`
`Hamster preproglucagon contains
`the sequence of
`glucagon and two related peptides
`
`Graeme I. Bell, Robert F. Santerre*
`& Guy T. Mullenbach
`
`Chiron Corporation, 4560 Horton Street, Emeryville,
`California 94608, USA and *Division of Molecular and Cell Biology,
`Lilly Research Laboratories, Indianapolis, Indiana 46285, USA
`
`Glucagon is a 29-amino acid polypeptide hormone synthesized
`by the A cells of the endocrine pancreas1
`-4. Its primary site of
`it stimulates glycogenolysis,
`action
`is
`the
`liver where
`gluconeogenesis and ketogenesis. In mammals, biosynthetic
`studies have shown that glucagon is derived from a precursor
`of molecular weight (M.) approximately 18,000 which is five
`to six times larger than glucagon5
`• Glucagon-containing poly(cid:173)
`peptides and inununoreactants of various sizes have also been
`described from stomach, intestine, brain and salivary gland3
`•
`Here, we have determined the structure of hamster pancreatic
`preproglucagon from the sequence of its eDNA. This 180-
`
`amino add precursor contains the sequence of glucagon and
`two glucagon-like polypeptides arranged in tandem. The pre(cid:173)
`cursor also contains the sequences of several non-pancreatic
`glucagon-containing polypeptides which suggests that, in mam(cid:173)
`mals, both pancreatic and non-pancreatic glucagon and
`glucagon-containing polypeptides may be derived from a com(cid:173)
`mon precursor by tissue-specific processing. We have tenta(cid:173)
`tively identified each of the glucagon-like immunoreactants
`which · have been described with respect to the sequence of
`proglucagon and have proposed a scheme for the processing
`of pancreatic proglucagon.
`The structure of preproglucagon mRNA was deduced from
`the 1,118 base pair (bp) sequence of the insert in colony pshglu1
`(Fig. 1). The sequence contains a single open reading frame
`beginning at the methionine codon at nucleotides 104-106 (the
`only one in any of the three frames) which predicts the sequence
`of the 180-amino acid preproglucagon. Thus, the coding region
`of hamster preproglucagon mRNA is 540 nucleotides. The
`3'-untranslated region of the mRNA is 475 bases and contains
`7
`two polyadenylation signals, AAUAAA6
`, nucleotides 811-
`'
`816 and 1,098-1,103, beginning408 and 21 bases, respectively,
`before the poly(A) tract. The 5'-untranslated region is at least
`103 nucleotides. Electrophoresis of glyoxylated islet RNA in
`an agarose gel8 and subsequent hybridization 9 indicated that
`hamster preproglucagon mRNA is 1,250 bases (data not
`shown). As the cloned eDNA insert is 1,118 nucleotides exclus-
`
`-20
`met lys arg lie
`Anglerf Ish
`met lys asn ile
`Hamster
`CAGAGCUUGGGCACAGMCACAUCCAMGUUCCCAAGUGGGCUCCUOCGUCUGCACCUGCUCACCUGCUCOCCGCOCAGUCACAGCAGCAGGCAGMAAMAA AUG MG AAC AUU
`
`115
`
`-10
`10
`hisser I~!!U ala gly lie leu leu val
`leu met gin glu ala asp pro ser ser ser leu
`leu gly leu ile gin ser ser cys arg val
`esn
`porcine gllcentfn Cl-69>
`~rg
`lie vel ala gly phe phe cys gly ala gly gin gly ser trp gin hisser leu gin esp thr glu glu lys ser arg ser phe pro
`tyr-
`205
`~~-~-~~~~~~~=~~~~ucc~~~~~~~ucc-~~~
`
`JO
`20
`glu ~Ia liSp ser thr leu lys asp glu pro erg glu leu ser asn met
`pro
`asp
`met thr
`lys arg hisser gin gly 1-hr phe thr ser asp tyr ser lys
`ele ser gin thr asp pro leu glu asp.pro asp gin lie asn glu asp
`295
`~ucc~~~~~~~~~~~~~~~=~~~-~~~~~~~~
