`Larsen et al.
`
`I 1111111111111111 11111 1111111111 1111111111 11111 lllll 111111111111111 11111111
`
`US006528486Bl
`
`(10) Patent No.:
`(45) Date of Patent:
`
`US 6,528,486 Bl
`Mar.4,2003
`
`(54) PEPTIDE AGONISTS OF GLP-1 ACTIVITY
`
`OTHER PUBLICATIONS
`
`(75)
`
`Inventors: Bjarne Due Larsen, Briz1nshiz1j (DK);
`Jens Damsgaard Mikkelsen, Lyngby
`(DK); Spren Neve, Lyngby (DK)
`
`(73) Assignee: Zealand Pharma A/S, Glostrup (DK)
`
`( *) Notice:
`
`Subject to any disclaimer, the term of this
`patent is extended or adjusted under 35
`U.S.C. 154(b) by O days.
`
`(21) Appl. No.: 09/614,847
`
`(22) Filed:
`
`Jul. 12, 2000
`
`Related U.S. Application Data
`( 60) Provisional application No. 60/143,591, filed on Jul. 12,
`1999.
`Int. CI.7 ................................................ A61K 38/00
`(51)
`(52) U.S. Cl .
`............................. 514/12; 514/2; 530/300;
`530/303
`(58) Field of Search ....................... 514/12, 2; 530/300,
`530/303
`
`(56)
`
`References Cited
`
`U.S. PATENT DOCUMENTS
`
`5,424,286 A
`5,545,618 A
`
`6/1995 Eng .............................. 514/2
`8/1996 Buckley et al. ............... 514/12
`
`FOREIGN PATENT DOCUMENTS
`
`........... C07K/1/107
`
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`
`WO 98/05351
`WO 98/08871
`WO 98/11126
`WO 98/11126 A
`WO 98/22577 A
`WO 98/30231 A
`WO 99/07404
`WO 99/25727
`WO 99/25728
`WO 99/43707
`WO 99/43708
`WO 99/46283
`
`2/1998
`3/1998
`* 3/1998
`3/1998
`5/1998
`7/1998
`2/1999
`5/1999
`5/1999
`9/1999
`9/1999
`9/1999
`
`J. Eng et al. Isolation and characterization of Exendin-4, an
`Exendin-3 analogue, from Heloderma suspectum venom.
`1992. J. Biol. Chem., 267(11): 7402---05.*
`C. Orskov, Diabetologia, 701 (1992).
`M. Nauck et al., Harm. Metab. Res., 411 (1997).
`Jean-Pierre Raufman, Reg. Peptides 61: 1-18 (1996).
`Janet A Meurer, et al. "Properties of Native and In Vitro
`Glycosylated Forms Of The Glucagon-Like Peptide-1
`Receptor Antagonist Exendin (9-39)", Metabolism, vol. 48,
`No. 6 (Jun.), 1999, pp 716-724.
`M.M. Byrne et al., European Journal of Clinical Investiga(cid:173)
`tion, 72 (1998).
`C.F. Deacon et al., Diabetologia, 271 (1998).
`C. Deacon et al., Diabetes, 764 (1998).
`U. Ritzel et al., Journal of Endocrinology, 93 (1998).
`R. Pederson et al., Diabetes, 1253 (1998).
`R. Goke et al., European Journal of Neuroscience, 2294
`(1995).
`R. Goke et al., The Journal of Biological Chemistry, 19650
`(1993).
`M. Pohl et al., The Journal of Biological Chemistry, 9778
`(1998).
`N.H. Greig et al., Diabetologia, 45 (1999).
`Y. Chen et al., The Journal of Biological Chemistry, 4108
`(1997).
`J.J. Holst, Annu. Rev. Physiol., 257 (1997).
`D. AD' Alessio et al., J. Clin. Invest. (USA) 93 (5):2263-6
`(1994).
`
`* cited by examiner
`
`Primary Examiner-Lorraine Spector
`Assistant Examiner-Dong Jiang
`(74) Attorney, Agent, or Firm-Robert L. Buchanan;
`Edwards & Angell, LLP
`
`(57)
`
`ABSTRACT
`
`The present invention relates to novel peptide conjugates
`which have increased stability and are useful in the treat(cid:173)
`ment of excess levels of blood glucose.
`
`2 Claims, 8 Drawing Sheets
`
`Novo Nordisk Exhibit 2006
`Mylan Pharms. Inc.v. Novo Nordisk A/S
`IPR2023-00723
`Page 00001
`
`
`
`U.S. Patent
`
`Mar.4,2003
`
`Sheet 1 of 8
`
`US 6,528,486 Bl
`
`w
`z
`_J
`~
`Cl)
`
`T"""
`
`0
`C.
`C)
`::J
`0
`0
`'o:::t
`
`T"""
`
`0
`C.
`C)
`:::,
`0
`'o:::t
`
`T"""
`
`0
`0.
`0)
`:::,
`'o:::t
`
`T"""
`
`0
`C.
`0)
`::J
`-.::I;
`0
`
`C.
`0)
`::J
`0
`'o:::t
`
`T"""
`
`T"""
`
`0
`z
`:J
`0
`a.
`2
`0
`(_)
`
`0
`z
`::)
`0
`a..
`2
`0
`(_)
`
`0
`z
`::)
`0
`a.
`2
`0
`(_)
`
`0
`z
`:J
`0
`a.
