Quantitative Bias in Illumina TruSeq and a Novel Post
`Amplification Barcoding Strategy for Multiplexed DNA
`and Small RNA Deep Sequencing
`
`Filip Van Nieuwerburgh1, Sandra Soetaert1, Katie Podshivalova2, Eileen Ay-Lin Wang2, Lana Schaffer3,
`Dieter Deforce1, Daniel R. Salomon2, Steven R. Head3, Phillip Ordoukhanian3*
`
`1 Laboratory of Pharmaceutical Biotechnology, Ghent University, Ghent, Belgium, 2 Department of Molecular and Experimental Medicine, The Scripps Research Institute,
`La Jolla, California, United States of America, 3 Next Generation Sequencing Core, The Scripps Research Institute, La Jolla, California, United States of America
`
`Abstract
`
`Here we demonstrate a method for unbiased multiplexed deep sequencing of RNA and DNA libraries using a novel, efficient
`and adaptable barcoding strategy called Post Amplification Ligation-Mediated (PALM). PALM barcoding is performed as the
`very last step of library preparation, eliminating a potential barcode-induced bias and allowing the flexibility to synthesize as
`many barcodes as needed. We sequenced PALM barcoded micro RNA (miRNA) and DNA reference samples and evaluated
`the quantitative barcode-induced bias in comparison to the same reference samples prepared using the Illumina TruSeq
`barcoding strategy. The Illumina TruSeq small RNA strategy introduces the barcode during the PCR step using differentially
`barcoded primers, while the TruSeq DNA strategy introduces the barcode before the PCR step by ligation of differentially
`barcoded adaptors. Results show virtually no bias between the differentially barcoded miRNA and DNA samples, both for
`the PALM and the TruSeq sample preparation methods. We also multiplexed miRNA reference samples using a pre-PCR
`barcode ligation. This barcoding strategy results in significant bias.
`
`Citation: Van Nieuwerburgh F, Soetaert S, Podshivalova K, Ay-Lin Wang E, Schaffer L, et al. (2011) Quantitative Bias in Illumina TruSeq and a Novel Post
`Amplification Barcoding Strategy for Multiplexed DNA and Small RNA Deep Sequencing. PLoS ONE 6(10): e26969. doi:10.1371/journal.pone.0026969
`
`Editor: Bob Lightowlers, Newcastle University, United Kingdom
`
`Received August 19, 2011; Accepted October 6, 2011; Published October 28, 2011
`Copyright: ß 2011 Van Nieuwerburgh et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which
`permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
`
`Funding: This work was supported by the Fund for Scientific Research-Flanders, Belgium (F.W.O.- 301 Vlaanderen) to FVN; and the National Institutes of Health
`[TL1 RR025772–03] to KP, [U19 302 A1063603–06] to DRS, SRH, GTH and LS. The funders had no role in study design, data collection and analysis, decision to
`publish, or preparation of the manuscript.
`
`Competing Interests: The authors have declared that no competing interests exist.
`
`* E-mail: philo@scripps.edu
`
`Introduction
`
`Taking advantage of the increasing throughput achieved by
`second generation sequencing technologies, multiplexing several
`samples in one analysis can increase experimental throughput
`while reducing time and cost.
`Several strategies have been described for barcoding sequencing
`libraries [1–5]. Vigneault et al. [4] published a miRNA barcoding
`protocol using ligation of 3’ pre-adenylated barcoded adapter
`oligonucleotides as the first step of sequencing library preparation.
`Buermans et al.[5] published a miRNA sequencing protocol,
`introducing a barcode during PCR. Illumina recently released the
`TruSeq kits for multiplexed high-throughput sequencing. The
`Illumina TruSeq small RNA protocol
`introduces the barcode
`during the PCR step using differentially barcoded primers, while
`the TruSeq DNA (or messenger RNA converted to double
`stranded DNA) protocol introduces the barcode before the PCR
`step by ligation of differentially barcoded double stranded
`adaptors. All published methods place the barcodes within the
`adapters, downstream or within the PCR primer binding site or
`introduce the barcode during PCR. However, it is well established
`that multi-template PCR amplification can result in a sequence-
`dependent amplification bias, as some DNA species are amplified
`more efficiently than others [6–9]. For this reason, introducing
`barcodes near a priming site might result in a barcode-specific
`
`quantitative bias. To our knowledge, no previous publication has
`provided in-depth data measuring PCR amplification bias
`resulting from the use of barcodes.
`Our initial attempts to adapt previous barcoding strategies to
`multiplexed sequencing of small RNA used index sequences
`placed at the distal end of the 5’ adapter in the Illumina small
`RNA library protocol. Despite a number of iterations of the design
`we consistently failed to avoid PCR amplification bias when
`identical
`samples with different barcodes were compared.
`Therefore, we designed a new strategy in which we ligate both
`the 3’ and 5’ adapters, perform the RT-PCR step and then ligate
`the barcode after the library PCR amplification, as the last step of
`strategy Post
`the library preparation. We have called this
`Amplification Ligation Mediated (PALM) barcoding.
`In the
`present
`study, we compared the de-multiplexed quantitative
`results of 12 differentially PALM barcoded miRNA samples, 12
`TruSeq barcoded miRNA samples and 4 miRNA samples
`barcoded using our above-mentioned pre-PCR barcoding strategy
`from the Human Brain Reference RNA (Ambion). Each pool was
`sequenced in a single lane on an Illumina GAIIx.
`Parallel to PALM barcoding for small RNA, we also developed
`a PALM barcoding protocol for DNA samples or messenger RNA
`(mRNA) converted to double stranded DNA (dsDNA). The main
`difference compared to the PALM barcoding for small RNA, is the
`fact
`that double stranded adapters instead of single stranded
`
`PLoS ONE | www.plosone.org
`
`1
`
`October 2011 | Volume 6 |
`
`Issue 10 | e26969
`
`00001
`
`EX1022
`
`