`
`40
`G 1 ucogon
`lys arg his ser glu gly thr phe ser as n asp tyr ser lys
`
`50
`60
`tyr leu gtu asp arg tys ;,Ia gin glu phe vel arg trp leu met esn.. asn
`
`70
`
`tyr leu asp ser arg erg ala gin asp phe vel gin trp leu met asn thr
`~~~ucc=~~~~~-~~~~~~
`
`385
`
`100
`90
`80
`peptide 1
`I ys- asp gIn a I a II e I ys asp phe va I asp arg I eu
`::: ; :: ::: hIs a I a asp g I y thr phe thr ser asp va I ser ser tyr I eu
`I ys
`i le ala trp leu val
`phe glu arg his ala glu gly thr phe thr ser asp val ser ser tyr leu glu gly gin era ala lys glu phe
`475
`~~-~~~~~~~~~-~~~~~=~~~~~~~~~=~
`
`110
`
`120
`
`G I ucagon-11 ke pept 1 de 2
`
`Fig. 1 Primary struc(cid:173)
`ture of hamster pancre(cid:173)
`atic
`preproglucagon
`mRNA
`and
`protein
`and comparison with
`anglerfish
`prepro(cid:173)
`glucagon and porcine
`GLI-1. The predicted
`amino acid sequence
`of
`hamster
`prepro(cid:173)
`glucagon is numbered
`by designating the first
`amino acid of hamster
`GLI-1 as 1. The amino
`acids constituting
`the
`signal peptide are given
`negative numbers. The
`basic dipeptides which
`may be involved in pro(cid:173)
`cessing are boxed. The
`regions corresponding
`to glucagon and GLP-1
`and -2 are indicated.
`The number of
`the
`nucleotide at the end of
`each line is indicated.
`two AAUAAA
`The
`sequences
`in
`the 3'(cid:173)
`untranslated region are
`underlined.
`Hamster
`and anglerfish 14 prepro(cid:173)
`glucagon are aligned
`and colons indicate gaps
`introduced to maximize homology. The amino acid differences between hamster and porcine GLI-1 10 (proglucagon(1-69)) are indicated.
`Methods: RNA was prepared 23 from islets of Langerhans obtained from the pancreases of 400 female Syrian hamsters (Mesocricetus
`auratus)24
`• The tissue preparation was 50% islets and contained -2 x 107 cells. The yield of poly(A)-containing RNA was 35 JLg. Double(cid:173)
`stranded eDNA was prepared as described by Land et a/. 25 and inserted into the Pstl site of pBR322 using the GC-tailing technique26
`.
`Transformation of Escherichia coli strain HB101 generated a library of 25,000 tetracycline-resistant transformants; 1,000 of these were grown
`in arrays on Whatman 541 filter paper27
`• Following amplification of the plasmid DNA in situ, the colonies were screened for those containing
`hybridization 28 with
`32P-labelled
`heptadecadeoxynucleotide29
`glucagon
`sequences
`by
`a
`pool whose
`sequences
`3'
`GT(T /C) ACC (G/ A)A(A/G/C/T) TAC TA(A/G) TG 5' were complementary to all 32 possible sequences of mRNA encoding glucagon(24-
`29). Two colonies containing plasmids with inserts of 1,200 and 1,000 bp hybridized: pshglu1 and 2, respectively. The colonies were rescreened
`with the insert in pshglu1 and no additional hybridizing colonies were observed. The frequency of colonies containing plasmids coding for
`hamster insulin and somatostatin was also determined by hybridization with human insulin30 and somatostatin 15 probes: 20/500 and 2/1,000
`colonies hybridized with the insulin and somatostatin probes, respectively. The sequence of the insert in pshglu1 was determined by the
`procedure of Maxam and Gilbert31 on both strands except for 165 bp and 210 bp at the 5' and 3' ends, respectively, and across all restriction
`sites used to initiate sequence determinations. A partial sequence of the insert in pshglu2 indicated no differences in the region from nucleotides
`240 to 329.