`2
`0
`(_)
`
`0
`z
`:J
`0
`a.
`~
`0
`(_)
`
`0
`z
`:J
`0
`a..
`~
`0
`(_)
`
`t T 1 + + +
`
`.,...
`.
`(9
`LL
`
`N
`
`en c:::
`::)
`0
`I
`
`0
`0
`0
`'o:::t
`N
`M
`~ ~ 'T-
`
`0
`T"""
`""'-
`
`0
`0
`'T-
`
`0
`m
`
`0
`0
`0
`0
`0
`00 ~ ~ ~ ~
`
`73/\37 8nH0-3Hd .:::10 %
`
`Novo Nordisk Exhibit 2006
`Mylan Pharms. Inc.v. Novo Nordisk A/S
`IPR2023-00723
`Page 00002
`
`
`
`U.S. Patent
`
`Mar.4,2003
`
`Sheet 2 of 8
`
`US 6,528,486 Bl
`
`w
`z
`::J
`<t
`Cf)
`
`0 a.
`0)
`::J
`0
`0
`0
`......
`
`0
`a.
`0)
`::J
`0
`0
`......
`
`0
`a.
`0)
`::J
`0
`......
`
`0
`a.
`0)
`::J
`......
`
`a.
`0)
`::J
`0
`0
`......
`
`C\I
`0
`z
`:::J
`0
`a.
`2
`0
`(.)
`
`C\I
`0
`z
`:::J
`0
`a.
`2
`0
`(.)
`
`C\I
`0
`z
`:::J
`0
`a.
`2
`0
`(.)
`
`C\I
`0
`z
`:::J
`0
`a.
`2
`0
`(.)
`
`t T 1 • + +
`
`C\I
`0
`z
`:::J
`0
`a.
`2
`0
`(.)
`
`C\I
`0
`z
`:::J
`0
`0..
`2
`0
`(.)
`
`N .
`(9
`LL
`
`C\I
`
`U)
`0::
`:::J
`0
`I
`
`--+---+---+---+---+--"--o
`
`73/\37 E)n~a-3~d ::10 %
`
`Novo Nordisk Exhibit 2006
`Mylan Pharms. Inc.v. Novo Nordisk A/S
`IPR2023-00723
`Page 00003
`
`
`
`U.S. Patent
`
`Mar.4,2003
`
`Sheet 3 of 8
`
`US 6,528,486 Bl
`
`w
`z
`-
`_J
`<{
`U)
`I
`LO
`0
`z
`=>
`0
`a_
`~
`0
`(.)
`
`0 a.
`CJ)
`::,
`0
`0
`.....
`0
`I
`LO
`0
`z
`=>
`0
`a_
`~
`0
`(.)
`
`0
`C.
`CJ)
`::::,
`0
`0
`.....
`I
`LO
`0
`z
`=>
`0
`a_
`~
`0
`(.)
`
`0
`C.
`CJ)
`::::,
`.....
`0
`I
`LO
`0
`z
`=>
`0
`a_
`~
`0
`(.)
`
`0
`C.
`CJ)
`::I
`.....
`I
`LO
`0
`z
`=>
`0
`a_
`~
`0
`(.)
`
`a.
`CJ)
`::::,
`0
`.....
`0
`I
`LO
`0
`z
`=>
`0
`a_
`~
`0
`(.)
`
`t T 1 + + t
`
`.
`(.9
`LL
`
`U)
`~
`=>
`0
`I
`
`0
`0
`~ M
`
`0
`N
`
`0
`..-
`
`0
`0
`
`~ ~ ~ ~ ~
`
`0
`m
`
`0
`0
`0
`0
`ro ~ ~ LO
`
`0
`~
`
`Novo Nordisk Exhibit 2006
`Mylan Pharms. Inc.v. Novo Nordisk A/S
`IPR2023-00723
`Page 00004
`
`
`
`U.S. Patent
`
`Mar.4,2003
`
`Sheet 4 of 8
`
`US 6,528,486 Bl
`
`--=-
`Cl z ::,
`0
`a..
`~
`0
`(.)
`
`■
`
`-.::t"
`
`Cl z ::,
`0
`a..
`~
`0
`(.)
`
`•
`
`0
`0
`N
`
`0 co
`.....
`
`-C .E
`
`.._...
`w
`~
`I-
`
`"'T
`.
`(9
`LL
`
`0
`0
`0
`0
`0 ..--
`
`0
`0
`0
`0 ..--
`
`0
`0
`0
`..--
`
`0
`0
`..--
`(V',JU) "8N08
`
`.....
`0
`
`.....
`
`..--
`ci
`
`Novo Nordisk Exhibit 2006
`Mylan Pharms. Inc.v. Novo Nordisk A/S
`IPR2023-00723
`Page 00005
`
`
`
`U.S. Patent
`
`Mar.4,2003
`
`Sheet 5 of 8
`
`US 6,528,486 Bl
`
`-e- COMPOUND 2
`--0- COMPOUND 14
`_,._ COMPOUND 15
`~ COMPOUND 16
`------------------------------------------------ -a- COMPOUND 18
`-0- COMPOUND 19
`-Ir- COMPOUND (i)
`
`100 -----------
`
`-w
`
`_j
`0
`I
`w
`>
`0
`1-
`w
`Cl) z
`0
`0...