`

`Bias in TruSeq and Post Amplification Barcoding
`
`adaptors need to be ligated before PCR. In the present study, we
`compared the de-multiplexed quantitative results of 12 differen-
`tially PALM barcoded DNA samples and 12 TruSeq barcoded
`DNA samples. Reference DNA was generated by converting
`Saccharomyces cerevisiae mRNA into double stranded DNA. Each
`pool was sequenced in a single lane on an Illumina HiSeq 2000.
`
`Methods
`
`PALM small RNA barcoding
`is similar to the
`The PALM miRNA barcoding protocol
`Illumina Small RNA v1.5 Sample Preparation Guide. This
`protocol was modified to achieve a higher yield after the PCR
`amplification step using higher reaction volumes for the RT-PCR
`step. No extra cycles were added to the PCR reaction. The
`adapters used in the protocol were modified to allow for PALM
`barcoding and Illumina index sequencing with the Illumina
`multiplexing index read sequencing primer. The complete
`protocol, including the adapter sequences, is available in Text
`S1. Figure S1 shows a typical Invitrogen 4% E-gel of a Human
`Brain Reference RNA (Ambion) library after PCR amplification
`and before barcode ligation. Figure 1 shows
`the necessary
`oligonucleotide components
`for PALM and how they are
`consecutively added to the miRNA sample. The key difference
`with respect to the current Illumina small RNA library protocol is
`the addition of the barcode to the library by ligation after PCR
`amplification. After ligation of the barcode, no further purification
`of the library is required. The library is quantified using analysis of
`area under the peaks with a BioAnalyzer 2100 (Agilent)
`to
`determine the correct
`loading concentration for
`subsequent
`sequencing.
`
`Pre-PCR barcoding of small RNA
`The pre-PCR miRNA barcoding protocol is also similar to the
`Illumina Small RNA v1.5.
`Sample Preparation Guide. The adapters used in the protocol
`were modified to include a barcode and to allow for Illumina index
`sequencing with the Illumina multiplexing index read sequencing
`primer. The complete protocol, including the adapter sequences, is
`available in Text S1.
`
`Preparation of dsDNA from S. cerevisiae mRNA
`Starting with poly A+ enriched RNA from S. cerevisiae
`(Clontech 636312), dsDNA was prepared with the NEBNext
`mRNA Sample Prep Reagent Set 1 (New England Biolabs E6100).
`During this procedure, RNA was fragmented with a fragmentation
`buffer and subsequently purified with the Qiagen RNeasy
`Minelute kit. After second strand cDNA synthesis, the dsDNA
`was purified with a Zymo DNA Clean and concentrator-5.
`
`PALM DNA barcoding
`The PALM DNA barcoding protocol is similar to the Illumina
`Genomic DNA Sample Preparation Guide. The adapters used in
`the protocol were modified to allow for PALM barcoding and
`Illumina index sequencing with the Illumina multiplexing index
`read sequencing primer. The complete protocol,
`including the
`adapter sequences, is available in Text S1. The main difference
`compared to the current Illumina Genomic DNA library protocol
`is the addition of the barcode to the library by ligation after PCR
`amplification. After ligation of the barcode, no further purification
`of the library is required. The library is quantified using analysis of
`area under the peaks with a BioAnalyzer 2100 (Agilent)
`to
`
`Figure 1. Comparative schematic of small RNA barcoding methods. The three methods start with ligation of a 3’ and 5’ RNA adapter to
`generate a substrate for RT-PCR. In the pre-PCR barcoding method, the barcode is incorporated in the 5’ adapter. In the TruSeq method, the barcode
`is incorporated in one of the RT-PCR primers. In the PALM barcoding method, the amplified RT-PCR product is A-tailed and ligated to a T-tailed
`barcoded adapter.
`doi:10.1371/journal.pone.0026969.g001
`
`PLoS ONE | www.plosone.org
`
`2
`
`October 2011 | Volume 6 |
`
`Issue 10 | e26969
`
`00002
`
`

