome segregation
`0
`1-like
`Chemokine (C-X-C motif)
`Ligand 3
`
`98089
`
`98089
`
`0
`
`CSE1L
`
`CXCL3
`
`D. Genes showing increased expression in CGAP cDNA DGED & SAGE DEGD databases
`DPEP1
`Dipeptidase 1
`0
`98089
`24
`643586
`KLK10
`Kallikrein 10
`0
`98089
`23
`643586
`
`Infinity
`Infinity
`
`0.00
`0.00
`
`NM_004413
`NM_002776
`
`E. Gene underexpressed in both SAGE and microarray data sets (from references 64 and 68)
`GUCA2B Uroguanilyn
`57
`98089
`0
`643586
`
`0
`
`0.00
`
`NM_007102
`
`F. Inflammatory gene
`IL-12
`Interleukin-12
`
`0
`
`98089
`
`0
`
`643586
`
`Infinity
`
`–
`
`NM_000882
`
`*Parameters employed in the DGED gene selection tool (http://cgap.nci.nih.gov/Tissues/Significance) to calculate the odd ratio (OR): Total
`(cancer)/Gene (cancer) (89). Total (normal)/Gene (normal). **Obtained from virtual Northern blot of CGAP database (89). ***Low copy number
`housekeeping gene standard.
`
`9600 thermocycler (Foster City, CA, USA) to validate the
`amplified products. A master mix was used containing final
`concentrations of 1X high fidelity PCR buffer, 0.2 mM dNTP, 2
`mM MgSO4, 0.4 Ìm forward and reverse primers, 0.1 ng ss-cDNA
`template and 1 U of "hot start" Platinum High Taq DNA
`polymerase (Invitrogen) in a final volume of 25 Ìl in a 100 Ìl
`plastic PCR tube. Running conditions were: one cycle at 94ÆC for
`3 min to activate the hot start Taq, 35 cycles of 94ÆC denaturation
`for 45 sec, 55ÆC annealing for 1 min and 72ÆC elongation for 1 min
`each, followed by one elongation/extension cycle at 72ÆC for 7 min.
`Reactions were placed in wells of a 1% agarose gel immersed with
`1X Tris-acetate EDTA (TAE) gel running buffer
`in an
`electrophoresis apparatus (5 V per cm), stained with ethidium
`bromide (0.25 Ìg/ml final concentrations) and visualized using an
`Alpha Innotech charge-coupled device (CCD) based imaging
`system (San Leandro, CA, USA).
`(ii) Semi-quantitative real-time PCR. The comparative cross point
`(CP) method, also called the E-method (29), for semi-quantitative
`PCR analysis was carried out using the Roche’s LightCycler
`(LCì), model 2.0 PCR instrument, utilizing the LC Relative
`Quantification Softwareì (30, 31). The method uses standard
`curves, in which the standard concentrations are plotted versus the
`threshold cycles, to calculate the unknown samples automatically
`without user input (Figure 3) (29, 32-34).
`
`Selection of primer, probes, genes and PCR conditions. A web-
`based assay design software was used for selecting target-specific
`PCR primers. This employs the Primer3 software (http://
`frodo.wi.mit.edu/primer3/primer3_code.html) with compatible
`sterically-modified short probes, and contains 90 pre-validated
`dual-labeled detection probes that target 98% of all human
`mRNA transcripts annotated in the RefSeq database at the
`USA’s National Center for Biotechnology Information (NCBI)
`(35). The probes are short (only 8-9 nucleotide long) and the four
`nucleotide bases have been substituted with high affinity
`nucleotide analogs (e.g., locked nucleic acid, LNA, which are
`conformationally locked in a C3’-endo/N-type sugar conformation
`that
`leads
`to
`reduced conformation
`flexibility). These
`conformational restraints raise melting temperatures to ~80ÆC
`under standard hybridization conditions, which assures duplex
`stability and specificity in real-time RT-qPCR assays, as even a
`single mismatch with the potential target affects binding and
`prevents generation of signal (36, 37). The ProbeFinder web-
`based assay design software
`is accessible at Exiqon site
`(http://www.universalprobelibrary.com), or via the Roche Applied
`Science home page (www.roche-applied-science.com).
`Table II shows the probe and primer sequences generated for
`use in this study employing the above websites. Whenever non-
`intron-spanning assays were performed, DNase-treated RNA
`
`7
`
`Geneoscopy Exhibit 1074, Page 7
`
`

`

`CANCER GENOMICS & PROTEOMICS 4: 1-20 (2007)
`
`and extension at 72ÆC for 1 sec. Control samples (negative
`control) to exclude contamination, in which cDNA was replaced
`by H2O, were run in parallel with each experiment.
