1/9/24, 2:46 PM
`
`Analysis of promoter methylation in stool: A novel method for the detection of colorectal cancer - Clinical Gastroenterology and Hep…
`
`Log in
`
`
`
` Search for...
`
`ORIGINAL ARTICLES
`
`Analysis of promoter methylation in stool: A novel method for the
`detection of colorectal cancer
`Konstanze Lenhard • Guido T. Bommer • Silke Asutay • ... Burkhard Göke • Rolf Lamerz •
`•
`Frank T. Kolligs   •
`Published: January 12, 2005 • DOI: https://doi.org/10.1016/S1542-3565(04)00624-X
`
`PlumX Metrics
`
`Background & Aims: Detection of tumor-derived DNA alterations in stool is an intriguing new
`approach with high potential for the noninvasive detection of colorectal cancer (CRC). Because of
`heterogeneity of tumors, usually multiple markers distributed throughout the human genome need to
`be analyzed. This is labor intensive and does not allow for high through-put screening. Therefore,
`markers with high sensitivity and good specificity are needed. We explored the potential of a single
`epigenetic marker in comparison with fecal occult blood testing (FOBT) for the discrimination of
`patients with CRCs and adenomas from those without. Methods: Methylation-specific polymerase
`
`
`chain reaction (PCR) was performed to analyze hypermethylated in cancer 1 (HIC1) promoter
`
`https://www.cghjournal.org/article/S1542-3565(04)00624-X/fulltext
`
`1/27
`
`|
`
` VOLUME 3, ISSUE 2
`
`,
`
`P142-149,
`
`FEBRUARY 2005
`
`Download Full Issue
`
`1
`
`1
`
`Show all authors
`
`Show footnotes
`
`Geneoscopy Exhibit 1073, Page 1
`
`

`

`1/9/24, 2:46 PM
`Analysis of promoter methylation in stool: A novel method for the detection of colorectal cancer - Clinical Gastroenterology and Hep…
`methylation status in a blinded fashion in stool samples from 26 patients with CRC, 13 with
`adenoma ≥1 cm, 9 with hyperplastic polyps, 9 with chronic inflammatory bowel disease, and 32 with
`endoscopically normal colon. Results: Ninety-seven percent of the stool samples contained
`amplifiable DNA. Forty-two percent of the samples from patients with CRC and 31% of the samples
`from patients with colorectal adenoma ≥1 cm were positive for HIC1 promoter methylation. No
`methylated HIC1 promoter DNA was detected in the fecal DNA from patients with endoscopically
`normal colon or hyperplastic polyps. Conclusions: The epigenetic marker HIC1 promoter
`methylation carries high potential for the remote detection of CRCs. We postulate that a panel of
`merely a few genetic and epigenetic markers will be required for the highly sensitive and specific
`detection of CRCs and adenomas in fecal samples from affected patients.
`
`Abbreviations used in this paper:
`
`CI (confidence interval), CRC (colorectal cancer), FOBT (fecal occult blood test), HIC1
`(hypermethylated in cancer 1), MSP (methylation-specific PCR), PCR (polymerase chain reaction)
`
`Colorectal cancer (CRC) is one of the leading causes of cancer-related morbidity and mortality.1
`About 40% of patients die within 5 years of being diagnosed. This mainly is attributable to late
`presentation with locally advanced or metastatic disease in one third of cases, precluding curative
`surgery.2 The majority of CRCs follow the adenoma-carcinoma sequence, requiring a time period of
`usually more than 10 years.3 Detection of early disease and precancerous adenomatous lesions
`leads to a decrease of CRC-related mortality.4, 5, 6, 7 Therefore, there is a strong rationale for
`screening programs. Sigmoidoscopy, colonoscopy, and fecal occult blood test (FOBT) alone or in
`combination with endoscopy, are recommended for screening of the average-risk population.8
`However, FOBT, when applied regularly, can decrease CRC mortality by only 15%–33%.5, 6, 7
`Compliance with endoscopic screening is not satisfactory. Overall, in 1998, only 37% of eligible
`adults in the United States had been screened for CRC in the previous 3 years.9
`
`Detection of tumor-derived genetic changes in stool is a promising new approach for CRC
`screening. Studies published so far focus on the detection of mutations in oncogenes,10, 11, 12, 13,
`14, 15, 16 and tumor-suppressor genes,17, 18, 19 as well as changes in microsatellite markers.20
`Two recent studies required the analysis of up to 15 different genetic markers21 or 144 aliquots
`from each stool18 for the detection of 91% and 61% of cancers and 82% and 50% of adenomas ≥1
`cm, respectively. This precludes their application for routine high throughput screening owing to high
`
`
`labor intensity and costs. The identification of new markers with high sensitivities and specificities is
`
`https://www.cghjournal.org/article/S1542-3565(04)00624-X/fulltext
`
`2/27
`
`Geneoscopy Exhibit 1073, Page 2
`
`