`~ 50 ------------------------
`0:::
`LL
`0
`~
`C
`
`~
`
`E
`
`0
`~ I
`0
`0
`:J
`<(
`
`0
`
`VEHICLE 0.001
`
`0.01
`
`0.1
`
`1
`
`10
`
`100
`
`DOSE (nmol/kg i.p.)
`
`FIG. 5
`
`Novo Nordisk Exhibit 2006
`Mylan Pharms. Inc.v. Novo Nordisk A/S
`IPR2023-00723
`Page 00006
`
`
`
`FIG. 6
`
`C .....
`~.
`.....
`('t
`('t
`;:.-
`'J1
`
`00
`
`5.9kb
`pYES2
`
`2µ ori
`
`1 CYC1 TT
`
`I
`
`GAL
`~
`
`Xba I
`
`Sphl
`
`~ Hind 111
`~ Kpnl
`
`Xho I
`
`Not I
`
`Sac I
`
`BamH I
`
`BstX I BstX I
`
`/
`
`EcoRI
`
`GAAGAATGGTGGTCCATCTTCTGGTGCTCCACCATCTAAGAAGAAGAAGAAGAAGTAA3'
`5'ATGCATGGTGAGGGTACATTCACATCTGATTTGTCTAAGCAAATGGAGGAGGAGGCTGTTCGTTTGTTCATTGAGTGGTT
`
`Novo Nordisk Exhibit 2006
`Mylan Pharms. Inc.v. Novo Nordisk A/S
`IPR2023-00723
`Page 00007
`
`
`
`U.S. Patent
`
`Mar.4,2003
`
`Sheet 7 of 8
`
`US 6,528,486 Bl
`
`I'--
`
`(9
`LL
`
`ci q
`.
`. a. a.
`a.
`. ...;
`(I) Q)
`(1)
`(/)
`(/) (/)
`0 O 0
`::J -= ::J
`u u u
`--~ :::::.,.~
`0) °!0>
`
`000
`zzz
`:::, :::, :::,
`000
`a.. a.. a..
`~ ~ ~
`000
`u (.) (.)
`
`+?t
`
`I II
`
`•
`
`If I
`
`0
`0 ..-
`
`0
`LO
`
`0
`
`0
`LO
`I
`
`(37~1H3/\ O.L 3SNOdS3cl ~O %) uiw Ovl-O~nV
`
`0
`0 ..-
`
`0 ...-
`
`..-
`
`..-
`0
`
`...-
`0
`0
`
`UJ
`....J
`(.)
`
`I w
`>
`
`-a.
`~ -0
`C: -w
`
`0)
`
`E
`
`en
`0
`0
`
`Novo Nordisk Exhibit 2006
`Mylan Pharms. Inc.v. Novo Nordisk A/S
`IPR2023-00723
`Page 00008
`
`
`
`U.S. Patent
`
`Mar.4,2003
`
`Sheet 8 of 8
`
`US 6,528,486 Bl
`
`140
`
`120 ,_
`
`~ COMPOUND 2, 100 nmol/kg i.p.
`~ VEHICLE i.p.
`
`·-w 100
`en z
`0 a. en w
`
`80 ·-
`
`0::
`w
`_J
`()
`I
`w
`>
`~
`
`,_
`60
`
`,_
`
`,_
`
`0
`
`*
`
`*
`
`*
`
`*
`
`*
`
`*
`
`*
`
`*
`
`" *
`'
`~
`'
`'
`
`**
`
`{I
`
`*
`
`*
`i I
`
`*
`
`*I
`I
`
`-20 ,_
`
`I
`0
`
`I
`120
`
`I
`I
`240 360
`
`I
`I
`480 600
`
`I
`720
`
`I
`840
`
`I
`I
`I
`I
`I
`960 1080 1200 1320 1440
`
`TIME OF DRUG ADMINISTRATION (min BEFORE OGTT)
`
`*: p<0.05 VERSUS VEHICLE
`
`FIG. 8
`
`Novo Nordisk Exhibit 2006
`Mylan Pharms. Inc.v. Novo Nordisk A/S
`IPR2023-00723
`Page 00009
`
`
`
`US 6,528,486 Bl
`
`1
`PEPTIDE AGONISTS OF GLP-1 ACTIVITY
`
`This application claims benefit of U.S. Provisional appli(cid:173)
`cation Ser. No. 60/143,591, filed on Jul. 12, 1999.
`
`FIELD OF THE INVENTION
`The present invention relates to novel peptide agonists of
`GLP-1 activity. More specifically the invention relates to
`novel peptides that lower blood glucose levels comprising
`variants of the exendin-4 polypeptide sequence and peptide
`conjugates comprising variants of the GLP-1 or the
`exendin-4 polypeptide sequences which are pharmacologi(cid:173)
`cally active and stable, and as agonists of GLP-1 activity are
`useful in the treatment of diseases that benefit from regula(cid:173)
`tion or excess levels of blood glucose and/or regulation of
`gastric emptying, such as diabetes and eating disorders. The
`present invention also relates to methods of preparing said
`novel peptides, a composition, e.g., a pharmaceutical
`composition, comprising a peptide of the invention and a
`physiologically acceptable carrier, to said peptide for use in 20
`therapy, a method of treating a disorder and to the use of said
`peptide for the manufacture of a pharmaceutical composi(cid:173)
`tion for use in therapy.