`

`determine the correct
`sequencing.
`
`loading concentration for
`
`subsequent
`
`miRNA sequencing and data analysis
`The pooled PALM and pre-PCR miRNA libraries were each
`sequenced in one lane on an Illumina Genome Analyzer IIx
`sequencer
`(40 bp single reads), using version 4 of cluster
`generation and sequencing kits. Sequencing of the pooled TruSeq
`miRNA libraries was done in one lane on an Illumina HiSeq 2000
`sequencer
`(40 bp single reads), using version 4 of cluster
`generation and sequencing kits. Raw sequences were obtained
`from the Illumina GA Pipeline software CASAVA v1.7. The
`PALM barcoded sequences were demultiplexed using the Illumina
`pipeline and the pre-PCR barcodes using scripts written for this
`purpose. The pre-PCR barcodes cannot be demultiplexed using
`CASAVA because the pre-PCR barcode is not obtained with a
`separate read like the PALM and TruSeq barcode. The scripts
`allow for no mismatches in the barcode. Each barcode set was
`analyzed for small RNA using the Illumina pipeline add-on Flicker
`v2.7. Flicker trims the adaptor sequence from each read and does
`iterative alignment to the genome and to the miRNA database
`(miRBase v16) using the ELAND alignment strategy. The iterative
`alignment generates statistics of the number of reads aligning to
`the different classes of miRNA, as well as to individual miRNAs.
`
`DNA/mRNA sequencing and data analysis
`The pooled S. cerevisiae mRNA libraries were sequenced in one
`lane on an Illumina HiSeq 2000 sequencer (40 bp single reads),
`using version 4 of cluster generation and sequencing kits. The
`Illumina GA Pipeline software CASAVA v1.7. was used to obtain
`the reads and to demultiplex the PALM and TruSeq barcoded
`sequences. Each barcode read set was aligned and annotated with
`CASAVA v1.7 using the S. cerevisiae S228C genome downloaded
`from the UCSC Genome website and the S. cerevisiae GTF exon
`and splice site annotation file downloaded from the Ensembl
`website. Reads that aligned to each exon and splice junction site
`were summed per gene.
`
`TruSeq small RNA and DNA barcoding and sequencing
`For the TruSeq sample preparation, the Illumina TruSeq Small
`RNA Sample Prep Kit (RS-200–0012) and the Illumina TruSeq
`DNA Sample Prep Kit (FC-121–1001) were used.
`
`Results
`
`Yields and quantification of libraries
`several DNA
`The PALM barcode ligation step produces
`products but only the main product, library products with the
`barcode adapters ligated to both ends, are able to form clusters
`and generate sequencing data. For miRNA libraries, this product
`has a size of approximately 170 bp. For mRNA/DNA libraries
`this product has a size that is 102 bp longer than the size selected
`product before the PCR step. The other DNA products present in
`the library cannot form clusters or be sequenced: Residual barcode
`adapters (,32 bp) can bind to the Illumina flow cell with one end,
`but will not produce clusters because bridge amplification only
`occurs when both ends of the DNA strand bind to the flow cell.
`Barcode-adapter dimers (,64 bp), can bind to the flow cell, but
`will not produce sequence because they lack a sequencing primer
`hybridization site. For this reason, no gel purification step is
`needed after the PALM barcode ligation step. When no final gel
`purification step is performed, quantification of the total quantity
`of DNA present in the library after barcode ligation would over-
`estimate the available material for optimal cluster generation and
`
`Bias in TruSeq and Post Amplification Barcoding
`
`sequencing. Therefore, it is good practice to quantify the amounts