`

`1/9/24, 2:46 PM
`Analysis of promoter methylation in stool: A novel method for the detection of colorectal cancer - Clinical Gastroenterology and Hep…
`needed. So far, little attention has been paid to DNA hypermethylation as a potential stool marker for
`CRC.
`
`Methylation of CpG islands of promoters leads to silencing of transcription of the affected gene.22,
`23 Methylation-specific polymerase chain reaction (PCR) (MSP)24 has been used successfully to
`detect DNA methylation in primary tumors and in various body fluids.25 The feasibility of
`amplification of methylated DNA from stool samples of patients with CRC has been reported.26, 27
`In one study evaluating several potentially methylated genes, SFRP2, SFRP5, and PGR were found
`to be methylated differentially in the stool of patients with CRC.27 Of these markers, SFRP2 was
`found to be the most sensitive fecal methylation marker, detecting 77%–90% of CRCs. However,
`specificity of SFRP2 methylation was quite poor, at 77%. Therefore, identification of both sensitive
`and highly specific methylation markers is required before MSP can be evaluated as a stool-based
`screening procedure for CRC in prospective studies.
`
`We studied the potential of hypermethylated in cancer 1 (HIC1) promoter methylation as a stool-
`based DNA marker. The promoter of HIC1, a candidate tumor-suppressor gene localized on
`17p13.3 and the first gene cloned based on the finding of CpG island hypermethylation in cancer,28,
`29 frequently is methylated in CRC,30 but not in normal or aging colonic tissue.31 We show that
`HIC1 promoter methylation can be detected frequently and with high specificity in stool samples
`from patients with CRCs. The combination of HIC1 methylation analysis with FOBT allowed for the
`detection of two thirds of CRCs.
`
`Materials and methods
`
`Patients and stool samples
`
`The investigation was approved by the ethical committee of the Medical Faculty of the University of
`Munich. Stool samples were collected preoperatively from patients with verified CRCs (Table 1), and
`before endoscopy from patients with adenomas ≥1 cm (Table 2), endoscopically normal colons,
`hyperplastic polyps, and chronic inflammatory bowel disease (Table 3). Most patients with CRCs
`had been referred with a known diagnosis, all persons with adenomas and normal colons were
`asymptomatic and underwent colonoscopies for surveillance reasons.
`
`Table 1 Clinicopathologic Data and HIC1 Methylation Status of Patients
`With CRC
`
`
`
`
`https://www.cghjournal.org/article/S1542-3565(04)00624-X/fulltext
`
`3/27
`
`Geneoscopy Exhibit 1073, Page 3
`
`

`

`1/9/24, 2:46 PM
`
`Analysis of promoter methylation in stool: A novel method for the detection of colorectal cancer - Clinical Gastroenterology and Hep…
`
`No.
`
`Sex
`
`Age (y)
`
`UICC
`stage
`
`1
`
`2
`
`3
`
`4
`
`5
`
`6
`
`7
`
`8
`
`9
`
`M
`
`F
`
`M
`
`M
`
`M
`
`M
`
`M
`
`F
`
`M
`
`71
`
`75
`
`66
`
`69
`
`65
`
`56
`
`63
`
`72
`
`74
`
`IV
`
`III
`
`IV
`
`II
`
`III
`
`IV
`
`IV
`
`III
`
`III
`
`Localization
`
`Sigmoid
`colon/rectum
`
`Sigmoid colon
`
`Descending/sigmoid
`colon
`
`Ascending colon
`
`Transverse colon
`
`Rectum
`
`Ascending colon
`
`Cecum
`
`Sigmoid
`l
`/
`
`t
`
`Symptoms
`a
`
`HIC
`me
`
`1
`
`1, 3
`
`0
`
`0
`
`0
`
`1
`
`2
`
`2
`
`0
`
`−
`
`−
`
`−
`
`+
`
`+
`
`+
`
`−
`
`+
`
`−
`
`UICC, International Union Against Cancer; M, male; F, female; NA, no amplification.
`
`a 0, no symptoms; 1, change in bowel habits; 2, blood admixed with stool; 3, abdominal pain; 4, anemia.
`
`Open table in a new tab
`
`Table 2 Clinicopathologic Data and HIC1 Methylation Status of Patients
`With Adenomatous Polyps
`
`https://www.cghjournal.org/article/S1542-3565(04)00624-X/fulltext
`
`
`
`
`
`4/27
`
`Geneoscopy Exhibit 1073, Page 4
`
`