`
`BACKGROUND OF THE INVENTION
`A number of hormones that lower blood glucose levels are
`released from the gastrointestinal mucosa in response to the
`presence and absorption of nutrients in the gut. These
`include gastrin, secretin, glucose-dependent insulinotropic
`polypeptide (GIP) and glucagon-like peptide-1 (GLP-1).
`The most potent substance known is GLP-1 (0orskov, 1992,
`Diabetologia 35:701-711). Glucagon-like peptide 1 (GLP-
`1) is a product of proglucagon, a 180 amino acid peptide
`(Drucker, 1998 Diabetes 47:159-169). The overall sequence
`of proglucagon contains the 29-amino acid sequences of
`glucagon, the 36 or 37 amino acid sequence of GLP-1 and
`the 34 amino acid sequence of glucagon-like peptide-2
`(GLP-2), an intestinotrophic peptide. GLP-1 has a number
`of functions. It is a physiological hormone that enhances the
`effect on insulin secretion in normal humans and is therefore
`an incretin hormone. In addition, GLP-1 also lowers gluca(cid:173)
`gon concentrations, slows gastric emptying, stimulates (pro)
`insulin biosynthesis, and enhances insulin sensitivity
`(Nauck, 1997, Harm. Metab. Res. 47:1253-1258). The
`peptide also enhances the ability for the ~-cells to sense and
`respond to glucose in subjects with imparted glucose toler(cid:173)
`ance (Byrne, 1998, Eur. J. Clin. Invest. 28:72-78). The
`insulinotropic effect of the GLP-1 in humans increases the
`rate of glucose disappearance partly because of increased
`insulin levels and partly because of enhanced insulin sensi(cid:173)
`tivity (D'Alessio, 1994, Eur. J. Clin. Invest. 28:72-78). This
`has placed GLP-1 as a promising agent for treatment of type
`II diabetes. Active fragments of GLP-1 have been found to
`be GLP-1(7-36) and GLP-1(7-37). However, a major phar(cid:173)
`macological problem with native GLP-1 is its short half-life. 55
`In humans and rats, GLP-1 is rapidly degraded by dipeptidyl
`peptidase-IV (DPP-IV) into GLP-1(9-36)amide, acting as
`an endogenous GLP-1 receptor antagonist (Deacon, 1998,
`Diabetologia 41:271-278). Several strategies circumventing
`this problem have been proposed, some using inhibitors of 60
`DPP-IV and other DPP-IV resistant analogues of GLP-1
`(7-36)amide (Deacon, 1998, Diabetologia 41:271-287;
`Deacon et al., 1998, Diabetes 47:764-769; Ritzel, 1998, J.
`Endocrinol. 159:93-102; U.S. Pat. No. 5,545,618; Pederson,
`1998, Diabetes 47:1253-1258).
`Exendins, another group of peptides that lower blood
`glucose levels have some sequence similarity (53%) to
`
`2
`GLP-1[7-36]NH2 (Goke et al., 1993, J. Biol. Chem.
`268:19650-55). The exendins are found in the venom of
`Helodermatidae or beaded lizards (Raufman, 1996, Reg.
`Peptides 61:1-18). Exendin-3 is present in the venom of
`5 Heloderma horridum, the Mexican beaded lizard and
`exendin-4 is present in the venom ofHeloderma suspectum,
`the Gila monster. Exendin-4 differs from exendin-3 at just
`positions two and three. The cDNA encoding the exendin-4
`precursor protein, a 47 amino acid peptide fused to the
`10 amino terminus of exendin-4 has been cloned and sequenced
`(Pohl et al., 1998, J. Biol. Chem. 273:9778-9784 and
`W098/35033). Both exendin-3 and exendin-4 stimulate an
`increase in cellular cAMP production in guinea pig pancre(cid:173)
`atic acinar cells by interacting with exendin receptors
`15 (Raufman, 1996, Reg. Peptides 61:1-18). Exendin-3 causes
`a biphasic increase in cellular cAMP production, but a
`monophasic increase in amylase release in pancreatic acinar
`cells. In contrast, exendin-4 causes a monophasic increase in
`cAMP production and does not alter amylase release.
`Exendin-4 is a strong GLP-1 receptor agonist on isolated
`rat insulinoma cells (Goke et al., 1993, J. Biol. Chem.
`268:19650-55). This is expected as the (His Ala) domain of
`GLP-1 recognised by DPP-IV is not present in exendin-4
`(Goke et al., 1993, J. Biol Chem. 268:19650-55). Binding of
`25 [ 125I]GLP-1 to the nucleus of the solitary tract was inhibited
`concentration-dependently by unlabelled GLP-1 and
`[Tyr39]exendin-4 with Ki values of 3.5 and 9.4 nM
`respectively, and similar values are found in cell lines ( Goke
`et al., 1995, Eur. J. Neurosci. 7:2294-2300 and Goke et al.,
`30 1993, J. Biol. Chem. 268:19650-55). Further, exendin-4
`given systemically lowers blood glucose levels by 40% in
`diabetic db/db mice (W0/99/07404). Recently, Grieg et al.
`(1999, Diabetologia 42:45-50) has shown a long lasting
`blood glucose lowering effect of once daily intraperitoneal
`35 injection of exendin-4 to diabetic ob/ob mice). U.S. Pat. No.
