protocol
`Titration-free 454 sequencing using Y adapters
`
`Zongli Zheng1,2, Abdolreza Advani3, Öjar Melefors2,3, Steve Glavas3, Henrik Nordström2,3, Weimin Ye1,
`Lars Engstrand2,3 & Anders F Andersson4
`
`1Department of Medical Epidemiology and Biostatistics, Karolinska Institutet, Stockholm, Sweden. 2Department of Microbiology, Tumor and Cell Biology,
`Karolinska Institutet, Stockholm, Sweden. 3Swedish Institute for Infectious Disease Control, Solna, Sweden. 4Science for Life Laboratory, KTH Royal Institute of Technology,
`Stockholm, Sweden. Correspondence should be addressed to Z.Z. (zhengzongli@gmail.com).
`
`Published online 18 August 2011; doi:10.1038/nprot.2011.369
`
`We describe a protocol for construction and quantification of libraries for emulsion pcr (empcr)-based sequencing platforms
`such as roche 454 or Ion torrent pGM. the protocol involves library construction using customized Y adapters, quantification
`using taqMan-MGB (minor groove binder) probe–based quantitative pcr (qpcr) and calculation of an optimal template-to-
`bead ratio based on poisson statistics, thereby avoiding the need for a laborious titration assay. unlike other qpcr methods,
`the taqMan-MGB probe specifically quantifies effective libraries in molar concentration and does not require specialized
`equipment. a single quality control step prior to emulsion pcr ensures that libraries contain no adapter dimers and have an
`optimal length distribution. the presented protocol takes ~7 h to prepare eight barcoded libraries from genomic Dna into libraries
`that are ready to use for full-scale empcr. It will be useful, for example, to allow analyses of precious clinical samples and
`amplification-free metatranscriptomics.
`
`IntroDuctIon
`Modern DNA sequencing technology has improved markedly in
`recent years. However, in many current technologies, sample library
`preparation before sequencing has surfaced as a key limiting factor.
`For instance, the current Roche 454 sequencing protocol for prepa-
`ration of a shotgun library1 requires 500 ng of DNA as starting
`material and includes a laborious titration assay. A faster library
`preparation protocol that can handle lower starting amounts would
`be desirable and particularly useful for, e.g., sequence analyses of
`precious clinical samples, cDNA sequencing of environmental
`samples for metatranscriptomics2 without the need for amplifica-
`tion that may introduce biases3, or microsatellite sequencing in
`population genetics4. The protocol presented here is based on our
`previous study that described a novel method for sequencing low-
`starting-amount materials5.
`Library preparation in most high-throughput sequencing tech-
`nologies involves the ligation of universal adapter(s) to the ends
`of DNA sample fragments to enable PCR amplification6–8. Unlike
`linear adapters such as adapters A and B (used for 454 sequencing),
`a single Y adapter, proposed previously9 and used for the Illumina
`sequencing, has several advantages. Given a 100% ligation effi-
`ciency, four double-stranded DNA (dsDNA) molecules would, on
`average, generate two properly appended dsDNA libraries using
`adapters A and B, whereas eight single-stranded DNA (ssDNA)
`libraries would be generated using a single Y adapter (Fig. 1). In
`addition, the Y adapters can only be ligated at the double-stranded
`stem end that enables a simultaneous incubation with all enzymes
`involved, thus eliminating the need for laborious and yield-reducing
`cleanup steps.