`of the desired products using an Agilent High Sensitivity DNA
`chip or an analogous gel- and microfluidics-based system to
`correctly load the flow cell.
`For miRNA PALM barcoding, we optimized the yield of the
`Illumina small RNA library preparation protocol (version 1.5) for
`PALM barcoding by using higher reaction volumes for the RT-
`PCR step. No extra cycles were added to the PCR reaction.
`Starting from 1 mg of Human Brain Reference total RNA, the
`protocol yields 11.1461.5 ng of gel purified PCR product. The
`PALM barcoding step worked well starting with between 2 and
`20 ng of gel-purified, PCR-amplified miRNA library. After PALM
`barcoding and AMPure XP bead purification, the final yield (in
`ng) of library with barcodes ligated to both ends, is approximately
`the same as the amount of PCR-amplified miRNA library used to
`start the PALM barcoding reaction.
`The mRNA/DNA PALM barcoding protocol is based on the
`Illumina Genomic DNA Sample Preparation Guide. Starting from
`the PALM protocol yields ,200 ng PCR-
`5 ng of dsDNA,
`amplified library (15 cycles) of which 100 ng was used in the
`PALM barcoding step. This generated .100 ng of library with
`barcodes ligated to both ends.
`
`Deep Sequencing Results of Human Brain Reference RNA
`We performed multiplexed miRNA deep sequencing on
`Human Brain Reference RNA using libraries prepared with three
`different protocols: PALM barcoded (12 barcodes), pre-PCR
`barcoded (4 barcodes) and TruSeq barcoded (12 barcodes).
`Sequencing of the brain RNA yielded 23,685,700 Illumina GAIIx
`pass-filter reads for the PALM barcoded pool, 24,171,696 Illumina
`GAIIx reads for the pre-PCR barcoded pool and 35,495,446
`Illumina HiSeq 2000 reads for the TruSeq pool. Of the pass-filter
`reads from the PALM, pre-PCR and TruSeq barcoded libraries,
`88%, 92% and 97% contained the barcode sequence respectively.
`Representation of the differentially barcoded libraries within the
`flow cell
`lanes was uniform and more than 50% of all
`the
`sequences mapped to mature miRNAs (Table S1).
`
`Deep Sequencing Results of S. cerevisiae mRNA
`We performed multiplexed mRNA deep sequencing on S.
`cerevisiae reference mRNA using libraries prepared with two
`different protocols: PALM barcoded (12 barcodes) and TruSeq
`barcoded (12 barcodes). Sequencing yielded 104,277,310 Illumina
`HiSeq 2000 pass-filter reads for the PALM barcoded pool and
`115,419,701 Illumina HiSeq 2000 pass-filter reads for the TruSeq
`pool. Of
`the pass-filter reads from the PALM and TruSeq
`barcoded libraries, 94% and 97% contained the barcode sequence
`respectively. Representation of the differentially barcoded libraries
`within the flow cell lanes was uniform and more than 60% of all
`the sequences mapped to exons and splice junction sites (Table
`S2).
`
`Evaluation of bias for miRNA barcoding
`We calculated the expression of each miRNA as its number of
`read counts normalized by the total number of reads for each
`library. The scatter plots
`in Figure 2 shows a side-by-side
`comparison of the miRNA expression profiles of the human brain
`reference libraries, barcoded using either the pre-PCR (A), PALM
`barcoding protocol (B) and the TruSeq barcoding protocol (C).
`This comparison reveals a very low variability in the miRNA
`expression profiles of the PALM and TruSeq barcoded samples
`but not for the pre-PCR barcoded samples, which is confirmed
`using a linear regression analysis on the miRNA with at least 10
`counts (Table S1) for one of the barcodes: Barcode 1 against the
`
`PLoS ONE | www.plosone.org
`
`3
`
`October 2011 | Volume 6 |
`
`Issue 10 | e26969
`
`00003
`
`