`5,424,286 discloses that a considerable portion of the
`N-terminal sequence is essential in order to preserve insuli(cid:173)
`notropic activity (exendin-4(1-31) and Y 31 -exendin-4
`(1-31)) whereas an N-terminally truncated exendin
`40 (exendin-4(9-39) has inhibitory properties.
`The use of exendin-3, exendin-4 and exendin agonists has
`been proposed for the treatment of diabetes mellitus, reduc(cid:173)
`ing gastric motility and delaying gastric emptying and the
`prevention of hyperglycemia (U.S. Pat. No. 5,424,286,
`45 W098/0535) as well as for the reduction of food intake
`(W098/30231). There has been proposed ways of obtaining
`novel compounds by modifying the native exendin
`sequences. One way is to attach lipophilic substituents to the
`molecule, e.g. as described in WO 99/43708 which discloses
`50 derivatives of exendin with just one lipophilic substituent
`attached to the C-terminal amino acid residue.
`A major approach has been to devise exendin analogues
`characterised by amino acid substitutions and/or C-terminal
`truncation of the native exendin-4 sequence. This approach
`is represented by the compounds of W099/07404, WO
`99/25727 and WO 99/22728. W099/07404 discloses exen-
`din agonists having a general formula I that defines a peptide
`sequence of 39 amino acid residues with Gly Thr in posi(cid:173)
`tions 4-5, Ser Lys GLn in positions 11-13, Glu Glu Glu Ala
`Val Arg Leu in positions 15-21, Leu Lys Asn Gly Gly in
`positions 26-30, Ser Ser Gly Ala in positions 32-35, and
`wherein the remaining positions may be occupied by wild(cid:173)
`type exendin amino acid residues or may be occupied by
`specified amino acid substitutions. The formula I does not
`65 cover any exendin agonists or analogues having specific
`amino acid deletions and/or being conjugates as described
`herein, such as the novel compounds desPro 36-exendin-4
`
`Novo Nordisk Exhibit 2006
`Mylan Pharms. Inc.v. Novo Nordisk A/S
`IPR2023-00723
`Page 00010
`
`
`
`US 6,528,486 Bl
`
`4
`(i) substitution of D-alanine, glycine or alpha-amino
`isobutyric acid for alanine at position 8 and
`(ii) a lipophilic substituent;
`and Z, a peptide sequence of 4--20 amino acid units
`covalently bound to said variant, wherein each amino acid
`unit in said peptide sequence, Z is selected from the group
`consisting of Ala, Leu, Ser, Thr, Tyr, Asn, Gln, Asp, Glu,
`Lys, Arg, His, Met, Orn, and amino acid units of the general
`formula I
`
`-NH---C(R1)(R2)---C(~O)-
`
`(I)
`
`wherein R1 and R2 are selected from the group consisting of
`hydrogen, C1 _calkyl, phenyl, and phenyl-methyl, wherein
`C1 _6-alkyl is optionally substituted with from one to three
`substituents selected from halogen, hydroxy, amino, cyano,
`nitro, sulfono, and carboxy, and phenyl and phenyl-methyl
`is optionally substituted with from one to three substituents
`selected from C1_calkyl, C2 _calkenyl, halogen, hydroxy,
`amino, cyano, nitro, sulfono, and carboxy, or R1 and R2
`together with the carbon atom to which they are bound form
`a cyclopentyl, cyclohexyl, or cycloheptyl ring, e.g., 2,4-
`diaminobutanoic acid and 2,3-diaminopropanoic acid, with
`the proviso that X is not exendin-4 or exendin-3.
`The peptide Xis further characterised in being effective in
`improving glucose tolerance in a diabetic mammal.
`Furthermore, the invention is directed to a novel variant
`of a parent exendin, wherein said parent exendin has an
`amino acid sequence having at least an 90% homology to
`exendin-4 and wherein said variant lowers the blood glucose
`level in a mammal, binds to a GLP-1 receptor and has at
`least one modification selected from the group consisting of
`(a) between one and five deletions at positions 34-38, and
`(b) contains a Lys at position 40 having a lipophilic sub(cid:173)
`stituent attached to the epsilon amino group of said lysine.
`
`3
`(1-39), exendin-4(1-39)-K6 or desPro36-exendin-4(1-39)(cid:173)
`K6. WO 99/25727 discloses exendin agonists having a
`general formula I that defines a peptide sequence of from 28
`to 38 amino acid residues with Gly in position 4 and Ala in
`position 18, and wherein the remaining positions may be 5
`occupied by wild-type exendin amino acid residues or may
`be occupied by specified amino acid substitutions. Formula
`I does not comprise a peptide sequence having Ser as the
`C-terminal amino acid and exendin agonists or analogues
`having specific amino acid deletions and/or being conjugates 10
`as described herein, such as the novel compounds desPro36 -
`exendin-4(1-39), exendin-4(1-39)-K6 or desPro36-exendin-
`4)1-39)-K6. Further, formula II of WO 99/25727 defines a
`peptide sequence similar to formula I, but including exendin
`derivatives having a C(l-lO)alkanoyl or cycloalkylalkanoyl 15
`substituent on lysine in position 27 or 28. When treating
`inappropriate post-prandial blood glucose levels the com(cid:173)
`pounds are administered frequently, for example one, two or
`three times a day. WO 99/25728 discloses exendin agonists
`having a general formula I that defines a peptide sequence of 20
`from 28 to 39 amino acid residues with fixed Ala in position
`18, and wherein the remaining positions may be occupied by
`wild-type exendin amino acid residues or may be occupied
`by specified amino acid substitutions. Said exendin agonists
`all correspond to a truncated exendin analogues having a 25
`varying degree of amino acid substitutions. Peptide
`sequences of from 34 to 38 amino acid residues do not have
`Ser C-terminally. A peptide sequence of 39 amino acid
`residues may have either Ser or Tyr C-terminally, but no
`further residues. Exendin agonist or analogues having spe- 30
`cific amino acid deletions and/or being conjugates according
`to the invention described herein are not comprised by
`formula I. Further, formula II defines a peptide sequence
`similar to formula I, but including exendin derivatives
`having a C(l-lO)alkanoyl or cycloalkylalkanoyl substituent 35
`on lysine in position 27 or 28.