`

`1/9/24, 2:46 PM
`
`Analysis of promoter methylation in stool: A novel method for the detection of colorectal cancer - Clinical Gastroenterology and Hep…
`
`No.
`
`Sex
`
`Age (y)
`
`Diagnosis
`
`HIC1
`methylation
`
`FOBT
`
`72
`
`63
`
`63
`
`76
`
`83
`
`65
`
`Tubular adenoma,
`ascending colon, 3 cm
`
`Tubulovillous adenoma,
`ascending colon,
`hepatic flexure, sigmoid
`colon, 1–1.5 cm
`
`Tubulovillous adenoma,
`ascending colon, 2 cm
`
`Tubulovillous adenoma,
`ascending and
`transverse colon, 1, 3,
`4 cm
`
`Tubulovillous adenoma,
`transverse colon, 3 cm
`
`Tubulovillous adenoma,
`sigmoid colon, 1.5 cm
`
`+
`
`−
`
`−
`
`+
`
`−
`
`−
`
`−
`
`−
`
`−
`
`+
`
`−
`
`−
`
`27
`
`28
`
`29
`
`30
`
`31
`
`32
`
`M
`
`F
`
`M
`
`M
`
`M
`
`F
`
`M, male; F, female.
`
`Open table in a new tab
`
`Table 3 HIC1 Methylation Status of Healthy Controls and Patients With
`Nonneoplastic Disease
`
`https://www.cghjournal.org/article/S1542-3565(04)00624-X/fulltext
`
`
`
`
`
`5/27
`
`Geneoscopy Exhibit 1073, Page 5
`
`

`

`1/9/24, 2:46 PM
`
`Analysis of promoter methylation in stool: A novel method for the detection of colorectal cancer - Clinical Gastroenterology and Hep…
`
`No.
`
`Sex
`
`Age
`
`Diagnosis
`
`HIC1 methylation
`
`FOBT
`
`40
`
`41
`
`42
`
`43
`
`44
`
`45
`
`46
`
`47
`
`48
`
`49
`
`F
`
`F
`
`F
`
`M
`
`M
`
`F
`
`M
`
`F
`
`F
`
`M
`
`61
`
`61
`
`73
`
`63
`
`47
`
`41
`
`53
`
`59
`
`73
`
`36
`
`Normal
`
`Normal
`
`Normal
`
`Normal
`
`Normal
`
`Normal
`
`Normal
`
`Normal
`
`Normal
`
`Normal
`
`−
`
`−
`
`−
`
`−
`
`−
`
`−
`
`−
`
`−
`
`−
`
`−
`
`F, female; M, male; ND, not determined; NA, no amplification.
`
`Open table in a new tab
`
`+
`
`−
`
`−
`
`−
`
`−
`
`−
`
`−
`
`+
`
`−
`
`−
`
`Stool samples were collected before cathartic preparation for scheduled surgery or colonoscopy. A
`period of at least 12 days was respected between previous biopsy examinations of colorectal
`tumors before stool sampling. Samples were received within 10 hours after defecation at the
`laboratory, aliquoted, and stored at −80°C.
`
`Isolation of DNA
`
`Stool samples were thawed on ice and DNA was isolated using the QiaAmp DNA Stool Mini-Kit
`(Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Briefly, DNA was isolated
`
`
`
`https://www.cghjournal.org/article/S1542-3565(04)00624-X/fulltext
`
`6/27
`
`Geneoscopy Exhibit 1073, Page 6
`
`