`One of the main differences in current high-throughput DNA
`sequencing technology as compared with traditional Sanger
`sequencing is that sample template concentration is kept very
`low to avoid tedious microbial subcloning. Emulsion PCR–based
`sequencing uses many millions of water-in-oil droplets, each of
`which serves as a separated amplification compartment6. Sample
`library concentration is kept so low that the majority of the droplets
`contain no library, a small proportion contains single-molecule
`
`libraries and an even smaller proportion contains mixed-molecule
`libraries in a stochastic manner that follows Poisson distribution,
`as shown by our sequencing data5. In addition, the enrichment
`step will select only those beads that have a library, but a too-low
`DNA-to-bead ratio will lead to insufficient amount of beads for
`sequencing, whereas a too-high ratio will lead to frequent occur-
`rence of mixed library beads. Thus, one of the key factors for a
`successful experiment is to use an optimal amount of library for
`sequencing. It is important to keep in mind that the amount of
`library added is not linearly associated with the number of high-
`quality beads5. We recommend an input DNA-to-bead ratio of 0.08,
`which will result in 96% of the enriched beads having a single-copy
`template according to Poisson distribution, and will be sufficient
`for sequencing5. A higher proportion of ‘nonpure’ (mixed-copy)
`beads associated with higher DNA-to-bead ratio might, in addi-
`tion, affect the consumption of nucleotide flows during sequenc-
`ing and bioinformatics processes, such as image background and
`signal intensity normalizations. Apart from the predicted increase
`of mixed library beads, a higher ratio of input DNA to beads is also
`less tolerant of subtle pipetting errors5.
`Two quantitative PCR (qPCR) assays have previously been pro-
`posed to quantify libraries derived from trace amounts of starting
`material10,11. Besides requiring less library, as compared with UV
`spectrophotometry and fluorometry methods, qPCR assays also
`have the advantage of measuring the amount of effective library—
`as the total library typically contains a mixture of molecules that
`are amplifiable, amplifiable but inefficient, or nonamplifiable for
`various reasons5. The previous two methods are based on SYBR
`Green dye10 qPCR and universal template TaqMan probe digital
`PCR11, respectively. With the SYBR Green–based qPCR assay, there
`is no need to design and use the relatively expensive TaqMan probe.
`However, it measures the total mass of the library and requires trans-
`formation into copy numbers on the basis of amplicon size estima-
`tion by gel electrophoresis or Agilent Bioanalyzer. Furthermore,
`the precision (coefficient of variance (CV) of the estimates) of this
`assay has not been assessed. In contrast, TaqMan-based assays have
`
`nature protocols | VOL.6 NO.9 | 2011 | 1367
`
`©2011 Nature America, Inc. All rights reserved.
`
`00001
`
`EX1017
`
`

`

`A-B library
`
`Y library
`
`End polishing,
`5′ phosphorylation,
`adenylation and
`ligation of Y adapter
`
`Without cleanup in
`between
`
`End polishing,
`5′ phosphorylation
`
`P
`
`P
`
`P
`
`P P
`
`P
`
`P
`
`P
`
`Ligation of adapters
` A
` B
`
`Nick repair
`
`Two effective molecules
`
`Eight effective molecules
`
`One of the potential forms, if no
`cleanups in between
`
`for all qPCR-based assays, amplification efficiency drops as the
`amplicon length increases. The best quantification method would
`be the one that best mimics the efficiency of emPCR. Either poorer
`or better efficiency than obtained by emPCR (depending on the
`emPCR system) could result in inaccurate estimation of the enrich-
`ment percentage after emPCR. This issue possibly pertains to all
`qPCR assays, including ours. It seems that our qPCR quantification
`method yields lower efficiency than the Roche Titanium emPCR
`method (data not shown) and results in ~50% more enriched beads
`than expected. However, as a typical bead recovery percentage is
`around 65–85%, the additional (~50%) beads more or less com-
`pensate for the bead loss during recovery and result in nearly the
`amount needed for loading onto the sequencing plate. Because
`qPCR amplification efficiency drops rapidly for long amplicons,
`and with the anticipated increase in read length in upgraded or
`
`protocol
`
`Figure 1 | A schematic illustration of the constructions of two types of
`libraries, A-B and Y. The A-B library construction method generates on
`average two effective double-stranded molecules (each appended with
`adapters A (blue) and B (green)) from four dsDNA molecules, given
`100% ligation efficiency. The molecules appended with A-A and B-B are
`nonamplifiable because of the amplification-inhibiting hairpins formed
`between the complementary adapted sequences after denaturing and
`annealing steps. The Roche A-B library uses a biotinylated B adapter and
`two additional steps to generate two effective ssDNA molecules (see ref. 5).
`In contrast, the Y library construction method generates eight effective
`single-stranded molecules. The MGB-probe is in red and barcode in yellow.
