Targeted Exon Sequencing by In-Solution
`Hybrid Selection
`Brendan Blumenstiel,1 Kristian Cibulskis,1 Sheila Fisher,1
`Matthew DeFelice,1 Andrew Barry,1 Tim Fennell,1 Justin Abreu,1
`Brian Minie,1 Maura Costello,1 Geneva Young,1 Jared Maquire,1
`Andrew Kernytsky,1 Alexandre Melnikov,1 Peter Rogov,1 Andreas Gnirke,1 and
`Stacey Gabriel1
`1Broad Institute, Cambridge, Massachusetts
`
`ABSTRACT
`This unit describes a protocol for the targeted enrichment of exons from randomly sheared
`genomic DNA libraries using an in-solution hybrid selection approach for sequencing on
`an Illumina Genome Analyzer II. The steps for designing and ordering a hybrid selection
`oligo pool are reviewed, as are critical steps for performing the preparation and hybrid
`selection of an Illumina paired-end library. Critical parameters, performance metrics, and
`analysis work(cid:223)ow are discussed. Curr. Protoc. Hum. Genet. 66:18.4.1-18.4.24. C(cid:2) 2010
`by John Wiley & Sons, Inc.
`Keywords: exon sequencing r hybrid selection r mutation discovery r
`DNA sequencing r targeting
`
`INTRODUCTION
`The ability to identify rare polymorphisms in the human genome is crucial for dis-
`covering genetic associations and causative mutations related to human disease. With
`the completion of the Human Genome Project (Lander et al., 2001; http://www.
`genome.gov/10001772), the framework was set for establishing a deep understanding of
`genomic variation, its structure, and its role in human disease. While genomic sequenc-
`ing is the most powerful tool for identifying a variety of genetic variants, whole-genome
`sequencing of thousands of samples remains prohibitively expensive, thus requiring
`targeted approaches to sequencing genomic regions of interest (Ng et al., 2009).
`Traditionally, targeted sequencing has been performed using single-plex PCR-based
`ampli(cid:222)cation followed by Sanger sequencing (Sj¤oblom et al., 2006). For a multitude of
`reasons including cost and logistic work(cid:223)ow, PCR-based targeting is no longer a cost-
`effective match for many of the new next-generation sequencing technologies emerging
`on the market. In recent years, several methods of exon targeting by hybrid selection have
`been developed by leveraging the massively parallel synthesis of long oligonucleotides
`on programmable arrays (Li et al., 2008; Gnirke et al., 2009). This relatively inexpensive
`method for simultaneous synthesis of tens of thousands of unique oligos has led to highly
`multiplexed methods for exon sequencing.
`By moving to array-based oligonucleotides ranging from 60 to 170 bp in length, pre-
`cise targeting of relatively short exons across many genes is possible. Programmable
`oligonucleotide microarrays can be used to capture and enrich exons by either solid-
`phase or solution-based hybrid selection. In the solution-based method developed and
`implemented at the Broad Institute, PCR-ampli(cid:222)ed DNA probes are then transcribed
`into biotinylated RNA, which is hybridized in-solution with a randomly sheared genomic
`DNA library. Hybridized DNA-RNA duplexes are pulled down using streptavidin-coated
`magnetic beads. Immobilized beads are then washed, removing non-hybridized DNA.
`
`Current Protocols in Human Genetics 18.4.1-18.4.24, July 2010
`Published online July 2010 in Wiley Interscience (www.interscience.wiley.com).
`DOI: 10.1002/0471142905.hg1804s66
`Copyright C(cid:2) 2010 John Wiley & Sons, Inc.
`
`UNIT 18.4
`
`High-
`Throughput
`Sequencing
`18.4.1
`Supplement 66
`
`00001
`
`EX1020
`
`