`WO 99/46283 (published 16.09.99) discloses peptide
`conjugates comprising a pharmacologically active peptide X
`and a stabilising peptide sequence Z of 4-20 amino acid
`residues covalently bound to X, where said conjugates are 40
`characterised in having an increased half-life compared to
`the half-life of X. X may be exendin-4 or exendin-3.
`
`OBJECTIVE OF IBE INVENTION
`There is a need for compounds that lower blood glucose
`levels in mammals, and are stable and effective. Therefore,
`it is an objective of the invention to provide novel com(cid:173)
`pounds that lower blood glucose levels in mammals. Ideally,
`these should be effective when administered orally. It is a
`further object of the invention to provide novel peptide 50
`agonists of GLP-1 activity and/or exendin-4 activity. It is a
`still further purpose of the invention to provide peptide
`agonists of GLP-1 activity and/or exendin-4 activity having
`an increased half-life and/or a decreased clearance.
`
`BRIEF DESCRIPTION OF THE FIGURES
`FIG. 1 shows the effect of Compound 1 (SEQ ID NO:101)
`(des PRO36-exendin-4(1-39)-NH2 ) on blood glucose levels
`of mice, cf. Example 25.
`FIG. 2 shows the effect of Compound 2 (SEQ ID NO:93)
`(des PRO36-exendin-4(1-39)-Lys6-NH2 on the blood glu(cid:173)
`cose levels of mice, cf. Example 25.
`FIG. 3 shows the effect of Compound 5 (SEQ ID NO:89)
`, Lys37 (palmitoyl)-GLP1-(7-36)(Human)-(Lysh-NH2
`(Gly8
`45 on the blood glucose levels of mice, cf. Example 25.
`FIG. 4 shows in vivo degradation kinetics in rabbits after
`i.v. injection of 1 µm/kg of Compound 4 and Compound
`(iii), cf. Example 27.
`FIG. 5 is a plot of AUC (area under the curve) values
`(mean±SEM) for Compounds, 2,14-16, 18 and 19 in an oral
`glucose tolerance test (OGTT), cf. Example 28.
`FIG. 6 shows a synthetic cDNA constructed for heterlog
`expression of Compound 2 in yeast. The new construct was
`55 designated pYES0Ol0, cf. Example 20.
`FIG. 7 is a plot of dose-response on GTT in db/db mice
`based on relative AUC0 _240 min values (mean±SEM) for
`Compound 2 and Compound (i), cf. Example 29.
`FIG. 8 shows the effects of a maximal dose of Compound
`60 2, i.e. 100 nmol/kg i.p., on the oral glucose tolerance test
`(OGTT) when administered up to 24 hours before the
`OGTT.
`
`SUMMARY OF THE INVENTION
`The invention is directed to a peptide conjugate compris(cid:173)
`ing a peptide X selected from the group consisting of
`(a) an exendin having at least 90% homology to exendin-
`4;
`(b) a variant of said exendin wherein said variant com(cid:173)
`prises a modification selected from the group consisting
`of between one and five deletions at positions 34-39
`and contains a Lys at position 40 having a lipophilic
`substituent; or
`(c) GLP-1 (7-36) or GLP-1 (7-37) having at least one
`modification selected from the group consisting of:
`
`65
`
`DETAILED DESCRIPTION OF THE
`INVENTION
`The compounds of the present invention include hitherto
`unknown deletion variants of a parent exendin. In contrast to
`
`Novo Nordisk Exhibit 2006
`Mylan Pharms. Inc.v. Novo Nordisk A/S
`IPR2023-00723
`Page 00011
`
`
`
`US 6,528,486 Bl
`
`5
`know substitution and/or truncation variants of exendin-4
`(1-39) the novel compounds are believed to exhibit a
`stabilised alpha-helix structure with superior stability prop(cid:173)
`erties and unreduced or enhanced binding properties.
`Moreover, conjugation of the novel variants, modified GLP-
`1(7-36)-NH2, and modified GLP-1-(7-37) to specific short
`peptide sequences (Z) render stability to these compounds
`without compromising the pharmacological properties.