`

`1/9/24, 2:46 PM
`Analysis of promoter methylation in stool: A novel method for the detection of colorectal cancer - Clinical Gastroenterology and Hep…
`from stool samples of approximately 200 mg, and purified DNA was eluted from the column in 50 μL
`of deionized water. The total yield of DNA was determined by ultraviolet absorbance at 260 nm; the
`range of DNA concentrations was 120–300 ng/μL. Leukocyte DNA was extracted with the Qia-Amp
`Blood Mini Kit (Qiagen) according to the manufacturer’s recommendations. Microdissected paraffin-
`embedded sections of normal colon and CRCs were treated with lysis buffer containing .5% Tween
`20 (Sigma, Taufkirchen, Germany), 20 μg proteinase K (Sigma), 50 mmol/L trizma base at pH 8.9,
`and 2 mmol/L ethylenediaminetetraacetic acid. After overnight incubation at 56°C, proteinase K was
`heat inactivated. Samples were subjected to phenol:chloroform/chloroform DNA extraction twice,
`chloroform extraction, and ethanol precipitation. Precipitated DNA was dissolved in Tris-
`ethylenediaminetetraacetic acid buffer and stored at 4°C.
`
`Methylation-specific polymerase chain reaction
`
`MSP is based on a 2-step process.24 First, DNA is treated with sodium bisulfite, which efficiently
`converts unmethylated cytosine to uracil but leaves methylated cytosines unchanged.
`Consequently, after treatment, methylated and unmethylated alleles have different sequences.
`Second, allele-specific primers allow for the specific amplification of methylated and unmethylated
`alleles.
`
`A total of 2 μg DNA from peripheral blood leukocytes, microdissected colonic tissues, and stool was
`diluted to 50 μL of distilled water. Then 2 μg of salmon sperm DNA was added as a carrier to stool
`and tissue DNA. DNA was denaturated by .2 mol/L NaOH for 15 minutes at 37°C. A total of 30 μL of
`10 mmol/L hydrochinone (Sigma) and 520 μL of 3 mol/L sodium bisulfite (Sigma) at pH 5 were
`added, and the samples were incubated for 16 hours at 50°C. After bisulfite treatment, DNA was
`purified using the Wizard DNA Clean-up System (Promega, Mannheim, Germany), following the
`manufacturer’s protocol, and incubated for 5 minutes at room temperature with .3 mol/L NaOH. DNA
`was ethanol-precipitated and resuspended in 50 μL of deionized water and stored at −80°C for up to
`8 weeks.
`
`Primers were designed to discriminate between methylated and unmethylated alleles. Primers were
`designed to hybridize to the CpG-rich region of the HIC1 promoter 1b (Figure 1A), which is affected
`by methylation in carcinomas.31 All PCR reactions were performed in a blinded fashion. The person
`performing the reactions was not aware of the diagnosis of the patients. A 2-step nested PCR was
`established to improve sensitivity. The methylated and unmethylated primer pair sequences for the
`first-step PCR were as follows: 5′-TTAGGTATTGAAGTTGTGAAGTTGT-3′ (unmethylated forward),
`5′-ACCATAACAACCAATAAAATACACC-3′ (unmethylated reverse), 5′-
`GTTAGGTATCGAAGTCGTGAAGTC-3′ (methylated forward), and 5′-
`
`
`
`
`
`https://www.cghjournal.org/article/S1542-3565(04)00624-X/fulltext
`
`7/27
`
`Geneoscopy Exhibit 1073, Page 7
`
`

`

`1/9/24, 2:46 PM
`Analysis of promoter methylation in stool: A novel method for the detection of colorectal cancer - Clinical Gastroenterology and Hep…
`TTACCATAACAACCGATAAAATACG-3′ (methylated reverse). The second-step PCR was performed
`with the following primers: 5′-GAAGTTGTGAAGTTGTTTGTGTAG -3′ (unmethylated forward), 5′-
`ACTTAACAACCACACTCACCA -3′ (unmethylated reverse), 5′-
`GAAGTCGTGAAGTCGTTTGCGTAG -3′ (methylated forward), and 5′-
`ACTTAACAACCGCGCTCGCCG -3′ (methylated reverse). The sizes of the first- and second-round
`PCR products were 231 and 181 bp, respectively.
`
`Figure thumbnail gr1
`
`Figure 1 (A) Location of the amplified region (underlined) of the HIC1 promotor by MSP. (B) Detection of unmethylated ()
`
`and methylated () HIC1 promoter DNA in primary CRCs, (C) normal colonic epithelium, and (D) human peripheral blood
`
`leukocytes. (E) Analysis of sensitivity of the HIC1 MSP assay. Indicated genome equivalents of fully methylated DNA were
`
`spiked into normal stool DNA.
`View Large Image | Download (PPT)
`
`Both PCRs were performed in 20 μL reaction volumes containing 1 × PCR buffer (Qiagen), 4
`mmol/L MgCl , 250 μmol/L deoxynucleotide triphosphate mixture (Invitrogen), 1 μmol/L of each
`2
`primer, 1 × Q-Solution (Qiagen), 2 μL bisulfite-treated DNA, and 1.7 units taq DNA polymerase (Hot
`Star Taq; Qiagen). Thermocycler conditions for the first-step PCR were as follows: 95°C for 15
`minutes (95°C for 30 s; 60°C for unmethylated and 56°C for methylated primers for 30 s; 72°C for
`30 s) for 20 cycles followed by a final extension at 72°C for 10 minutes. PCR products were purified
`using the QIAquick PCR Purification Kit (Qiagen) according to the manufacturer’s instructions and
`one tenth of the elution volume was subjected to the second-step PCR. Here the cycling conditions
`were as follows: 95°C for 15 minutes (95°C for 30 s; 54°C for unmethylated and 64°C for methylated
`primers for 30 s; 72°C for 30 s) for 40 cycles followed by a final extension at 72°C for 10 minutes.
`PCR products were analyzed by 3% agarose gel electrophoresis and ethidium bromide staining
`followed by visualization with ultraviolet illumination using a digital imaging system (Intas, Göttingen,
`Germany). The first-step MSP followed by the second-step MSP independently was performed twice
`for each sample. For the sensitivity assay, human leukocyte DNA was treated with the CpG
`methylase SssI (New England Biolabs, Frankfurt, Germany). Indicated genome equivalents32
`corresponding to the DNA content of 1 to 1000 human cells were spiked into normal stool DNA and
`the nested PCR was performed.
`
`Fecal occult blood testing
`
`https://www.cghjournal.org/article/S1542-3565(04)00624-X/fulltext
`
`
`
`
`
`8/27
`
`Geneoscopy Exhibit 1073, Page 8
`
`