`

`The remaining captured DNA is subsequently denatured from the immobilized RNA,
`enriched by PCR, and sequenced on Illumina(cid:146)s Genome Analzyer II (GAII) sequencing
`system (Gnirke et al., 2009).
`Outlined in this unit are the steps for performing solution-based hybrid selection of ex-
`ons and preparing enriched libraries for paired-end Illumina sequencing on the Illumina
`GAII. Steps include genomic DNA shearing (Basic Protocol 1); Illumina paired-end
`library construction (end repair, A base addition, paired-end adapter ligation, PCR en-
`richment, and clean-up; Basic Protocol 2); hybrid selection (Basic Protocol 3); and library
`quanti(cid:222)cation for optimized cluster density using qPCR (Basic Protocol 4). In the Support
`Protocol, we describe several recommendations for performing read alignment, calcu-
`lating meaningful hybrid selection metrics, and visualizing and assessing sequence data
`for overall protocol performance. Speci(cid:222)c challenges and points of sensitivity are further
`discussed, along with speci(cid:222)c performance metrics that can be expected by following the
`published protocols.
`STRATEGIC PLANNING
`Choosing Targets and Baits
`The process for choosing targets is fairly straightforward, and several standard capture
`panels are commercially available, such as the Agilent SureSelect Human All Exon Kit.
`In choosing custom targets for hybrid capture, there are two major areas of consideration:
`target uniqueness and target size.
`The genome-wide uniqueness of the capture targets must be considered. If a region is
`not suf(cid:222)ciently unique in the genome, it may not be able to be aligned uniquely with
`short reads. Therefore, although the DNA fragments may be physically captured and
`sequenced, it is not straightforward to analyze the data. A more critical, related problem
`is targeting regions of high copy number in the genome, such as mitochondrial genes
`and ALU repeats. Targeting these regions is detrimental, not only because the results are
`dif(cid:222)cult to interpret, but because the high representation of these regions in the DNA
`causes them to be oversampled. As an example, in one recent capture experiment, 7%
`of reads mapped to targeted mitochondrial genes, even though those genes, represented
`only 0.1% of the target set (unpub. observ.).
`The total size of the targets to be captured has an effect on the ef(cid:222)ciency of the hybrid
`selection, with smaller target sets causing a smaller fraction of reads to align to the target.
`With large target sets, such as whole-exome capture, over 80% of the reads typically align
`to the desired target. However, with smaller sets of a few hundred genes, often only 50%
`to 70% of reads may align to the target. Once a set of targets is chosen, baits are typically
`tiled across the target with a small overlap between baits, as seen in Figure 18.4.1. The
`(cid:222)gure also illustrates the nomenclature commonly used to refer to regions surrounding
`the targets and baits.
`Biotinylated RNA Baits
`Solution-based hybrid selection involves the hybridization of a prepared paired-end
`Illumina library ((cid:147)pond(cid:148)) with a pool of biotinylated RNA ((cid:147)baits(cid:148)). These RNA baits
`are generated from unique oligonucleotides synthesized on an Agilent programmable
`DNA microarray. Up to 55,000 unique oligos can be synthesized simultaneously; they
`are 150-200 bp in length and include 15-bp universal PCR primer sites at the ex-
`treme ends. Following synthesis, the oligos are stripped from the array substrate and
`are universally PCR ampli(cid:222)ed into double-stranded DNA. A second round of PCR in-
`corporates a T7 promoter site into the amplicon, which is used to transcribe the DNA
`into single-stranded, biotinylated RNAs. This process has recently been commercial-
`ized by Agilent Technologies and is currently being marketed as the SureSelect Target
`
`Current Protocols in Human Genetics
`
`Targeted Exon
`Sequencing by
`In-Solution
`Hybrid Selection
`18.4.2
`Supplement 66
`
`00002
`
`

`

`off target
`
`off target
`
`on target
`
`baits (120-mer)
`
`near bait
`(target +/- 250 b)
`
`on bait
`
`near bait
`(target +/- 250 b)
`
`Figure 18.4.1 Targets, baits, and nomenclature. Sequencing reads can fall into several cate-
`gories depending on where they align along a targeted region of the genome. Bases aligning
`to the exact targeted sequence are considered “on target.” Because RNA bait sequences can
`hang off the ends of the actual target, aligned bases can be “off target” but “on bait.” Addi-
`tionally, because randomly sheared fragments vary in size, it is realistic to expect a proportion
`of aligned bases to be “near bait,” which is considered ±250 bp of thebait sequence. Met-
`rics calculating the percentage of bases falling into these categories are helpful in understand-
`ing the performance of a hybrid selection experiment. For the color version of the figure, go to
`http://www.currentprotocols.com/protocol/hg1804.
`Enrichment System. Agilent has developed a streamlined web interface for uploading
`custom probe sequences that can be synthesized and manufactured into a ready-to-use
`biotinylated RNA pool (https://earray.chem.agilent.com/earray).
`
`DNA Quality and Quantity
`DNA quality and quantity must be considered when compiling a cohort for hybrid
`selection sequencing. If available, DNA samples with more than 3 μg of high-quality
`DNA should be used. Although whole-genome DNA extracted from cell lines and blood
`is preferred, whole-genome ampli(cid:222)ed DNA can be used as long as the starting DNA
`is not highly degraded. Before beginning a hybrid selection study, all samples should
`be quanti(cid:222)ed and an aliquot from each sample should be assessed for quality by gel
`electrophoresis or bioanalyzer.
`
`DNA FRAGMENTATION
`Genomic DNA must be fragmented in order to capture and sequence exons. First, because
`the goal is to sequence only exons and as little background genome as possible, DNA must
`be fragmented to a size that allows maximum sequence coverage of targeted exons with
`minimal sequencing of neighboring intronic regions. Because exons average ∼160 bp
`in length, shearing DNA to a mean length of ∼150 bp enables the ef(cid:222)cient capture and
`sequencing of these small target regions. Second, for optimal clonal cluster ampli(cid:222)cation
`on the (cid:223)ow cell, DNA fragments should range from 200 to 500 bp in length. With a tight
`fragment size distribution, uniformly sized clusters are more easily differentiated from
`one another on the GAII, ultimately increasing sequence yields.
`Several methods for randomly shearing DNA are in use today, including nebulization
`using compressed air, sonication, and hydro-shearing. These methods typically produce
`a wide size distribution and often require the use of a preparative gel and size selection to
`obtain the tight size distribution preferred for exon hybrid selection. To eliminate material
`loss and the time-consuming process of gel-based size selection, we routinely use a
`more recently developed DNA shearing technology called Adaptive Focused Acoustics
`(AFA). The Covaris S-series Sample Prep Station is highly adjustable and allows genomic
`
`Current Protocols in Human Genetics
`
`BASIC
`PROTOCOL 1
`
`High-
`Throughput
`Sequencing
`18.4.3
`Supplement 66
`
`00003
`
`