`These conjugations confer in vivo stability and hydrophi(cid:173)
`licity to the peptide molecule. The Z is composed of
`amino-acid residues, and has alone no structural character(cid:173)
`istics in terms of a-helix conformation. However, from
`studies using both circular dichroism and nuclear magnetic
`resonance (NMR) spectroscopy, addition of Z dramatically
`alters the structural characteristics of some peptides as 15
`evidenced by the increased amount of a-helix conformation
`in the peptide. For example, circular dichroism, demon(cid:173)
`strated that a Z-modified (Gly8)-GLP-1 had much more
`a-helix conformation than (Gly8)-GLP-1. Together with the
`pharmacological results, the structural analyses suggest that
`Z is modifying the conformation of the peptide leading to
`higher enzyme-stability, but without losing its potency. Also
`the physical and chemical properties of peptides may be
`altered considerably by Z-modification with resulting
`impact on pharmacological formulation strategy.
`Exendin Variants
`The exendin variant of the present invention is a variant
`of a parent exendin peptide having at least about 90%
`homology and most preferably at least about 95% to
`exendin-4, which have exendin activity, e.g., lowers the 30
`blood glucose level in a mammal and binds to a GLP-1
`receptor. In a preferred embodiment, the parent exendin
`peptide has an amino acid sequence which differs by five
`amino acids, preferably by four amino acids, more prefer(cid:173)
`ably by three amino acids, even more preferably by two
`amino acids, and still more preferably by one amino acid
`residue from the amino acid sequence of exendin-4)1-39).
`In one embodiment, the exendin variant comprises
`between one and five deletions at positions 34--38. Prefer(cid:173)
`ably the variant comprises between 1 and 4 deletions at
`positions 34--38, more preferably between 1 and 3 deletions
`at positions 36-38. Preferably the parent exendin is exendin-
`4, and a preferred variant included as peptide X in the
`peptide conjugates herein has an amino acid sequence
`wherein 1, 2 or 3 of the Pro residues in positions 36, 37 and 45
`38 have been deleted from the amino acid sequence of
`exendin-4 and preferably from the amino acid sequence of
`exendin-4(1-39).
`Coupling of a Z sequence to the X peptide herein is
`believed to increase the stability of these compounds. Pra(cid:173)
`line is a rigid amino acid that may interfere with the effect
`of Z to stabilise the structure of the X peptide. Deletion of
`one, two or all of the praline amino acids in positions 36, 37
`and 38 of the exendin backbone is therefore preferred in the
`peptide conjugates comprising a variant of a parent exendin 55
`according to the invention, as long as the efficacy of said
`conjugates as measured in, e.g. an oral glucose tolerance test
`(OGTT) in diabetic db/db mice, is not negatively affected.
`In another embodiment, the variant comprises an addi(cid:173)
`tional residue at position 40, a lysine residue which com- 60
`prises a lipophilic substituent bound to the epsilon amino
`group of lysine via an amide bond. The lipophilic substituent
`may be the acyl group of a straight-chain or branched fatty
`acid or a straight-chain or branched alkane a,w-dicarboxylic
`acid. The acyl group may have the formula CHiCH2)n 65
`CO-, wherein n is a integer from 4-38 and preferably from
`4-24. In a specific embodiment, the acyl group is
`
`6
`selected from the group consisting of CHiCH2) 6CO-,
`CHiCH/8 CO-, CHiCH2) 10CO-, CHiCH2 ) 12CO-,
`CHiCH2) 14CO-, CHiCH2 ) 16CO-, CHiCH2 ) 18CO-,
`CHiCH2) 20CO-, and CHiCH2)22CO-. The acyl group
`5 may have the formula HOOC(CH2)mCO-, wherein n is an
`integer from 4-38 and preferably from 4-24. In a specific
`embodiment, the acyl group is selected from the group
`consisting of HOOC(CH2 ) 14CO-, HOOC(CH2 ) 16CO-,
`HOOC(CH2 ) 18CO-, HOOC(CH2 ) 20CO- and HOOC
`10 (CH2 ) 22CO-. In a more specific embodiment, the lipophilic
`substituent is selected from the group consisting of
`tetradecanoyl, w-carboxynonadecanoyl, 7-deoxycholoyl,
`choloyl, palmitoyl and lithocholyl. In a most specific
`embodiment, the lipophilic substituent is palmitoyl.
`Alternatively, the liphophilic substituent may have an NH
`group. Specific embodiments include but are not limited to
`the formulae CHiCH2)a((CH2hCOOH)CHNHCO(CH2 ) 2
`CO- wherein a and b are integers and a+b is an integer of
`from 8 to 33, preferably from 12 to 28;
`20 CHiCH2)cCONHCH(COOH) (CH2)2CO-wherein c is an
`integer of from 10 to 24;
`CHiCH2)aCONHCH(CH2)2 (COOH)CO-wherein dis an
`integer of from 8 to 24;
`COOH(CH2)eCO- wherein e is an integer of from 8 to 24;
`25 -NHCH(COOH)(CH2) 4NHCO(CH2)f=H3 wherein f is a
`integer of from 8 to 18;
`-NHCH(COOH)(CH 2 ) 4 NHCOCH(CH2 ) 2 COOH)NHCO
`(CH2)gCH3 wherein g is an integer of from 10 to 16; and
`-NHCH(COOH)(CH 2 ) 4 NHCO)CH 2 ) 2 CH(COOH)
`NHCO(CH2hCH3 wherein his an integer of O or from 1
`to 22 and preferably from 10 to 16.
`The exendin variants having a lysine residue at position
`40 carrying a lipophilic substituent optionally further com(cid:173)
`prise between one and five deletions, preferably between one
`35 and three deletions, at positions 34 to 39, preferably at
`positions 34--38, such as [des Ser39
`, Lys40 (palmitoyl)]
`, Lys40 (palmitoyl)]exendin-4
`exendin-4(1-39), [des Pro 36
`, Lys40 (palmitoyl)]exendin-4(1-40).