`
`140
`150
`160
`met asn thr i le leu asp ser leu 2!11a thr arg asp phe lie asn trp leu lie gin thr lys lie thr asp
`lys lys OC
`AUG AAC ACG AUU CUC GAU AGU CUU GCC ACC AGG GAC UUC AUC AAC UGG CUG AUU CAA ACC AAA AUC ACU GAC AAG AAA UAA GUGUGUCAGCAU 658
`
`OCACAACCAUCUOCACMCUUCOCCCGCCAGUCACCUGGGAUGUAGAUUUAAGUUCUAUACAUUUMGAGCUAUAUUUUUGAAGCUGCAUUGCUUUGCAUGUGGAUGAAUACAUUUCCCU 778
`
`UUAGCAUUGUGUAGCCAAAAGAUUGUAAAUGAAAUAAAGUAUUUCCAGGA~UGAUAAGAUAACAACUUCACGAUAUGAAAGUXUGGAUUCACAUUUUCCCUCUCAUUUUAMGGUCC 898
`
`CACCCUGUUUAUGUGUAGCAGCGAGAUUAUOCUUCUGUGAUAUAAAUUGUMAUCAUUAUUACAGUCACGACACCUGCAUUGUAAUAACAGAAGACAUGACAGCC~UAGCCGCAG~ 1018
`
`UGAACCUGGAGAGAGAGCUOCUOCCUUGAGOCCUUUAUCAUAAAUGCACUCAGCUUUCAAUGUAUCGGGGAUAGAUUUAAAUAAAGAUUCCAOCCUUCUUAAAAAAAAAAAAA
`
`565
`
`0028-{1836/83/1607!6--03$01.00
`
`© 1983 Macmillan Journals Ltd
`
`SUN EXHIBIT 1019, IPR2024-00107, PAGE 1
`
`
`
`~NA~T~u~R=E~v~o~L~.3~0~2~2t~A~P~R=IL~t9~83~-----------------LETTERSTQNATURE------------------------------------~7~t7
`
`his ser gIn g I y thr phe thr ser asp Glucagon
`his asp glu phe glu arg his ala glu gly thr phe thr ser asp GLP-1
`hIs a I a asp g I y ser phe ser asp g I u GLP-2
`his ser asp gly thr phe thr ser glu Secretin
`his ser asp a I a va I phe thr asp asn VIP
`tyr a I a g I u g I y thr phe
`i I e ser asp G I P
`his a I a asp g I y va I phe thr ser asp PH 1-27
`tyr a I a asp a I a i I e phe thr asn ser
`pGRF
`
`tyr ser lys tyr leu asp ser arg arg ala gin asp phe val gin
`va I ser ser tyr I eu g I u g I y gIn a I a a I a I ys g I u phe i I e a 1 a
`met asn thr i le leu asp ser leu ala thr arg asp phe i le asn
`I eu ser arg I eu arg asp ser a I a arg I eu gIn arg I eu
`I eu gIn
`tyr thr arg leu arg lys gin met ala val
`lys lys tyr leu asn
`tyr ser i I e a I a met asp
`I ys i I e arg gIn gIn asp phe va I asn
`pl:le ser arg I eu
`I eu 9 I y gIn I eu ser a I a I ys
`I ys tyr I eu g I u
`tyr arg lys val
`leu gly gin leu ser ala arg lys leu leu gin
`
`Glucagon
`GLP-1
`GLP-2
`Secretin
`VIP
`GIP
`PHI-27
`pGRF
`
`trp I eu met asn thr
`trp leu val
`lys gly arg gly
`trp leu lie gin thr lys i le thr asp
`9ly leu val
`ser i le leu asn
`trp leu leu ala gin lys gly lys lys ser asp trp lys his asn
`ser leu i le
`asp
`i I e met ser arg gIn gIn g I y g I u ser asn gIn g I u arg 9 I y
`
`lys lys
`
`Glucagon
`GLP-1
`GLP-2
`Secretin
`VIP
`GIP
`PHI-27
`pGRF
`
`I I e thr g I n
`G I P
`ala arg ala arg leu
`pGRF
`Fig. 2 Comparison of the sequences of hamster glucagon-like
`polypeptides with other members of the glucagon-secretin family.
`The peptides are: human glucagon (all mammalian glucagons seem
`to have identical sequences) 32 ; hamster GLP-1 and -2 (this paper);
`porcine secretin, vasoactive intestinal polypeptide (VIP) gastric
`inhibitory polypeptide (GIP) and PHI- 32- 34 ; and human pGRF35 •
`
`ive of the poly(A) tract, it may represent a nearly full-length
`copy of the mRNA. Also, as an approximately 900-base form
`of hamster pancreatic preproglucagon mRNA was not obser(cid:173)
`ved, the proximal AAUAAA, nucleotides 811-816, is not a
`normal signal for polyadenylation.