`

`genomic
`DNA
`
`sheared
`DNA
`
`Band
`size (bp)
`
`2,000
`1,500
`1,000
`700
`
`500
`
`300
`
`150
`
`50
`
`Figure 18.4.2 Sheared genomic DNA size distribution. High-quality genomic DNA was sheared
`using the Covaris instrument. Unsheared gDNA (100 ng) and sheared DNA (200 ng) were run in
`parallel on a 2% agarose gel. After shearing, the bulk of the fragments should run between ∼100
`and 400 bp.
`
`DNA to be sheared into a tight band averaging 150 bp with a distribution of ∼100 to
`400 bp (Fig. 18.4.2). The Covaris instrument uses adjustable acoustic energy that is
`focused into a glass vial containing the diluted DNA samples. The focused energy
`creates tiny bubbles that constantly collapse in a process called cavitation, which shears
`the DNA. By adjusting the energy level and the exposure time, genomic DNA can be
`sheared to many size distributions.
`Materials
`DNA sample (e.g., see APPENDIX 3B)
`Nuclease-free water
`70% (v/v) ethanol
`NanoDrop ND-1000 spectrophotometer
`Covaris S-2 Sample Preparation System
`VWR circulating chiller
`Covaris shearing vial (6 × 16−mm AFA (cid:222)ber vial; cat. no. 520045)
`1.5-ml microcentrifuge tube
`Agencourt AMPure XP kit (Beckman Coulter, cat. no. A63881)
`Magnetic separator (DynaMag Spin Magnet, Invitrogen, cat. no. 123-20D)
`Additional reagents and equipment for DNA quantitation (APPENDIX 3D) and agarose
`gel electrophoresis (UNIT 2.7)
`Dilute DNA sample
`1. Prepare a dilution of DNA sample at a concentration of 3 μg in 100 μl nuclease-free
`water (∼30 ng/μl).
`
`Current Protocols in Human Genetics
`
`Targeted Exon
`Sequencing by
`In-Solution
`Hybrid Selection
`18.4.4
`Supplement 66
`
`00004
`
`

`

`2. Con(cid:222)rm DNA concentration by absorption at 260 nm on a Nanodrop ND-1000
`spectrophotometer (APPENDIX 3D), using nuclease-free water to blank the instrument.
`Shear DNA
`3. Fill a Covaris water bath to the (cid:222)ll line, adjust circulating chiller bath to 4◦C, and
`begin degassing. Allow system to chill and degas for 20 min or more.
`4. Pipet 100 μl DNA sample through the split septum cap of a shearing vial, insert vial
`into holder, and place holder into position.
`5. Adjust shearing parameters and run program as follows:
`Duty cycle
`10%
`Intensity
`5%
`Cycler/burst
`200
`Mode
`frequency sweeping
`# Cycles
`3.
`6. Pipet the sheared sample from the vial to a clean 1.5-ml microcentrifuge tube.
`Clean DNA using AMPure XP beads
`7. Allow AMPure beads to equilibrate to room temperature ∼20 min.
`For additional information about using AMPure beads, see manufacturer(cid:146)s instructions.
`8. Gently shake the bottle to resuspend any beads that may have settled and ensure that
`mixture is homogeneous.
`9. Slowly add 1.8× volume (180 μl) of beads to the sheared DNA.
`10. Vortexbead/reactionmixturefor10secoruntilthemixtureishomogeneous.Incubate
`5 min at room temperature.
`11. Place the tube on a magnetic separator and allow the beads to separate out of solution
`for 2 min until the solution appears clear.
`12. With the tube still on the magnet, slowly pipet off and discard the supernatant.
`13. Gently pipet 500 μl of 70% ethanol into the tube, being careful not to disturb beads.
`Let stand 30 sec and then remove and discard the ethanol wash.
`14. Repeat wash, being sure to remove all ethanol after the second wash.
`15. With tube still on the magnet, allow beads to air dry for 2 min.
`Do not allow beads to over dry and appear cracked, as this will greatly reduce DNA
`recovery.
`Elute DNA
`16. Remove tube from magnet and add 32 μl nuclease-free water to elute DNA.
`17. Brie(cid:223)y vortex to ensure all beads come in contact with eluant.
`18. Place tube on magnetic separator and allow beads to separate for 1 min until liquid
`is clear.
`19. Carefully pipet the eluate to a new labeled tube. Store at −20◦C until end repair
`step.
`Check DNA fragment size
`20. Run 2 μl of eluate on a 2% agarose gel to ensure correct fragment distribution.
`The smear should be from ∼100 to 400 bp with a peak around 150 to 200 bp.
`
`Current Protocols in Human Genetics
`
`High-
`Throughput
`Sequencing
`18.4.5
`Supplement 66
`
`00005
`
`