`

`1/9/24, 2:46 PM
`Analysis of promoter methylation in stool: A novel method for the detection of colorectal cancer - Clinical Gastroenterology and Hep…
`All stool samples were subjected to FOBT (Beckman Coulter, Fullerton, CA) immediately on receipt
`and before freezing. One drop of the peroxide catalyst was added to the reverse side of each
`window of the test cards 1 day after applying stool samples. A blue color reaction within 60 seconds
`was considered a positive result.
`
`Statistical analysis
`
`Sensitivity and specificity were estimated relative to the results of colonoscopy in the usual manner.
`Exact binominal estimate was used to calculate 95% confidence intervals (CIs) for the estimated
`parameters.33 P values were calculated with the Fisher exact test. Calculations were performed
`using SISA online statistics package (http://home.clara.net/sisa/binomial.htm; Daan G. Uitenbroek,
`Hilversum, The Netherlands).
`
`Results
`
`Establishment of hypermethylated in cancer 1 promoter methylation analysis
`and determination of the sensitivity of the assay
`
`DNA was extracted from microdissected tissues from primary CRCs, microdissected samples from
`normal colonic epithelium from individual patients, and peripheral blood leukocytes from healthy
`individuals. A nested MSP amplifying a CpG island within the HIC1 promoter 1b was established
`(Figure 1A). We found 7 of 9 cancers (78%) to contain both methylated and unmethylated and 2
`cancers to contain unmethylated HIC1 DNA only (Figure 1B and data not shown). Furthermore,
`none of 8 samples from normal colonic epithelium containing analyzable DNA after bisulfite
`conversion revealed any detectable methylated HIC1 promoter DNA (Figure 1C and data not
`shown). In accordance with previously reported data,30 we found that HIC1 promoter methylation is
`frequent in primary CRCs and absent in healthy colorectal epithelium. Because stool of a significant
`fraction of patients with CRC and nonmalignant disease contains overt or occult blood we analyzed
`the HIC1 methylation status of peripheral blood leukocytes from 10 healthy individuals. MSP
`revealed that none of the 10 leukocyte samples contained any detectable methylated HIC1 DNA
`(Figure 1D and data not shown). Based on these data we were prompted to analyze the potential of
`HIC1 promoter methylation analysis as a stool-based marker for CRC detection.
`
`To determine the sensitivity of the assay to detect tumor-derived methylated DNA in the presence of
`a surplus of normal stool DNA, 1–1000 genome equivalents of SssI-treated fully methylated
`leukocyte DNA were diluted into stool DNA from a healthy individual. MSP revealed that the
`
`
`equivalent of methylated HIC1 DNA from 10 cells could be detected with the assay (Figure 1E). This
`
`https://www.cghjournal.org/article/S1542-3565(04)00624-X/fulltext
`
`9/27
`
`Geneoscopy Exhibit 1073, Page 9
`
`