`
`the advantage of measuring the number of amplifiable molecules
`directly. The universal template TaqMan probe digital PCR is based
`on an 8-bp dual-labeled locked nucleic acid probe, complementary
`to the 5′-end tail of the customized amplification primer11. First,
`the digital PCR assay requires special equipment that is not widely
`accessible, such as Fluidigm’s BioMark microfluidic device. Second,
`two rounds of quantifications are used: an initial crude quantifi-
`cation by qPCR to guide the dilution of the libraries for a more
`precise quantification by digital PCR, which renders a precision
`(CV 11.8%) higher than the initial qPCR alone (CV 21.2%)11. Our
`MGB probe-based assay5 does not require special equipment and,
`therefore, is more accessible to ordinary laboratories. This MGB
`probe assay is at least as precise as digital PCR (CV 9.5% versus
`11.8%). The MGB probe is a 20-bp-long probe complementary
`to the library molecule and is located next to the 3′ end of one
`of the amplification primers (Fig. 2). Having a probe targeting
`site between the amplification primers has the advantage that the
`amount of fluorescence signal is proportional to the number of
`library amplicons and not to the potential amplification primer
`dimers, which might be a potential source for less precise quan-
`tification with a probe-targeting part of an amplification primer.
`Further, a longer probe, as compared with a shorter one (8 bp), is
`more specific.
`Limitations of the method should be acknowledged. The library
`quantification described here is based on a qPCR assay. Essentially,
`
`©2011 Nature America, Inc. All rights reserved.
`
`a
`
`c
`
`Amplification
`primer
`emPCR A
`
`3′
`
`Sequencing primer complement
`
`b
`
`Library key GACT
`
` 5′ MID sequence
`
`T
`
`Sequencing starts
`
`Sequencing primer
`
`5′
`
`3′
`
`At and after ∼500 bp, the
`sequence quality typically
`drops below acceptable levels
`and is trimmed away during
`computational analysis
`
`5′
`
`5′
`
` 3′ MID sequence
`MGB probe priming site
`
`Amplification primer emPCR
`B complement
`
`Library
`key
`
`5′ MID
`
`Sample
`
`MGB probe
`
`3′ MID
`
`emPCR B
`complement
`
`5′-C*C*A*T*C*T*CATCCCTGCGTGTCTCCGACGACTACAC T*A*C*T*C*G*T-sample-pC*G*A*G*T*A*GTGTGACACGCAACAGGGGATAG ACAAGGCACACAGGG*G*A*T*A*G*G -3′
`
`3′-G*G*A*T*A*G*GGGACACACGGAAC AGATAGGGGACAACGCACAG TGTG*A*T*G*A*G*Cp-sample-T*G*C*T*C*A*T CACATCAGCAGCCTCTGTGCGTCCCTAC*T*C*T*A*C*C-5′
`
`Figure 2 | Design of Y MID adapter. (a,b) Schematic illustrations of the Y MID adapter (a) and the sequencing process on a library molecule (b).
`(c) An example of two library molecules generated using one ‘Y3’ adapter. The emPCR primer A is underlined; emPCR primer B complement is shown by
`dashed underline. The sequencing primer is highlighted in yellow, the library key sequence is shown with dots underneath, the 5′ MID sequence is shown in
`red, the 3′ MID sequence is shown in green and the MGB-probe highlighted is in purple.
`
`1368 | VOL.6 NO.9 | 2011 | nature protocols
`
`00002
`
`

`

`protocol
`
`sequencer generates read lengths of ~500 bp, whereas the library
`molecules are generally longer than 500 bp, indicating that most
`of the 5′ end of the library (3′ end of the read) is not sequenced at
`acceptable quality and, therefore, trimmed away. This can also be
`evidenced by the small difference in the total number of yielded
`bases between pre- and post-trimming of our customized adapter
`(711 versus 699 Mbp, see ANTICIPATED RESULTS).