`The organization of hamster preproglucagon was determined
`by comparing its sequence with that of other glucagon(cid:173)
`containing polypeptides. This analysis suggested that the first
`20, mainly hydrophobic, amino acids constitute the signal pep(cid:173)
`tide. Thus, hamster preproglucagon is 160 amino acids and its
`predicted molecular weight of 18,675 is in good agreement
`with the value of 18,000 determined by Patzelt et a/. 5 for the
`rat precursor. Glucagon is proglucagon(33-61) and is flanked
`by 52 and 99 amino acids at its amino and carboxy terminus,
`respectively. Proglucagon(1-69) possesses 90% homology with
`porcine intestinal glucagon-like immunoreactant 1 (GLI-1) or
`
`glicentin 10 and is probably the corresponding hamster protein
`(Fig. 1). Proglucagon(1-30) is 80% homologous to a porcine
`polypeptide, called glicentin-related pancreatic polypeptide
`(GRPP), which is secreted from the pancreas concomitantly
`with glucagon 11
`• Proglucagon(33-69) is the pancreatic glucagon
`precursor initially described by Tager and Steiner12 and which
`Bataille et at. 13 recently characterized from porcine intestine.
`Because pancreatic proglucagon contains the sequences of both
`pancreatic and intestinal glucagon-containing polypeptides, a
`common precursor may be synthesized in both tissues. The
`carboxy-terminal segment of proglucagon, residues 70-160,
`contains two glucagon-like peptides (GLP) of 37 and 35 amino
`acids, GLP-1 and -2 (Fig. 1). Each polypeptide is flanked by a
`pair of basic amino acids which can be sites of proteolytic
`processing. However, there is no evidence to suggest that the
`Arg-Arg at residues 109, 110 and 124, 125 are cleaved. In
`fact, the Arg-Arg at residues 49, 50 in the glucagon moiety is
`not cleaved. In addition, spacer oligopeptides of 6 and 13
`residues separate glucagon and GLP-1, and GLP-1 and GLP-2,
`respectively. GLP-1 and -2 are related but not identical to
`other members of the glucagon-secretin family of gastro(cid:173)
`intestinal hormones which have been described (Fig. 2).
`Lund et al. 14 have characterized an anglerfish pancreatic
`preproglucagon. This 124-amino acid precursor (M, 14,500) is
`56 amino acids smaller than hamster preproglucagon and this
`difference is due to the absence of the 13-amino acid spacer
`peptide and second glucagon-like peptide (GLP-2) in the
`anglerfish precursor (Fig. 1). Interestingly, this is the first
`example in which the organization of a prohormone has not
`been conserved during vertebrate evolution (compare mam(cid:173)
`16
`malian and fish preproinsulin and preprosomatostatin 15
`'
`).
`Also, in contrast to mammals, anglerfish has another prepro(cid:173)
`glucagon of -12,500M, (refs 17, 18); however, its sequence
`has not been reported. Thus, there may be at least three
`different types of pancreatic proglucagon in vertebrates. Com(cid:173)
`paring hamster and anglerfish preproglucagon, the signal pep(cid:173)
`tide, the amino-terminal peptide (corresponding to GRPP),
`glucagon and GLP-1 possess 25, 10, 69 and 48% amino acid
`homology and 47, 33, 76 and 66% nucleotide homology,
`respectively. The low level of sequence conservation in the
`signal peptide region is not unexpected because the absolute
`sequence of this region is not as important as the maintenance
`of its hydrophobic character19
`• Although the sequence of the
`amino-terminal peptide, that is, proglucagon(1-30), is not con(cid:173)
`served, the size is and this segment may be required for proper
`processing of the precursor. Interestingly, in mammals, the
`
`Fig. 3 Schematic representation
`of the processing of pancreatic pre-
`proglucagon and the structure of
`glucagon-containing polypeptides.