`

`1/9/24, 2:46 PM
`Analysis of promoter methylation in stool: A novel method for the detection of colorectal cancer - Clinical Gastroenterology and Hep…
`shows the high sensitivity of the assay because the vast majority of DNA is degraded during bisulfite
`conversion.34 Tumors shedding less methylated DNA into the lumen of the colon would not be
`detected by this assay.
`
`Analysis of hypermethylated in cancer 1 promoter methylation in stool DNA
`
`DNA was extracted and purified from small amounts of stool from 26 patients diagnosed with CRC
`before surgery (Table 1) and of 63 patients before colonoscopy (32 with confirmed healthy colons,
`13 with adenomas >1 cm, 9 with hyperplastic polyps, and 9 with chronic inflammatory bowel
`disease; Table 2, Table 3). Amplification of the unmethylated allele, which was expected for all
`samples, was positive in 97% of cases and was used as a control for amplifiable DNA after bisulfite
`conversion. Five of 13 patients with cancers of the rectum or sigmoid colon tested positive for HIC1
`methylation (sensitivity 39%; 95% CI, 14%–68%) (Figure 2A and Table 4). Sensitivity for the 13
`cancers of the cecum, and ascending, transverse, and descending colon was 46% (95% CI, 19%–
`75%) (Figure 2A and Table 4). Altogether the assay detected 42% (95% CI, 23%–63%) of all CRCs.
`Interestingly, the sensitivity was marginally higher for localized (International Union Against Cancer
`stages I and II) than advanced disease (67% vs. 25%, P = .084). Next to detecting CRCs, a stool-
`based screening assay also should detect relevant premalignant lesions (ie, adenoma). Thirteen
`stool samples from patients with adenomatous lesions ≥1 cm were collected before polypectomy.
`Four of the 13 patients (31%) with adenoma tested positive for methylated HIC1 DNA (Figure 2B,
`and Table 4).
`
`Figure thumbnail gr2
`
`Figure 2 Detection of unmethylated () and methylated () HIC1 promoter DNA in stool samples from patients with (A) CRC,
`
`(B) adenoma, and (C) normal controls.
`View Large Image | Download (PPT)
`
`Table 4 Positivity Rates of the Fecal DNA Assay, FOBT, and Combination
`of the Tests
`
`https://www.cghjournal.org/article/S1542-3565(04)00624-X/fulltext
`
`
`
`
`
`10/27
`
`Geneoscopy Exhibit 1073, Page 10
`
`

`

`1/9/24, 2:46 PM
`
`Analysis of promoter methylation in stool: A novel method for the detection of colorectal cancer - Clinical Gastroenterology and Hep…
`
`HIC1
`
`FOBT
`
`Combined
`
`n (%)
`
`95% CI
`
`n (%)
`
`95% CI
`
`n (%)
`
`95% CI
`
`All cancers
`
`11/26 (42)
`
`23%–63%
`
`9/26 (35)
`
`17%–56%
`
`17/26 (65)
`
`44%–83%
`
`Localized
`cancers
`
`Advanced
`cancers
`
`Rectum and
`sigmoid colon
`
`From
`descending
`colon to
`cecum
`
`Asymptomatic
`cases
`
`4/6 (67)
`
`22%–96%
`
`2/6 (33)
`
`4%–77%
`
`6/6 (100)
`
`12%–
`188%a
`
`5/20 (25)
`
`9%–49%
`
`7/20 (35)
`
`15%–59%
`
`11/20 (55)
`
`32%–77%
`
`5/13 (39)
`
`14%–68%
`
`5/13 (39)
`
`14%–68%
`
`9/13 (69)
`
`39%–91%
`
`6/13 (46)
`
`19%–75%
`
`4/13 (31)
`
`14%–68%
`
`8/13 (62)
`
`39%–91%
`
`4/10 (40)
`
`12%–74%
`
`3/10 (30)
`
`7%–65%
`
`6/10 (60)
`
`26%–88%
`
`a Estimated by normal approximation of Poisson distribution.
`
`Open table in a new tab
`
`To test for specificity, stool samples from 32 patients with normal colonoscopy results, 9 patients
`with hyperplastic polyps, and 9 patients with a known history of chronic inflammatory bowel disease
`were analyzed by MSP. One stool sample from a patient with ulcerative colitis who did not reveal
`any malignant process of the colon on colonoscopy contained methylated HIC1 DNA. All other
`samples from normal controls, and patients with hyperplastic polyps or chronic inflammatory bowel
`disease, tested negative for methylated HIC1 DNA (Figure 2C, and Table 3). Altogether only 1 of 50
`samples (2%) from patients lacking neoplastic disease of the colon was positive, resulting in a
`specificity of 98% (95% CI, 92%–100%).
`
`
`
`
`https://www.cghjournal.org/article/S1542-3565(04)00624-X/fulltext
`
`11/27
`
`Geneoscopy Exhibit 1073, Page 11
`
`