`(1-39) and [des Pro36
`The variant may be in a most specific embodiment
`40 selected from the group consisting of:
`Compound 1: des Pro 36-exendin-4(1-39)-NH2 (SEQ ID
`NO:101),
`des Pro36 -exendin-4(1-40)-NH2,
`, Pro 37
`Compound 14: des Pro 36
`NH2,
`, Pro 38-exendin-4(1-40)-NH2,
`, Pro 37
`des Pro36
`, Pro 37-exendin-4(1-39)-NH2,
`des Pro36
`des Ala35-exendin-4(1-39)-NH2 (SEQ ID NO:105),
`des Gly34-exendin-4(1-39)-NH2 (SEQ ID NO:106),
`50 des Ser39-(Lys40 (palmitoyl))exendin-4(1-39)-NH2 (SEQ
`ID NO:107),
`des Gly34-(Lys40 (palmitoyl))exendin-4(1-39)-NH2 (SEQ
`ID NO:108),
`des Ala35-(Lys40 (palmitoyl))exendin-4(1-39)-NH2 (SEQ
`ID NO:109),
`des Pro36-(Lys40 (palmitoyl))exendin-4(1-39)-NH2 (SEQ
`ID NO:110), and the free acid thereof and a pharmaceu(cid:173)
`tically acceptable salt thereof.
`Modified GLP-1
`A preferred modified GLP-1 included as peptide X in the
`peptide conjugates herein has an amino acid sequence of
`GLP-1 (7-36)-NH2 or GLP-1 (7-37) having a substitution
`of glycine for alanine at position 8. Alternatively, a preferred
`modified GLP-1 has an amino acid sequence of GLP-1
`(7-36) or GLP-1 (7-37) having a substitution of glycine for
`alanine at position 8 and a lipophilic substituent, preferably
`palmitoyl, on one lysine residue at position 26, 34 or 37. The
`
`, Pro 38exendin-4(1-39)(cid:173)
`
`Novo Nordisk Exhibit 2006
`Mylan Pharms. Inc.v. Novo Nordisk A/S
`IPR2023-00723
`Page 00012
`
`
`
`US 6,528,486 Bl
`
`7
`lipophilic substituent is preferably attached to the epsilon
`amino group of said lysine and includes the specific embodi(cid:173)
`ments described above for the exendin variants. The modi(cid:173)
`fied GLP-1(7-36) or GLP-1(7-37) used as X in the conju(cid:173)
`gates of the invention may be those cited in WO 99/43707 5
`and WO 98/08871 comprising a lipophilic substituent or,
`more preferably those GLP-1 analogues having a glycine
`substitution at position 8. Preferred peptides X are
`Gly8 -GLP-1(7-36),
`Gly8-GLP-1(*7-37), and
`Gly8 -GLP-1(7-36)-Lys37 (palmitoyl).
`The compounds of the invention having a lipophilic
`substituent would have a more protracted profile of action
`than the parent peptides as demonstrated for GLP-1 deriva(cid:173)
`tives in WO 98/08871.
`Peptide conjugates
`The peptide sequence Z may be bound to the C-terminal
`or the N-terminal of the peptide sequence, X or two peptide
`sequences may be bound individually to both the C- and
`N-terminal of X. In case the native peptide X possesses a
`free C-terminal carboxylic acid, the peptide sequence z may 20
`be attached to either the C-terminal of the peptide X or to the
`N-terminal of the peptide X, or the C- and N-terminal of X
`may both be bound to each individual peptide sequence Z.
`Alternatively, Z may be bound to the nitrogen atom on the
`side chain of lysine, histidine or arginine or a carbonyl 25
`function on the side chain of glutamic acid or aspartic acid
`anywhere with the peptide sequence X. In one embodiment,
`Z may be attached to X within the sequence and to the N(cid:173)
`and/or C-terminal of X. Whether the sequence should be
`attached to the peptide sequence X as its C-terminal, at its 30
`N-terminal, or both, or within the peptide sequence X
`depends on the specific peptide X and can be easily deter(cid:173)
`mined by the person skilled in the art. Preferably, Xis bound
`to Z via a peptide bond and preferably at the C-terminal of
`X.
`One aspect of the invention is directed to a peptide
`conjugate comprising a peptide X which reduces the blood
`glucose level in a mammal, wherein X is (a) an exendin
`having at least 90% homology to exendin-4: (b) a variant of
`said exendin wherein said variant comprises a modification 40
`selected from the group consisting between One and five
`deletions at positions 34-39 and contains a Lys at position
`40 having a lipophilic substituent; or (c) GLP-1 (7-36) or
`GLP-1 (7-37) having at least one modification selected from
`the group consisting of: (i) substitution of D-alanine, glycine 45
`or alpha-amino isobutyrel acid (Aib) for alanine at position
`8 and (ii) a lipophilic substituent; and Z, a peptide sequence
`of 4-20 amino acid units covalently bound to X, wherein
`each amino acid unit in said peptide sequence Z is selected
`from the group consisting of Ala, Leu, Ser, Thr, Tyr, Asn, 50
`Gln, Asp, Glu, Lys, Arg, His, Met, Orn, and am