`

`BASIC
`PROTOCOL 2
`
`Targeted Exon
`Sequencing by
`In-Solution
`Hybrid Selection
`18.4.6
`Supplement 66
`
`PAIRED-END LIBRARY PREPARATION
`Library preparation follows a slightly modi(cid:222)ed Illumina paired-end sample preparation
`protocol by which randomly sheared genomic DNA fragments are modi(cid:222)ed so that they
`can be effectively hybridized to a (cid:223)ow cell, cluster ampli(cid:222)ed, and subsequently sequenced
`on the Genome Analyzer II. Brie(cid:223)y, randomly sheared DNA fragments are end-repaired
`to produce blunt ends. Blunt-ended fragments are extended with a single dATP to produce
`a single A-base overhang to which speci(cid:222)c adapters with a single dTTP overhang can be
`ligated. A universal PCR ampli(cid:222)cation is used to enrich for successfully adapter-ligated
`fragments, increase library concentration, and add an additional utility sequence used to
`hybridize fragments to a (cid:223)ow cell for cluster ampli(cid:222)cation and sequencing.
`Materials
`Illumina Paired End Sample Prep Kit (cat. no. PE-102-1001), containing:
`10× T4 DNA ligase buffer w/10 mM ATP
`T4 polynucleotide kinase
`T4 DNA polymerase
`Klenow fragment (3(cid:5)→5(cid:5) exo) and Klenow buffer
`10 mM dNTP mix
`1 mM dATP
`DNA ligase and 2× buffer
`Nuclease-free water
`Sheared, cleaned DNA sample (see Basic Protocol 1)
`Paired-end oligo mix (Illumina)
`2× Phusion high-(cid:222)delity PCR master mix (Finnzymes, cat. no. F-531S)
`PCR primers, 100 μM each:
`PE1.0: AAT GATACGGCGACCACCGAGATCTACACTCTTTCCCTACAC
`GACGCTCTTCCGATCT
`PE2.0: CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCT
`GAACCGCTCTTCCGATCT
`96-well PCR plate
`Thermocycler
`Additional reagents and equipment for cleaning DNA with AMPure beads (see
`Basic Protocol 1), agarose gel electrophoresis (UNIT 2.7), and DNA quantitation
`(APPENDIX 3D)
`Perform end repair
`1. Prepare end repair master mix on ice as follows (20 μl/reaction):
`5.0 μl 10× T4 DNA ligase buffer with 10 mM ATP
`2.5 μl T4 polynucleotide kinase
`2.5 μl T4 DNA polymerase
`0.5 μl Klenow fragment
`2.0 μl 10 mM dNTP mix
`7.5 μl nuclease-free water.
`2. Add 20 μl end repair mix to 30 μl sheared, cleaned DNA in a 96-well PCR plate for
`a total reaction volume of 50 μl.
`3. Vortex, spin down, seal, and incubate on a thermocycler as follows:
`25◦C
`30 min
`4◦C
`hold.
`
`Current Protocols in Human Genetics
`
`00006
`
`