`

`1/9/24, 2:46 PM
`Analysis of promoter methylation in stool: A novel method for the detection of colorectal cancer - Clinical Gastroenterology and Hep…
`HIC1 MSP was compared with the best evaluated stool-based screening test to date: FOBT.
`Sensitivity and specificity of FOBT found in this study is comparable with published data.35 The
`HIC1 assay was only slightly more sensitive for all cancers (42% vs. 35%; P = .19; Table 4).
`However, although there was no difference between both tests in detecting rectal and sigmoid
`cancers, symptomatic or asymptomatic cases (P = .66, P = .26, and P = .33, respectively), the HIC1
`assay detected more localized cancers (67% vs. 25%, P = .085) and more adenomas (31% vs. 8%,
`P = .14). In addition, specificity of the HIC1 assay was higher (97.9% vs. 89.9%, P = .102). The
`combination of both assays resulted in increased detection rates for CRCs (65%; 95% CI, 44%–
`83%). Although the combined test detected all localized cancers, no increase in the sensitivity for
`adenoma was seen.
`
`Discussion
`
`Highly sensitive, specific, and easily analyzable markers are required for noninvasive stool-based
`CRC screening. We show here that DNA methylation can be detected in stool of CRC patients with
`high specificity. The use of the DNA methylation marker, HIC1 promoter methylation, allowed for the
`highly specific detection of CRCs in 42% and of adenomas ≥1cm in 31% of cases. Interestingly,
`sensitivity was quite high for early cancers and higher for adenoma than FOBT. The combination of
`HIC1 MSP with FOBT resulted in the detection of almost two thirds of CRCs.
`
`DNA methylation was first described in primary tumors. More recently, tumor-derived methylated
`DNA has been detected in various remote media, including serum, urine, and sputum.25 In 30%–
`70% of cases with methylation of a specific marker in the primary colorectal tumor, the same
`methylated marker also could be detected in serum.36, 37, 38 However, to date, methylation
`markers have not been assessed thoroughly in stool. Our data suggest that we detected at least
`50% of cases expected to be methylated at the HIC1 locus, because methylation of HIC1 has been
`reported to occur in 60%–80% of CRCs.28 Nonetheless, in at least 25% of expected cases with
`HIC1 methylation no methylation was detected by our assay. Because only small amounts of stool
`were used for DNA extraction and 84%–96% of DNA is lost during bisulfite conversion owing to
`degradation,37 it is conceivable that tumors shedding only small amounts of DNA into the lumen of
`the colon will not be detected. The use of larger stool samples might increase sensitivity because
`only a fraction of the stool DNA is of human origin. It has been reported that the feces of healthy
`individuals contains 200–500 ng and the feces of CRC patients contains 1500–2000 ng human DNA
`per mg of stool.39 The amount and quality of extracted and converted DNA is most likely also the
`reason for the failure to amplify an unmethylated product in 3 cases. Although our nested PCR
`
`
`
`
`https://www.cghjournal.org/article/S1542-3565(04)00624-X/fulltext
`
`12/27
`
`Geneoscopy Exhibit 1073, Page 12
`
`

`

`1/9/24, 2:46 PM
`Analysis of promoter methylation in stool: A novel method for the detection of colorectal cancer - Clinical Gastroenterology and Hep…
`allowed for the amplification of stool DNA in 97% of cases, another study using a single-step
`fluorescent PCR approach failed to amplify DNA after bisulfite conversion in more than 40% of
`cases.27
`
`DNA methylation of promoters has been shown to be an early event in colorectal carcinogenesis
`already occurring in aberrant crypt foci.40 Promoters of some genes are affected more frequently by
`methylation than others.40, 41, 42 The reason for this currently is not very well understood.
`Promoters of several genes, including the estrogen receptor and insulin-like growth factor II, have
`been reported to be methylated in both CRCs and in aging colon,31, 43 rendering these promoters
`unattractive markers for screening owing to low specificity for CRC. So far, no HIC1 promoter
`methylation has been found in the colon mucosa of healthy controls31 and our analysis of samples
`from normal colon did not reveal any HIC1 promoter methylation. One recent study proposed
`SFRP2 hypermethylation as a marker for stool-based detection of CRC.27 However, this marker
`has low specificity for CRC. Although SFRP2 methylation was detected in 77%–90% of CRCs with
`amplifiable DNA, 23% of colonoscopically healthy controls revealed methylation of this locus as
`well. This low specificity is most likely owing to the SFRP2 methylation that occurs frequently in
`premalignant aberrant crypt foci.44 In one study, 13 of 15 of these lesions revealed
`hypermethylation of SFRP2. Because aberrant crypt foci are not detected by routine colonoscopy
`and their progression rate to adenoma and CRC is not known, their detection by a screening assay
`does not seem to be favorable. Moreover, K-ras mutation, the best evaluated molecular stool
`marker to date, has a sensitivity for CRC detection in stool samples of 40%–60% of cases.10, 11,
`12, 13, 14, 15, 16 But K-ras mutations also have been found in the stool of controls with normal
`colons. In one study, K-ras mutations were detected in 7% of healthy individuals.20 Self-limiting
`hyperplastic polyps, nondysplastic aberrant crypt foci, and morphologically normal colonic
`mucosa,45, 46, 47 which do not progress to cancer, frequently contain K-ras mutations. This shows
`that methylation markers as well as genetic markers need to be selected carefully to achieve both
`high sensitivity and specificity. Choosing sensitive markers that already are positive in a
`premalignant situation will compromise specificity severely. In addition, low specificity of a test
`results in a low positive predictive value and consecutively in high rates of unnecessarily performed
`colonoscopies.
`
`One of the stool samples from a patient with ulcerative colitis who did not reveal any detectable
`colonic malignancy contained methylated HIC1 DNA. The reason for this is not entirely clear.
`However, aberrant methylation of several promoters has been reported in normal and dysplastic
`colonic epithelium of patients with long-standing and extensive ulcerative colitis48, 49 as well as in
`ulcerative colitis-associated CRCs.50, 51 Alternatively, the patient could have an as yet unknown
`
`
`
`https://www.cghjournal.org/article/S1542-3565(04)00624-X/fulltext
`
`13/27
`
`Geneoscopy Exhibit 1073, Page 13
`
`