`
`Detection sensitivity of gene expression. A validation study was
`carried out to establish the lower limits of detection (sensitivity) of
`the expression of the HPRT gene in HT-29 cells added to stool of
`a normal subject that was collected four days earlier and stored at
`4ÆC. As colonocytes are precipitously lost after more than one day
`of fecal storage (13), any nucleic acid found in the employed stool
`will be due to bacteria and that extracted from spiked HT-29 cells.
`In that study, HT-29 cells were spiked and thoroughly mixed in a
`mortar using a pestle with 1 g of human stool at 100, 101, 102, 103
`and 104 cells, and because on average 2% of the total RNA is
`mRNA, the number of cells present in 1 g of stool corresponded
`to ~0.4 pg, 4 pg, 40 pg, 0.4 ng and 4 ng of mRNA, respectively,
`considering that each cell contains ~20 pg total RNA (27). The
`cells were allowed to remain in the harsh stool environment
`(containing PCR inhibitors such as heme derivatives, bile acids,
`and complex polysaccharides) for 4 h at 4ÆC, before extraction of
`RNA, thereby mimicking the real stool collection conditions.
`DNase (Invitrogen) treatment of the stool was then carried out to
`guard against any amplification of genomic DNA contaminant in
`stool, followed by RT and real-time qPCR detection of the HPRT
`gene. Various concentrations of an initial RNA, instead of a
`cDNA, were employed to guard against errors due to different
`cDNA synthetic reactions (24). Each point was run in triplicate.
`
`Amplification specificity of studied genes. The amplification specificity
`on all eleven genes studied was evaluated by running 1% agarose
`gels on products of endpoint PCR in parallel with real time PCR to:
`(i) confirm and determine the analytical specificity of the RT-PCR
`reaction, and (ii) verify the ability of the Universal probes – specific
`for studied genes – to bind the PCR product. We performed a
`conventional 25 Ìl qualitative endpoint PCR reaction, running 10 Ìl
`of the reaction product on an agarose gel, followed by transfer the
`DNA into a Biotranì Nylon membrane (ICN, Irvine, CA, USA)
`using a downward capillary transfer. After crosslinking the DNA to
`membranes by UV at 100 mJ/cm2, a short hybridization probe –
`specific for the internal sequence of the PCR product end-labeled
`with digoxigenin – using terminal deoxynucleotidyl transeferase
`(Promega Corporation, Madison, WI, USA) was prepared and
`hybridized. The signal was detected by chemiluminescence using
`alkaline phosphatase-conjugated anti-digoxigenin antibody and
`CDP-star substrate (Roche Diagnostics). Digital capture of light
`emission was carried out using Alpha Innotech chemiluminescent
`imaging instrument (San Leandro, CA, USA).
`
`Quality control (QC) considerations and optimization for the PCR.
`QC procedures were employed to ensure the uniformity,
`reproducibility and reliability of the PCR reaction. Random
`variability was minimized by running triplicate samples and
`averaging the data. Variability due to operator error was minimized
`by using a cocktail of reagents (i.e., master mix). To compensate for
`various variabilities, we implemented QA methods that minimized
`intra- and inter-assay and intra-subject variations, intralaboratory
`differences, statistical variations; analytical sensitivity for minimum
`detection level and normal control population variation for both
`stool and tissue samples (38). To prevent suspect carry-over, we
`used a method for preamplification inactivation of amplified DNA
`
`Figure 4. Relationship between fluorescence (F2/F1) versus cycle number
`for stool having HT-29 cells added at 1 cell (curve #1), 10 cells (curve
`#2), 100 cells (curve #3), 1,000 cells (curve #4), and 10,000 (curve #5)
`cells, thoroughly mixed and kept for 4 h at 4ÆC with 1 g of stool devoid of
`any colonocytes, before total RNA extraction. In this real-time RT-qPCR
`validation experiment that measures the amplification of human HPRT
`gene, the concentrations of calculated mRNA employed corresponding to
`the above number of cells were estimated to be ~0.4 pg, 4 pg, 40 pg, 0.4
`ng and 4 ng, respectively. These values also correspond to ss-cDNAs of
`0.36 pg, 3.6 pg, 36 pg, 0.36 ng and 3.6 ng, respectively.
`
`preparations were used. The selected primers were also validated
`using the Basic Local Alignment Search Tool (BLAST) from the
`National Center
`for Biotechnology Information (NCBI)
`(http://www.ncbi.nlm.nih.gov/BLAST/). It was also important to
`determine whether folding of the mRNA might interfere with
`primer access during the RT step using the Mfo