`a, Possible pathway for the pro-
`teolytic processing of pancreatic
`proglucagon. The basic dipeptides
`are indicated and those which are
`potential sites for cleavage are
`dark boxes. The numbers in paren-
`theses at the end of each line are
`the
`sizes
`of
`the glucagon-
`containing
`intermediates deter-
`mined by Patzelt eta/. 5
`• The num-
`bers above the lines are the amino
`acids at the ends of the polypeptide
`in relation to the sequence of pre-
`proglucagon (Fig. 1). b, Structure
`of
`non-pancreatic
`glucagon-
`containing
`polypeptides. GLI
`8,000 and GLI 12,000 are major
`polypeptides in the intestine and
`GLI 9,000 accumulates in
`the
`serum of animals with
`renal
`20
`failure 3
`'
`.
`
`a Pre-{20aa)
`
`NH2 -peptide (30aa)
`
`~ I
`e>
`"" ~
`....
`I
`30 33
`
`Secreted
`
`33
`
`33
`
`GU s.ooo (Giicentinl
`
`I
`
`GLI12,0oo
`
`Gllg.ooo
`
`I
`
`I
`
`(6aal
`
`I I
`e>
`e>
`""
`""
`~ 5
`....
`I I
`
`I I
`
`69 72
`
`I II
`
`GLP·1 (37aa)
`
`GLP-2 (35aa)
`
`(13aa)
`
`I
`"'
`.'(
`~
`I
`
`I
`
`I
`
`I
`~
`e>
`""
`I
`
`I
`
`I
`
`II
`~
`....
`5
`160
`llcM,,1a.ooo>
`160
`II<M,•13.000)
`
`160
`llcM,•4.soo>
`
`(Mr=3,500)
`
`Glucagon (29aa)
`
`II
`.,
`<
`e>
`
`II
`
`II
`
`II
`
`II
`
`' ""
`'
`'
`' 61
`' Secreted
`
`II
`
`II
`
`II
`
`69
`
`I
`
`I I
`61
`I
`
`108
`I
`
`© Nature Publishing Group
`1983
`
`SUN EXHIBIT 1019, IPR2024-00107, PAGE 2
`
`
`
`NATURE VOL. 302 21 APRIL 1983
`
`718
`
`lE II ERSTO NATURE
`sequence of proglucagon(1-30) is conserved to a greater extent
`than the C-peptide of proinsulin. For example, there is 80%
`homology between hamster and porcine proglucagon(1-30) and
`only 48% homology between their insulin C-peptides. The
`corresponding values in a comparison of hamster and human
`are 83% and 65%, respectively (G.I.B., unpublished). The
`spacer peptide which separates glucagon and GLP-1 is 6 amino
`acids in hamster and 5 in anglerfish and the sequence is different.
`The GLP-1 region possesses extensive homology between ham(cid:173)
`ster and anglerfish, especially the segment corresponding to
`hamster proglucagon(78-100). However, hamster GLP-1 has
`a 6-amino acid amino-terminal extension which is absent in
`anglerfish. The sequence conservation in the GLP-1 region
`suggests that this peptide has a biological function. We have
`also compared hamster GLP-2 with the anglerfish GLP and
`they possess only 29% amino acid sequence homology. The 5'(cid:173)
`and 3'-untranslated portions of hamster and anglerfish mRNA
`possess no significant regions of homology.
`The pancreas and intestine are the major sites of synthesis
`of glucagon and glucagon-containing polypeptides. Figure 3 is
`a possible scheme for the processing of proglucagon in the
`pancreas. This model is based on the structure of prepro(cid:173)
`glucagon presented here, the sizes and order of appearance of
`intermediates in the processing of rat proglucagon and the
`assumption that processing occurs at basic dipeptides. As indi(cid:173)
`cated, both glucagon and proglucagon(1-30) are secreted 11
`•
`However, the fate of proglucagon(72-160) and the two
`glucagon-like polypeptides is unknown. Intestinal glucagon(cid:173)
`containing polypeptides are present at less than 1% the levels
`of pancreatic glucagon and the major polypeptides have M,s
`of 8,000 and 12,000 (ref. 20). The 8,000-M, protein is GLI-1
`and corresponds
`to proglucagon(1-69)
`(Figs 1, 3). The
`sequence of the 12,000-M, polypeptide has not been deter(cid:173)
`20
`mined but its size, biochemical and immunological properties3
`'
`are consistent with it being proglucagon(1-108), and thus it
`would include both glucagon and GLP-1 (Figs 1, 3). In addition,
`a 9,000-M, peptide with glucagon-like immunoreactivity has
`been described which accumulates in the plasma of animals
`with renal failure 1
`20
`3
`• Its size, biochemical and immunological
`-
`'
`properties suggest that it may correspond to proglucagon(1-61)
`(Fig. 3).