`

`4. Clean reaction mixture using AMPure XP beads (see Basic Protocol 1, steps 7 to
`19). Use a 1.8× bead concentration and elute with 32 μl nuclease-free water.
`Carry out A-base addition
`5. Prepare A-base addition mix on ice as follows (18 μl/reaction):
`5.0 μl Klenow buffer
`10.0 μl 1 mM dATP
`3.0 μl Klenow fragment (exo).
`6. Add 18 μl A-base addition mix to 32 μl cleaned, end-repaired DNA in a 96-well
`PCR plate for a total reaction volume of 50 μl.
`7. Vortex, spin down, seal, and incubate on a thermocycler as follows:
`37◦C
`30 min
`4◦C
`hold.
`8. Clean reaction mixture using 1.8× volume AMPure XP beads and elute with 24 μl
`nuclease-free water.
`Ligate adapter
`9. Prepare adapter ligation mix on ice as follows (36 μl/reaction):
`30 μl 2× DNA ligase buffer
`3.9 μl paired-end oligo mix
`2.7 μl DNA ligase.
`10. Add 36 μl adapter ligation mix to 24 μl cleaned, A-tailed DNA in a 96-well PCR
`plate for a total reaction volume of 60 μl.
`11. Vortex, spin down, seal, and incubate on a thermocycler as follows:
`25◦C
`30 min
`4◦C
`hold.
`12. Clean reaction mixture using 1.8× volume AMPure XP beads and elute with 40 μl
`nuclease-free water.
`Enrich by PCR
`13. Prepare PCR master mix on ice as follows (15 μl/reaction):
`50 μl 2× Phusion master mix
`1.0 μl Primer PE1.0
`1.0 μl Primer PE2.0
`8.0 μl nuclease-free water.
`14. Add 60 μl PCR master mix to 40 μl cleaned, adapter-ligated DNA in a 96-well PCR
`plate for a total reaction volume of 100 μl.
`15. Vortex, spin down, seal, and incubate on a thermocycler as follows:
`98◦C
`1 cycle:
`30 sec
`98◦C
`6 cycles:
`10 sec
`65◦C
`30 sec
`72◦C
`30 sec
`72◦C.
`5 min
`1 cycle:
`16. Clean reaction mixture using 1.8× volume AMPure XP beads and elute with 35 μl
`nuclease-free water.
`
`Current Protocols in Human Genetics
`
`High-
`Throughput
`Sequencing
`18.4.7
`Supplement 66
`
`00007
`
`

`

`17. Run 3 μl of cleaned PCR product on a 2% agarose gel to con(cid:222)rm ampli(cid:222)cation.
`Ligation of paired-end adapters and ampli(cid:222)cation using PE1.0/PE2.0 primers adds an
`additional 120 bp of Illumina utility sequence, increasing sheared fragment size by 120 bp.
`The smear should now run from ∼250 to 600 bp, with a peak around 350 bp.
`18. Quantify DNA using the NanoDrop ND-1000 (APPENDIX 3D).
`
`HYBRID SELECTION
`In-solution hybrid selection works on the same principle as any typical DNA microarray.
`In this case, speci(cid:222)c capture of targeted exons is accomplished by mixing single-stranded
`biotinylated RNA baits with a denatured Illumina paired-end library under high strin-
`gency conditions. A 24-hour incubation at 65◦C drives the speci(cid:222)c hybridization of
`DNA and RNA based on sequence complementarity. To wash away non-hybridized
`DNA fragments, biotinylated DNA-RNA duplexes are immobilized using streptavidin-
`coated paramagnetic beads and are pulled out of solution using a magnetic separator.
`Repeated washing of beads at high stringency removes non-speci(cid:222)cally hybridized DNA
`fragments. Captured DNA fragments are then chemically denatured from the immo-
`bilized RNA with sodium hydroxide. The released DNA fragments are cleaned and
`PCR-enriched to produce a highly enriched targeted exon library ready for sequencing
`on the Illumina Genome Analyzer.
`Materials
`Adapter-ligated DNA (see Basic Protocol 2)
`50× Denhardt(cid:146)s solution
`20× SSPE
`Nuclease-free water
`10% SDS
`0.5 M EDTA
`1.0 mg/ml human Cot-1 DNA (Invitrogen, cat. no. 15279-101)
`10.0 mg/ml salmon sperm DNA (Invitrogen, cat. no. 15632-011)
`Blocking oligos (200 μM each, custom oligos from IDT)
`Oligo 1.0: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACAC
`GACGCTCTTCCGATCT
`Oligo 2.0: CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCT
`GCTGAACCGCTCTTCCGATCT
`100 ng/μl Biotinylated RNA Oligo Library (Agilent Technologies SureSelect)
`20 U/μl Superase-In RNAse Inhibitor (Applied Biosystems, cat. no. AM2694)
`Dynabeads M-280 Streptavidin Beads (Invitrogen, cat. no. 112-05D)
`5 M NaCl
`1 M Tris-Cl
`20× SSC
`0.1 N NaOH
`2× Phusion high-(cid:222)delity PCR master mix (Finnzymes, cat. no. F-531S)
`PCR primers, 100 μM each:
`PE1.0: AAT GATACGGCGACCACCGAGATCTACACTCTTTCCCTACAC
`GACGCTCTTCCGATCT
`PE2.0: CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCT
`GAACCGCTCTTCCGATCT
`NanoDrop ND-1000 spectrophotometer
`Speedvac evaporator
`65◦C heating block with 1.5-ml tube holder
`96-well PCR plates
`1.5-ml microcentrifuge tubes
`
`Current Protocols in Human Genetics
`
`BASIC
`PROTOCOL 3
`
`Targeted Exon
`Sequencing by
`In-Solution
`Hybrid Selection
`18.4.8
`Supplement 66
`
`00008
`
`