`

`Bias in TruSeq and Post Amplification Barcoding
`
`PLoS ONE | www.plosone.org
`
`4
`
`October 2011 | Volume 6 |
`
`Issue 10 | e26969
`
`00004
`
`

`

`Bias in TruSeq and Post Amplification Barcoding
`
`Figure 2. miRNA digital expression levels of all detected human brain reference sample miRNAs. (a) in the pre-PCR barcoded library 1
`versus their expression in the 3 other pre-PCR barcoded libraries, (b) in the PALM barcoded library 1 versus their expression in the 11 other PALM
`barcoded libraries, (c) in the TruSeq barcoded library 1 versus their expression in the 11 other TruSeq barcoded libraries.
`doi:10.1371/journal.pone.0026969.g002
`
`other barcodes gives an R2 = 0.819760.1217 for pre-PCR vs.
`R2 = 0.993060.0022 for PALM vs. R2 = 0.997760.0016 for
`TruSeq (See Table S3 for details). The bias introduced by the
`pre-PCR barcoding protocol precludes quantitative comparison of
`multiple samples using this strategy for multiplexing.
`
`Evaluation of bias for mRNA/dsDNA barcoding
`We calculated the expression of each mRNA as its number of
`read counts normalized by the total number of reads for each
`library. The scatter plots
`in Figure 3 shows a side-by-side
`comparison of the mRNA expression profiles of the human brain
`reference libraries, barcoded using either the PALM barcoding
`protocol
`(A) and the TruSeq barcoding protocol
`(B). This
`comparison reveals a very low variability in the mRNA expression
`profiles of the PALM and TruSeq barcoded samples, which is
`confirmed using a linear regression analysis on the mRNA with at
`least 10 counts (Table S2) for one of the barcodes: Barcode 1
`the other barcodes gives an R2 = 0.999160.0005 for
`against
`PALM vs. TruSeq R2 = 0.999660.0003 for TruSeq (See Table S3
`for details).
`
`Discussion
`
`The constantly increasing throughput of next generation
`sequencers opens the possibility for multiplexed sequencing of
`samples. For example, sequencing one miRNA sample in one flow
`cell lane on an Illumina GAIIx generates an order of magnitude
`more read data than required: There are currently only 1037
`known human miRNAs, representing a maximum of 25 kb of
`reference sequence [10]. Current Illumina technology provides
`.50 million reads from 1 flow cell lane. Thus, even multiplexing
`12 different miRNA samples in one lane results in .2 million
`reads per sample. This coverage is still enough to accurately
`quantify all but
`the low abundant miRNA present
`in these
`samples.
`A commonly used technique for multiplexing samples for deep
`sequencing is to incorporate a known, sample-specific nucleotide
`sequence in the DNA fragments during library preparation [1–5].
`
`This sample-specific sequence (barcode) is sequenced together with
`the rest of the fragment. PCR amplification of a pool of DNA
`molecules with different nucleotide compositions, especially near
`priming sites, can however result in quantitative bias because some
`DNA species are amplified more efficiently than others [6–9]. As
`we have shown here, introducing a barcode before the PCR step
`can result in a barcode-specific quantitative bias. Nonetheless, the
`currently published methods and commercial kits (i.e. Nugen and
`Bioo Scientific) introduce the barcode in the library before or
`during PCR-based library amplification. Unfortunately, none of
`these methods are provided with a quantitative analysis of the bias
`resulting from the use of barcodes. Thus, we reasoned that
`introduction of
`the barcode after library amplification would
`address this limitation by simply avoiding the problem and
`developed the PALM protocol. Illumina only recently introduced
`the TruSeq sample multiplexed sample preparation kits. The
`Illumina TruSeq small RNA strategy introduces the barcode
`during the PCR step using differentially barcoded primers, while
`the TruSeq DNA (or messenger RNA converted to double
`stranded DNA) strategy introduces the barcode before the PCR
`step by ligation of differentially barcoded adaptors. At the time of
`this publication, we are unaware of any published data
`demonstrating the impact of the TruSeq protocols on the bias
`created by the combination of barcoding and PCR. For this
`reason, we compared the PALM barcoding strategy with the
`TruSeq barcoding strategy.
`Our results describe a detailed quantitative analysis of PCR and
`barcoding bias obtained using the PALM and the TruSeq
`barcoding protocol. The PALM protocol demonstrates a robust
`and efficient multiplexing method for miRNA and mRNA
`expression profiling that is free of barcode-induced PCR bias. In
`contrast, our results for the same miRNA samples profiled with
`our pre-PCR barcoding protocol demonstrate significant barcode-
`specific bias. This bias is quite extreme, as the digital expression of
`the same miRNAs shows up to 100-fold differences in read counts
`for the top 200 most abundantly expressed miRNAs. Both the
`TruSeq miRNA and mRNA/dsDNA barcoding protocols show
`no bias.
`In the TruSeq miRNA protocol,
`the strategy of
`
`Figure 3. mRNA digital expression levels of all detected S.cerevisiaereference sample mRNAs. (a) in the PALM barcoded library 1 versus
`their expression in the 11 other PALM barcoded libraries, (b) in the TruSeq barcoded library 1 versus their expression in the 11 other TruSeq barcoded
`libraries.
`doi:10.1371/journal.pone.0026969.g003
`
`PLoS ONE | www.plosone.org
`
`5
`
`October 2011 | Volume 6 |
`
`Issue 10 | e26969
`
`00005
`
`