`Glucagon and insulin have a major role in the regulation of
`plasma glucose levels. The biological role(s) of the intestinal
`glucagon-containing polypeptides is unclear although GLI-1
`seems to inhibit gastric acid secretion21
`• Both the pancreatic
`and intestinal glucagon-containing polypeptides are probably
`derived from a common precursor which is processed differently
`in these two tissues. The processing of proglucagon can poten(cid:173)
`tially generate at least 11 unique polypeptides, 8 of which have
`been identified biochemically or immunochemically. As the
`sequence of proglucagon is now known, it will be possible to
`synthesize polypeptides and to produce antisera to specific
`segments or polypeptides contained within the precursor22
`• The
`processing of the precursor in different tissues and the function
`of this family of glucagon-containing polypeptides in normal
`and disease states can then be critically examined. The
`difference in structure between mammalian and anglerfish pro(cid:173)
`glucagon is unusual. The presence of an additional glucagon(cid:173)
`like peptide in the mammalian precursor suggests that duplica(cid:173)
`tion or loss of a segment of the proglucagon gene has occurred.
`Examination of the structure of the gene may elucidate the
`evolutionary history of this hormone.
`We thank our colleagues at Lilly Research Laboratories who
`helped in the isolation of the islets, Ms M. Quiroga and N.
`Pong for their technical assistance, Dr W. J. Rutter for his
`encouragement and suppport, Drs Leslie B. Rail and Pablo
`Valenzuela for their assistance in writing and Dr R. Najarian
`and Ms Maureen Appling who prepared the figures and typed
`the manuscript.
`Received 2 December 1982; accepted 16 February 1983.
`
`2. Unger, R. H. & Orci, L. (eds) Glucagon . Physiology. Pathophysiology and Morpholog y of
`the Pancreatic A-Cell (Elsevier, New York, 1981).
`3. Conlon, J. M. Diabetologia 18, 85-88 (1980).
`4. Unger, R. H. & Orci, L. New Engl. J. Med. 304, 1518-1524 (1981).
`5. Patzelt, C., Tager, H. S., Carroll, R. S. & Steiner, D. F. Nature Z82, 260-266 (1979).
`6. Proudfoot, N.J. & Brownlee, G . G. Nature 263,211-214 (1976).
`7. Fitzgerald, M. & Shenk, T. Celt 14,251-260 (1981 ).
`8. Carmichael, G. C. & McMaster, G. K. Meth. Enzym. 65, 380-391 (1980).
`9. Thomas, P. S. Proc. natn. Acad. Sci. U.S.A. 77, 5201-5205 (1980).
`10. Thim, L. & Moody, A. J. Regulatory Peprides 1, 139- 150 (1981).
`11. Moody, A. J., Holst, J. J., Tbim, L. & Lindkaer, Jenson, S. Nature 289,514-516 (1981 ).
`12. Tager, H. S. & Steiner, D. F. Proc. natn. Acad. Sci. U.S.A. 70, 2321-2325 (1973).
`13. Bataille, D. er al. FEBS Lert. 146, 79-86 (1982).
`14. Lund, P. K., Goodman, R. H .• Dee. P. C. & Habener, J. F. Proc. natn. Acad. Sci. U.S.A .
`79, 345-349 (1982).
`IS. Shen, L. P., Pictet, R. L. & Rutter, W. J . Proc. narn. Acad. Sci. U.S.A. 79, 4575-4579
`(1982).
`16. Chan, S. J. era/. J. bioi. Chem . 256,7595-7602 (1981).
`17. Lund, P. K., Goodman, R. H. & Habener, J. F. J. bioi. Chem. 256,6515-6518 (1981).
`18. Shields, D., Warren, T. G .• Roth, S. E. & Brenner, M. J. Nature 289, 511-514 (1981).
`19. Steiner, D. F., Quinn, P. S. , Chan, S. J., Marsh, J. & Tager, H. S. Ann. N . Y. A cad. Sci.
`343, 1- 16 (1980).