`

`Adhesive plate seal
`96-well thermocycler with heated lid
`50 ml conical tube
`Magnetic separator (DynaMag Spin Magnet, Invitrogen, cat. no. 123-20D)
`Additional reagents and equipment for DNA quantitation (APPENDIX 3D) and
`cleaning DNA with AMPure beads (see Basic Protocol 1)
`Hybridize DNA to RNA
`1. EnsurethatpondDNAisataconcentrationof≥100ng/μlbycheckingonaNanodrop
`ND-1000 spectrophotometer (APPENDIX 3D). If concentration is too low, concentrate
`sample in a Speedvac evaporator.
`2. Prepare hybridization buffer in a 1.5-ml tube as follows:
`500 μl 20× SSPE
`240 μl nuclease-free water
`200 μl 50× Denhardt(cid:146)s solution
`20 μl 10% SDS
`20 μl 0.5 M EDTA.
`3. Vortex hybridization buffer and place in a 65◦C heating block. Occasionally re-vortex
`mixture to ensure SDS precipitate is fully dissolved and buffer appears clear.
`4. In a 96-well plate labeled (cid:147)DNA,(cid:148) combine the following in appropriate wells:
`500 ng enriched pond (5.0 μl at 100 ng/μl)
`2.5 μl 1.0 mg/ml human Cot-1 DNA
`2.5 μl 10.0 mg/ml salmon sperm DNA
`1.5 μl 200 μM blocking oligo 1.0
`1.5 μl 200 μM blocking oligo 2.0.
`5. In a 1.5-ml tube labeled (cid:147)bait(cid:148) combine:
`5.0 μl 100 ng/μl biotinylated oligo library (bait)
`1.0 μl 20 U/μl Superase-In RNAse inhibitor
`1.0 μl nuclease-free water.
`6. Seal the DNA plate with adhesive plate seal, vortex, centrifuge brie(cid:223)y, and place on
`a thermocycler. Close lid and start the hybrid selection program as follows:
`95◦C
`5 min
`65◦C
`hold.
`7. Allow DNA to denature for 5 min and then equilibrate to 65◦C for 5 min.
`8. As soon as the DNA plate has stabilized at 65◦C for 2.5 min, place the tube containing
`RNA bait into a 65◦C heating block and set timer for 2.5 min.
`9. Once RNA has incubated for 2.5 min at 65◦C, pause program, open lid of thermo-
`cycler, and remove adhesive seal.
`It is critical to perform the following addition steps quickly to minimize volume loss to
`evaporation while the plate is open and heated at 65◦C.
`10. With the DNA plate still in the thermocycler, remove hybridization buffer from the
`heating block, brie(cid:223)y spin down, and pipet 13 μl hybridization buffer to each sample.
`11. Quickly remove the RNA bait tube from the 65◦C heating block, spin down, and
`pipet 6 μl to each sample.
`
`Current Protocols in Human Genetics
`
`High-
`Throughput
`Sequencing
`18.4.9
`Supplement 66
`
`00009
`
`