`

`introducing the barcode during the PCR step using differentially
`barcoded primers does not result in bias. The TruSeq protocol for
`mRNA/dsDNA which introduces the barcode before the PCR
`step, surprisingly also produces results with no bias. It is unclear
`why our pre-PCR protocol for small RNA produces biased results,
`while the TruSeq protocol for mRNA/dsDNA produces unbiased
`results. Compared to our pre-PCR small RNA protocol which
`places the barcode only 3 bp away from the miRNA insert, the
`TruSeq mRNA/dsDNA protocol places the barcode 34 bp away
`from the mRNA/dsDNA. Another difference is that the mRNA/
`dsDNA protocol contains no reverse transcriptase step after
`bacoding and works with a typical insert size of 250 bp, instead of
`the miRNA insert size of approx. 22 bp. Because of this, the
`barcode sequence might have less impact on the quantitative
`results after PCR.
`There are multiple sources of bias that can be introduced during
`sample purification and library preparation including ligation bias,
`secondary structures, PCR-bias created by amplification of
`differentially barcoded miRNAs and amplification bias introduced
`on the surface of the flow cell [11–13]. The important point in the
`context of the present work is that PALM and TruSeq barcoding,
`in contrast to the pre-PCR barcoding protocol we used, gives
`consistent and reproducible results allowing multiplexing and
`meaningful comparisons of differential miRNA and mRNA
`expression without the need for technical replicates with different
`barcodes. In addition, PALM is a transparent and adaptable
`alternative to commercial strategies with a limited number of
`barcodes. It allows the user to modify the protocol and provides
`the flexibility to synthesize as many barcodes as needed in order to
`keep up with the ever-growing sequencing throughput.
`
`References
`
`(2008)
`1. Craig DW, Pearson JV, Szelinger S, Sekar A, Redman M, et al.
`Identification of genetic variants using bar-coded multiplexed sequencing. Nat
`Methods 5: 887–893.
`2. Parameswaran P, Jalili R, Tao L, Shokralla S, Gharizadeh B, et al. (2007) A
`pyrosequencing-tailored nucleotide barcode design unveils opportunities for
`large-scale sample multiplexing. Nucleic Acids Res 35: e130.
`3. Rigola D, van Oeveren J, Janssen A, Bonne A, Schneiders H, et al. (2009) High-
`Throughput Detection of Induced Mutations and Natural Variation Using
`KeyPoint (TM) Technology. Plos One 4: e4761.
`4. Vigneault F, Sismour AM, Church GM (2008) Efficient microRNA capture and
`bar-coding via enzymatic oligonucleotide adenylation. Nat Methods 5: 777–779.
`5. Buermans HP, Ariyurek Y, van Ommen G, den Dunnen JT, t Hoen PA (2010)
`New methods for next generation sequencing based microRNA expression
`profiling. BMC Genomics 11: 716.
`6. Schutze T, Rubelt F, Repkow J, Greiner N, Erdmann VA, et al. (2011) A
`streamlined protocol for emulsion polymerase chain reaction and subsequent
`purification. Anal Biochem 410: 155–157.
`for
`7. Meyer SU, Pfaffl MW, Ulbrich SE (2010) Normalization strategies
`microRNA profiling experiments: a ‘normal’ way to a hidden layer of
`complexity? Biotechnol Lett 32: 1777–1788.
`
`Bias in TruSeq and Post Amplification Barcoding
`
`Supporting Information
`
`Figure S1 E-gel of a library after PCR amplification and
`before barcode ligation. Typical Invitrogen 4% E-gel with
`50 bp ladder of a Human Brain Reference RNA (Ambion) library
`after PCR amplification and before barcode ligation. The PCR
`product that needs to be purified from the gel is the band next to
`the 100 bp marker (second ladder band staring from the bottom of
`the picture). The bands closely above this PCR product should not
`be excised from the gel: Doing so lowers the percentage of mature
`miRNA sequences in the sequencing results.
`(TIF)
`
`Table S1 Human Brain RNA sequence quality statistics.
`(DOCX)
`
`Table S2 S. cerevisiae mRNA sequence quality statis-
`tics.
`(DOCX)
`
`Table S3 Matrix of correlations between differentially
`barcoded samples.
`(DOCX)
`
`Text S1 Supplementary Materials and Methods.
`(DOCX)
`
`Author Contributions
`
`Conceived and designed the experiments: FVN DRS SRH PO. Performed
`the experiments: FVN SS KP EA-LW PO. Analyzed the data: FVN LS.
`Contributed reagents/materials/analysis tools: DD. Wrote the paper: FVN
`KP DRS SRH PO.
`
`8. Lopez-Barragan MJ, Quinones M, Cui K, Lemieux J, Zhao K, et al. (2011)
`Effect of PCR extension temperature on high-throughput sequencing. Mol
`Biochem Parasitol 176: 64–67.
`(2009)
`9. Linsen SEV, de Wit E, Janssens G, Heater S, Chapman L, et al.
`Limitations and possibilities of small RNa digital gene expression profiling. Nat
`Methods 6: 474–476.
`10. Griffiths-Jones S, Saini HK, van Dongen S, Enright AJ (2008) miRBase: tools for
`microRNA genomics. Nucleic Acids Res 36: D154–D158.
`11. Tian G, Yin XY, Luo H, Xu XH, Bolund L, et al. (2010) Sequencing bias:
`comparison of different protocols of MicroRNA library construction. Bmc
`Biotechnol 10: 64.
`12. Nelson PT, Wang WX, Wilfred BR, Tang GL (2008) Technical variables in
`high-throughput miRNA expression profiling: Much work remains to be done.
`Bba-Gene Regul Mech 1779: 758–765.
`13. Romaniuk E, Mclaughlin LW, Neilson T, Romaniuk PJ (1982) The Effect of
`Acceptor Oligoribonucleotide Sequence on the T4 Rna Ligase Reaction.
`Eur J Biochem 125: 639–643.
`
`PLoS ONE | www.plosone.org
`
`6
`
`October 2011 | Volume 6 |
`
`Issue 10 | e26969
`
`00006
`
`