`

`1/9/24, 2:46 PM
`Analysis of promoter methylation in stool: A novel method for the detection of colorectal cancer - Clinical Gastroenterology and Hep…
`disease or malignant process somewhere else throughout the gastrointestinal tract, shedding
`methylated HIC1 DNA into the lumen, or a pathologic finding was overseen by the colonoscopy.
`
`Although methylated DNA of several markers has been found in hyperplastic polyps from patients
`with multiple hyperplastic polyps as well as in patients with hyperplastic polyposis, no DNA
`methylation has been described in sporadic hyperplastic polyps.52, 53 In accordance, none of the
`stools analyzed from patients with single hyperplastic polyps revealed methylated HIC1 DNA.
`Nonetheless, detection of hyperplastic polyps in patients with hyperplastic polyposis would be
`favorable because these lesions have been found to be associated with CRC.53 Altogether, of the
`50 stool samples from controls with either endoscopically normal colons, hyperplastic polyps, or
`inflammatory bowel disease, only one was MSP positive. This specificity of 98% emphasizes the
`value of HIC1 promoter methylation as a sensitive and specific marker for stool-based CRC
`screening.
`
`In summary, this study shows HIC1 as a sensitive and specific marker well suited for stool-based
`CRC screening. Combination of HIC1 with a few additional sensitive and specific methylation
`markers may allow for the highly sensitive and specific stool-based detection of CRCs and
`adenomas. Evaluation of other genes known to be methylated in CRC such as hMLH154 and
`HPP1,55 identification of other useful methylation markers, prospective screening studies, as well
`as further simplifications and automatization of the assays used, clearly are indicated.
`
`1.
`
`References
`Jemal A. • Thomas A. • Murray T. • et al.
`Cancer statistics.
`CA Cancer J Clin. 2002; 52: 23-47
`
`View in Article 
`Scopus (2946) • PubMed • Crossref • Google Scholar
`
`2.
`
`McArdle C.
`ABC of colorectal cancer. Primary treatment-does the surgeon matter?.
`BMJ. 2000; 321: 1121-1123
`
`View in Article 
`PubMed • Crossref • Google Scholar
`
`https://www.cghjournal.org/article/S1542-3565(04)00624-X/fulltext
`
`
`
`
`
`14/27
`
`Geneoscopy Exhibit 1073, Page 14
`
`

`

`Analysis of promoter methylation in stool: A novel method for the detection of colorectal cancer - Clinical Gastroenterology and Hep…
`
`1/9/24, 2:46 PM
`3.
`
`Kinzler K.W. • Vogelstein B.
`Lessons from hereditary colorectal cancer.
`Cell. 1996; 87: 159-170
`
`4.
`
`5.
`
`6.
`
`7.
`
`View in Article 
`Scopus (4328) • PubMed • Abstract • Full Text • Full Text PDF • Google Scholar
`
`Winawer S.J. • Zauber A.G. • Ho M.N. • et al. • National Polyp Study Workgroup
`Prevention of colorectal cancer by colonoscopic polypectomy.
`N Engl J Med. 1993; 329: 1977-1983
`
`View in Article 
`Scopus (4022) • PubMed • Crossref • Google Scholar
`
`Mandel J.S. • Bond J.H. • Church T.R. • et al.
`Reducing mortality from colorectal cancer by screening for fecal occult blood. Minnesota
`Colon Cancer Control Study.
`N Engl J Med. 1993; 328: 1365-1371
`
`View in Article 
`Scopus (2963) • PubMed • Crossref • Google Scholar
`
`Hardcastle J.D. • Chamberlain J.O. • Robinson M.H. • et al.
`Randomised controlled trial of faecal-occult-blood screening for colorectal cancer.
`Lancet. 1996; 348: 1472-1477
`
`View in Article 
`Scopus (2478) • PubMed • Abstract • Full Text • Full Text PDF • Google Scholar
`
`Kronborg O. • Fenger C. • Olsen J. • et al.
`Randomised study of screening for colorectal cancer with fae