`

`12. Mix 10 times with a pipettor set at 10 μl, reseal plate with new adhesive seal, close
`the thermocycler lid, and continue the program.
`13. Incubate hybridization reaction at 65◦C for 24 hr.
`Prepare M-280 streptavidin beads
`14. In a 50-ml conical tube, prepare bead wash buffer as follows:
`19.7 ml nuclease-free water
`5 ml 5 M NaCl
`250 μl 1 M Tris-Cl
`50 μl 0.5 M EDTA.
`15. In a 1.5-ml microcentrifuge tube, combine 50 μl streptavidin beads with 200 μl bead
`wash buffer per sample (e.g., for 5 samples, combine 250 μl beads with 1 ml buffer).
`Vortex for 30 sec.
`16. Place tube on magnetic separator for 2 min to allow beads to settle out of the mixture.
`17. With the tube still on the magnet, use a pipet to remove and discard the supernatant.
`18. Remove the tube from the magnet and add 165 μl bead wash buffer per reaction
`(e.g., for 5 samples, add 825 μl buffer). Resuspend beads by vortexing 30 sec.
`19. Repeat steps 17 and 18 for a total of three washes.
`20. After the (cid:222)nal wash, resuspend beads in 165 μl bead wash buffer per reaction.
`These wash steps remove the storage buffer and are necessary for effective streptavidin-
`biotin binding.
`Capture hybridized DNA/RNA
`21. When hybridization is complete (step 13), remove DNA plate from the thermocycler
`and transfer each reaction to a labeled 1.5-ml microcentrifuge tube.
`22. Add 165 μl washed beads to each tube. Vortex 10 sec and incubate mixture at room
`temperature for 30 min, vortexing occasionally to keep beads suspended.
`23. Place tubes on magnetic separator and allow to separate for 2 min. Remove and
`discard supernatant. Remove the tube from the magnet.
`24. Prepare low-stringency buffer as follows:
`23.5 ml nuclease-free water
`1.25 ml 20× SSC
`250 μl 10% SDS.
`25. Add 165 μl low-stringency buffer to each sample and incubate at room temperature
`for 15 min.
`26. Place tubes on magnet and allow beads to separate for 2 min. Remove and discard
`supernatant and remove tube from magnet.
`27. Prepare high-stringency buffer as follows:
`24.6 nuclease-free water
`125 μl 20× SSC
`250 μl 10% SDS.
`Aliquot into 1.5-ml tubes and warm to 65◦C in a heating block.
`28. Add 165 μl prewarmed high-stringency buffer to each sample, vortex to resuspend
`beads, and incubate in heating block at 65◦C for 10 min.
`
`Current Protocols in Human Genetics
`
`Targeted Exon
`Sequencing by
`In-Solution
`Hybrid Selection
`18.4.10
`Supplement 66
`
`00010
`
`

`

`29. Place tubes on the magnet and let beads separate for 2 min. Remove and discard the
`supernatant.
`30. Repeat steps 28 and 29 for a total of three washes.
`Denature DNA/RNA hybrid
`31. Denature DNA from bead-bound RNA by adding 50 μl of 0.1 N NaOH to each
`sample. Vortex to resuspend beads and incubate at room temperature for 10 min.
`32. Transfer tube to the magnet and let beads separate for 2 min.
`33. Remove the supernatant (containing the target-selected DNA) and transfer to a fresh
`tube.
`34. Add 50 μl of 1 M Tris-Cl to neutralize the NaOH.
`35. Clean reaction using 1.8× volume AMPure XP beads (see Basic Protocol 1, steps 7
`to 19). Elute (cid:147)catch(cid:148) DNA using 40 μl nuclease-free water.
`Enrich captured DNA
`36. Prepare PCR master mix on ice as follows (15 μl/reaction):
`50 μl 2× Phusion master mix
`1.0 μl Primer PE1.0
`1.0 μl Primer PE2.0
`8.0 μl nuclease-free water.
`37. Add 60 μl PCR master mix to 40 μl cleaned (cid:147)catch(cid:148) DNA in a 96-well PCR plate
`for a total reaction volume of 100 μl.
`38. Vortex, spin down, seal, and incubate on a thermocycler as follows:
`98◦C
`1 cycle:
`30 sec
`98◦C
`12 cycles:
`10 sec
`65◦C
`30 sec
`72◦C
`30 sec
`72◦C.
`5 min
`1 cycle:
`39. Clean reaction mixture using 1.8× volume AMPure XP beads and elute with 35 μl
`nuclease-free water. Store at −20◦C until sequencing.
`40. Quantify DNA using the NanoDrop ND-1000.
`The size of the PCR-ampli(cid:222)ed DNA can be veri(cid:222)ed by agarose gel electrophoresis;
`however, with only twelve cycles of PCR, the product may not be detectable on a gel. The
`subsequent qPCR step will reveal whether there is enough product for sequencing.
`LIBRARY QUANTIFICATION BY qPCR
`Accuratequanti(cid:222)cationofalibraryiscriticalforef(cid:222)cientsequencingontheGenomeAna-
`lyzer. Loading a sample at too high a concentration can saturate the surface chemistry, hin-
`dering the ability of the software to differentiate one cluster from another and ultimately
`reducing the yield of quality reads. Alternatively, loading a sample at too low a concentra-
`tionfailstofullyutilize(cid:223)owcellrealestate,generatinglowsequencingyieldsandlimiting
`the coverage of targets of interest. Because only DNA fragments containing the correct se-
`quences on either end will hybridize and produce clusters on the (cid:223)ow cell, simple quanti(cid:222)-
`cation by OD is often insuf(cid:222)cient for accurately calculating the optimal loading concen-
`tration of a given sample. An effective solution is to run a quantitative real-time PCR assay
`usingapreviouslysequencedpaired-endlibraryasastandardandprimerscomplementary
`to the P5 and P7 sequences used in hybridization and cluster ampli(cid:222)cation on the (cid:223)ow cell.
`
`Current Protocols in Human Genetics
`
`BASIC
`PROTOCOL 4
`
`High-
`Throughput
`Sequencing
`18.4.11
`Supplement 66
`
`00011
`
`