`

`00007
`
`

`

`Supporting Text S1: Supplementary Materials and Methods
`
`
`
`Quantitative Bias in Illumina TruSeq and a Novel Post Amplification Barcoding
`
`Strategy for Multiplexed DNA and small RNA Deep Sequencing
`
`Filip Van Nieuwerburgh, Sandra Soetaert, Katie Podshivalova, Eileen Ay-Lin Wang, Lana
`Schaffer, Dieter Deforce, Daniel R Salomon, Steven R Head, Phillip T. Ordoukhanian
`
`
`Table of Contents
`
`Supplementary Materials and Methods
`
`1) PALM barcoding of small RNA
`
`a) Materials
`
`b) Methods
`
`2) Pre-PCR barcoding of small RNA
`
`a) Materials
`
`b) Methods
`
`3) PALM barcoding of DNA
`
`a) Materials
`
`b) Methods
`
`00008
`
`

`

`Supplementary Materials and Methods
`
`
`PALM Barcoding of small RNA
`
`Materials: All oligonucleotides were ordered HPLC purified from Integrated DNA Technologies Inc.
`(IDT). Enzymes were obtained from Invitrogen, Life Technologies, Inc., New England Biolabs, and
`Enzymatics Inc.
`
`
`5′ GTGACTGGAGTTCAGACGTGTGCTCTTCCGA
`
`5′ rApp-AGATCGGAAGAGCACACGTCT(C3spacer)
`5′ GUUCAGAGUUCUACAGUCCGACGAUC
`
`• PALM Adapters
`
`5X PALM miRNA 3′adapter (10 µM)
`
`PALM miRNA 5′adapter (5 µM)
`
`• 5X PALM Reverse Transcription primer
`5X PALM RT primer (100 µM)
`
`
`
`• PALM PCR primers
`5′ AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
`
`PALM miRNA PCR primer 1 (25 µM)
`5′ P-GTGACTGGAGTTCAGACGTGTGCTCTTCCGA
`
`PALM miRNA PCR primer 2 (25 µM)
`
`• PALM Barcodes (50 µM final concentration in annealed solution 50mM NaCl/10mM Tris pH 7.5)
`barcode 1-P 5′ P-G-ATCACG-ATCTCGTATGCCGTCTTCTGCTTG/3AmMO/
`barcode 1-T 5′ CAAGCAGAAGACGGCATACGAGATCGTGATC*T
`barcode 2-P 5′ P-G-CGATGT-ATCTCGTATGCCGTCTTCTGCTTG/3AmMO/
`barcode 2-T 5′ CAAGCAGAAGACGGCATACGAGATACATCGC*T
`barcode 3-P 5′ P-G-TTAGGC-ATCTCGTATGCCGTCTTCTGCTTG/3AmMO/
`barcode 3-T 5′ CAAGCAGAAGACGGCATACGAGATGCCTAAC*T
`barcode 4-P 5′ P-G-TGACCA-ATCTCGTATGCCGTCTTCTGCTTG/3AmMO/
`barcode 4-T 5′ CAAGCAGAAGACGGCATACGAGATTGGTCAC*T
`barcode 5-P 5′ P-G-ACAGTG-ATCTCGTATGCCGTCTTCTGCTTG/3AmMO/
`barcode 5-T 5′ CAAGCAGAAGACGGCATACGAGATCACTGTC*T
`barcode 6-P 5′ P-G-GCCAAT-ATCTCGTATGCCGTCTTCTGCTTG/3AmMO/
`barcode 6-T 5′ CAAGCAGAAGACGGCATACGAGATATTGGCC*T
`barcode 7-P 5′ P-G-CAGATC-ATCTCGTATGCCGTCTTCTGCTTG/3AmMO/
`barcode 7-T 5′ CAAGCAGAAGACGGCATACGAGATGATCTGC*T
`barcode 8-P 5′ P-G-ACTTGA-ATCTCGTATGCCGTCTTCTGCTTG/3AmMO/
`barcode 8-T 5′ CAAGCAGAAGACGGCATACGAGATTCAAGTC*T
`barcode 9-P 5′ P-G-GATCAG-ATCTCGTATGCCGTCTTCTGCTTG/3AmMO/
`barcode 9-T 5′ CAAGCAGAAGACGGCATACGAGATCTGATCC*T
`barcode 10-P 5′ P-G-TAGCTT-ATCTCGTATGCCGTCTTCTGCTTG/3AmMO/
`barcode 10-T 5′ CAAGCAGAAGACGGCATACGAGATAAGCTAC*T