`20. Tager, H. S. & Markese, J. J. bioi. Chem. 254, 2229- 2233 (1979).
`21. Kirkegaard, P. et al. Nature 297, 156-157 (1982).
`22. Lerner, R. A. Nature 299, 592-596 (1982).
`23. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J. & Rutter, W. J. Biochemistry 18,
`5294-5299 (1979).
`24. Santerre, R F. er al. Proc. narn. Acad. Sci. U.S.A. 78, 4339-4343 (1981).
`25. Land, H., Grez, M., Hauser, H., Lindenmaier, W. & Schutz, G. Nucleic Acids Res. 9,
`2251-2266 (1981).
`26. Villa-Komarof!, L. er al. Proc. natn. Acad. Sci. U.S.A. 75, 3727-3731 (1978).
`27. Gergen, J.P., Stern, R. H. & Wensink, P. C. Nucleic Acids Res. 7, 2115-2136 (1979).
`28. Comb, M., Seeburg, P. H., Adelman, J., Eiden, L. & Herbert, E . Nature 19!, 663-666
`(1982).
`29. Beaucage, S. L. & Caruthers, M. H . Tetrahedron Lett. 21, 1859-1862 (1981 ).
`30. Bell, G . I. er al. Nature Z82, 525-527 (1979).
`31. Maxam, A . M. & Gilbert, W. Merh. Enzym. 65, 499- 560 (1980).
`32 . Dayhoff, M. 0 . Arias of Protein Sequence and Structure Vol. S, Suppl. 2, 125- 126 (National
`Biomedical Research Foundation, WashinStton. DC. 1976 ).
`33. Tatemoto, K. & Mutt, V. Proc. natn. A cad. Sci. U.S.A. 78,6603-6607 (1981).
`34 . Jornval. H. et al. FEBS Lett. 123,205-216 (1981 ).
`35. Guillemin, R. et al. Science 218,585-587 (1982).
`
`A new troponin T and eDNA clones
`for 13 different muscle
`proteins, found by shotgun sequencing
`Scott D. Putney*, Walter C. Herlihyt
`& Paul Schimmel*
`*Department of Biology and t Department of Chemistry,
`Massachusetts Institute of Technology, Cambridge,
`Massachusetts 02139, USA
`
`Complete amino acid sequences have been estabHshed for 19
`muscle-related proteins and these proteins are each sufficiently
`abundant to suggest that their mRNA levels are about 0.4%
`or higher. Based on these considerations, a simple theoretical
`analysis shows that clones for most of these proteins can be
`identified within a complementary DNA library by sequencing
`eDNA inserts from 150-200 randomly selected clones. This
`procedure should not only rigorously identify specific clones,
`but it could also uncover amino acid sequence variants of major
`muscle proteins such as the troponins1-.s. We have determined
`sequences for about 20,000 nucleotides within 178 randomly
`selected clones of a rabbit muscle eDNA library, and report
`here that in addition to finding sequences encoding the two
`known skeletal muscle isotypes of troponin C7
`-9, we have dis(cid:173)
`covered sequences encoding two forms of troponin T. Over the
`region of nucleotide sequence overlap in the troponin T clones,
`the new isotype diverges significantly from its counterpart10
`•
`Altogether, clones for 13 of the 19 known muscle-specific
`proteins were identified, in addition to the clone for the new
`troponin T isotype.
`To identify a clone for a particular protein by DNA sequen(cid:173)
`cing, the nucleotide sequence of a eDNA clone encoding a
`portion of the protein sequence must be determined. We deter(cid:173)
`mined sequences of eDNA fragments isolated from a library
`of rabbit muscle eDNA cloned into M13 phage 11
`• Before clon(cid:173)
`ing, the eDNA was restricted with Mspi, Taql or Sau3AI so
`that eDNA fragments of -250 base pairs (bp) were actually
`cloned. Sequences of -110 nucleotides from 178 different
`phage inserts were determined. The sequences were translated
`
`1. Foa, P., Bajaj, J. & Foa, N. (eds) Glucagon: Irs Role in Physiology and Clinical Medicine
`(Springer, Berlin, 1977).
`
`0028-0836/ 83/ 160718--04$01.00
`
`© 1983 Macmillan Journals Ltd
`
`SUN EXHIBIT 1019, IPR2024-00107, PAGE 3
`
`