`

`Any well-characterized library can be used for a standard curve, but in many labs the PhiX
`control library provided by Illumina is often well-calibrated for optimal cluster densities.
`Brie(cid:223)y, 1-μl of each library of unknown concentration is diluted 100-fold, and 1μl is
`used as template in a PCR reaction containing SYBR Green stain and P5 and P7 primers.
`Only DNA fragments with both a P5 and P7 sequence on either end will be ampli(cid:222)ed and
`generate (cid:223)uorescent signal by the intercalation of the SYBR stain into double-stranded
`DNA. The qPCR reaction is performed on a real-time PCR machine, which records the
`(cid:223)uorescence intensity for each cycle of ampli(cid:222)cation for each well. Upon completion
`of the cycling program, the software determines an intensity threshold (Rn) within the
`exponential log phase of PCR ampli(cid:222)cation. For each well, the Ct (or cycle-threshold)
`value is calculated by determining the exact cycle at which the (cid:223)uorescence intensity
`crosses the set intensity threshold. The Ct values for the standard curve are plotted, a best-
`(cid:222)t line is calculated, and concentrations for unknown samples are reported (Fig. 18.4.3).
`Materials
`10 nM PhiX Control Library (Illumina, cat. no. 1006471)
`Nuclease-free water
`Target-selected DNA library (see Basic Protocol 3)
`2× Brilliant SYBR Green QPCR Master Mix (Stratagene, cat. no. 600548)
`1 mM ROX Reference Dye
`1.25 μM P5 PCR primer (AATGATACGGCGACCACCGA)
`1.25 μM P7 PCR primer (CAAGCAGAAGACGGCATACGA)
`384 well MicroAmp Optical Reaction Plate (Applied Biosystems, cat. no. 4326270)
`MicroAmp Optical Adhesive Film (Applied Biosystems, cat. no. 4311976)
`ABI 7900HT Real-Time PCR System with SDS V2.3 software (Applied
`Biosystems)
`Create standard curve
`1. Add 2 μl of 10 nM PhiX Control Library to 98 μl nuclease-free water. Vortex well,
`spin down, and label this dilution (cid:147)PhiX Control 20 nM.(cid:148)
`Although the true dilution is now 0.2 nM, the label (20 nM) is scaled up 100-fold as a
`means of accounting for the 1/100 dilution of the library. Entering 100× standard curve
`points in the ABI analysis software allows the read-out to re(cid:223)ect the true concentration
`of the undiluted library.
`2. Add 50 μl of (cid:147)PhiX Control 20 nM(cid:148) to 50 μl nuclease-free water, vortex well, and
`spin down. Continue dilutions to create a seven-step, two-fold serial dilution (20, 10,
`5, 2.5, 1.25, 0.625, and 0.313 nM). Add 50 μl nuclease-free water to another tube
`and label as (cid:147)NTC(cid:148) (No Template Control).
`These labeled concentrations cover a 1/100 dilution of sample template and are at a
`working concentration for the qPCR assay.
`Carry out qPCR quanti(cid:222)cation
`3. Prepare a 1/100 dilution of each library to be quanti(cid:222)ed by carefully pipetting 1 μl
`of library into 99 μl nuclease-free water. Vortex 30 sec and spin down.
`4. Prepare qPCR master mix on ice as follows:
`12.5 μl 2× Brilliant SYBR Green Master Mix
`0.375 μl 2 μM ROX Reference Dye
`1.0 μl 1.25 μM P5 primer
`1.0 μl 1.25 μM P7 primer
`9.125 1.25 μM nuclease-free water.
`The 1 mM reference dye is diluted 1:500 (2 μM) before 0.375 μl is added to the master
`mix.
`
`Current Protocols in Human Genetics
`
`Targeted Exon
`Sequencing by
`In-Solution
`Hybrid Selection
`18.4.12
`Supplement 66
`
`00012
`
`

`

`Figure 18.4.3 qPCR library quantification. Real-time SYBR Green qPCR is used for accurate quantification
`of libraries prior to sequencing. An accurate quantitation is essential for calculating the amount of library to
`be loaded onto a flow cell for optimal cluster density and high sequence yields. Shown in this figure are the
`amplification plots for a two-fold serial dilution standard curve as well as four li