`barcode 11-P 5′ P-G-GGCTAC-ATCTCGTATGCCGTCTTCTGCTTG/3AmMO/
`barcode 11-T 5′ CAAGCAGAAGACGGCATACGAGATGTAGCCC*T
`barcode 12-P 5′ P-G-CTTGTA-ATCTCGTATGCCGTCTTCTGCTTG/3AmMO/
`barcode 12-T 5′ CAAGCAGAAGACGGCATACGAGATTACAAGC*T
`(P = 5′phosphate, 3AmMO = 3′amine, and * = phosphorothioate linkage)
`
`• T4 RNA Ligase 2, truncated; T4 RNA Ligase; Finnzymes 2X Phusion HF master mix; and Taq
`DNA polymerase (New England Biolabs)
`• RNaseOUT, SuperScript™ II Reverse Transcriptase, Qubit Fluorometer, dsDNA High
`Sensitivity assay, Magnetic Particle Concentrator, E-Gel EX 4% Agarose Gel, TrackIt 50 bp
`ladder, and 10 mM ATP (Invitrogen, Life Technologies, Inc.)
`• Agarose Dissolving Buffer (ADB) and DNA Clean and concentrator -5 and -25 kits (Zymo
`Research Co.)
`• T4 DNA Ligase (Rapid), using 2X Rapid Ligation Buffer (Enzymatics, Inc.)
`• Molecular Biology Grade, DNase- and RNase-free MgCl2 (Sigma-Aldrich, Co.)
`• 2100 Bioanalyzer and High Sensitivity DNA kit (Agilent Technologies)
`
`00009
`
`

`

`• Agencourt AMPure XP magnetic beads (Beckman Coulter, Inc.)
`• Dark Reader® transilluminator (Clare Chemical Research, Inc.)
`
`
`
`Methods:
`
`1) Ligation of 3′- and 5′- adapters to total RNA
`1 µg of total RNA sample was added to 10 pmol of PALM miRNA 3′ adapter in a final volume
`of 6 µL. The mixture was incubated at 70°C for 2 minutes, and then transferred to ice.
`Subsequently, the following reagents were added to the mixture: 1 μL 10X T4 RNA Ligase 2
`truncated reaction buffer; 0.8 μL 100 mM MgCl2; 1.5 μL T4 RNA Ligase 2 truncated; and 0.5
`μL RNaseOUT, and the reaction was incubated at 22°C for 1 hour. Just prior to this reaction
`finishing, the PALM miRNA 5′ adapter was denatured by heating it at 70°C for 2 minutes and
`transferring it to ice. Then, the following reagents were added to the reaction mixture: 1 μL of
`10 mM ATP; 1 μL PALM miRNA 5′ Adapter; and 1 μL T4 RNA Ligase. The reaction was
`incubated at 20°C for 1 hour and then transferred to ice.
`
`
`
`
`
`
`
`2) Reverse transcription of adapter ligated products.
`12 μL of the above RNA Ligation reaction was then taken and added directly to 60 pmol of
`PALM RT primer in a final volume of 15 μL. The mixture was then heated to 70°C for 2
`minutes, and then transferred to ice. In a separate, nuclease-free PCR tube the following
`reagents were premixed: 6 μL 5X First Strand Buffer; 1.5 μL 12.5 mM dNTP mix; 3 μL 100
`mM DTT; and 1.5 μL RNaseOUT. The 15 μL of Ligation products and PALM RT primer were
`then combined with the 12 μL of reagents in the PCR tube. The mixture was heated to 48°C for
`3 minutes, and then 3 μL SuperScript™ II was added. The reaction w