`For every experiment, it is useful to include a blank (no sample)
`library in parallel, starting from the first step until qPCR quanti-
`fication and agarose gel electrophoresis. Because of background
`noise (most likely due to a trace amount of adapter dimers
`remaining in the library), the qPCR quantification may yield a
`value of hundreds to thousands of molecules in total for the blank
`library12. Agarose gel electrophoresis of the blank library qPCR
`amplicons would reveal a band corresponding to the size of an
`adapter dimer. This background can be ignored as it typically
`comprises <1% of a sample library. However, longer amplicons
`would indicate that contamination had been introduced in the
`upstream steps.
`Size selection of DNA fragments is crucial. The Roche 454
`Titanium platform is able to sequence, on average, 500 bp, and
`the selected DNA fragments should be longer than 500 bp to take
`advantage of the long read length. Conventional qPCR methods
`recommend using amplicons no longer than 150 bp to achieve good
`amplification efficiency. Using regular thermocycling conditions,
`the amplification efficiency drops for amplicons longer than 500 bp
`and drops profoundly for amplicons longer than 1,000 bp (data
`not shown). Fragments longer than 1,000 bp will consequently not
`be amplified well when mixed in one microdroplet with a 500-bp
`fragment, although their presence might not be a problem pro-
`vided that the noise light signal from the 1,000-bp amplicons dur-
`ing sequencing is negligible. When a 1,000-bp fragment is amplified
`alone in a microdroplet, the number of amplicons on each bead
`will be much lower than normal (e.g., 100,000 amplicons of size
`1,000 bp on one bead versus 1 million amplicons of size 500 bp on
`another bead), despite using the same thermocycling conditions.
`Conceivably, postsequencing light normalization is better for a
`library with a narrower size range, and we recommend remov-
`ing DNA fragments longer than 900 bp for the current Roche 454
`Titanium emPCR setting13.
`For an experiment in which a single sample is to be sequenced,
`the nonbarcoded Y adapter5 can be used to save 10 bp for each read
`compared with the barcoded adapters. This Y adapter has a differ-
`ent key sequence (TCAG) than the barcoded ones (GACT). The
`Roche 454 pipeline, however, supports a simultaneous sequencing
`of libraries with different keys on one plate in physically separated
`regions; this can be done, for example, by using the nonbarcode
`Y adapter for one large-volume (LV) region (one sequencing plate
`consists of two LV regions) and eight different barcoded adapters
`for the other LV region.
`
`new platforms in mind, we recommend empirically estimating
`the difference in enrichment percentage predicted by the qPCR
`method and one observed by titration assay once before applying
`the titration-free method routinely. Here we use a qPCR thermo-
`cycling program of ~1.5 h, which favors the complete extension
`of long amplicons. For applications of sequencing shorter ampli-
`cons (e.g., <150 bp), the thermocycling program can be shortened
`to <30 min, as in a typical Fast qPCR assay.
`
`Experimental design
`Multiplexing adapters (MID adapters), also referred to as barcodes,
`are essential as more and more projects require the pooling of sam-
`ples. We present here a set of eight Y-barcoded adapters. The Y MID
`adapter has a stem of 10 bp, which serves as the barcode. It is impor-
`tant to have a short Y-adapter stem (just long enough to anneal and
`form dsDNA adapters at 25 °C for ligation to the sample DNA) to
`reduce the inhibitory effect during PCR amplification. The longer
`the stem, the stronger the inhibitory effect will be, assuming com-
`parable G/C to A/T ratios. This inhibition is due to the potential
`formation of a hairpin from the complementary barcodes at both
`ends of an ssDNA molecule (Fig. 2). A 17-bp-long stem greatly
`inhibited PCR amplification (annealing temperature 60 °C) and
`showed no visible amplicons on agarose gel (data not shown). Each
`Y MID adapter has a unique stem and two universal branches and
`is created by annealing two oligonucleotides that share ten comple-
`mentary nucleotides for the stem sequence (Fig. 2).
`The barcodes were designed primarily using the barcodes selected
`from the 12 Roche 454 Rapid Library (RL) MID sequences. We
`designed two new barcode sequences, Ya1 and Ya2, containing the
`same number (n = 17) of nucleotide flows during sequencing as
`the RL MIDs. Selection and validation of the barcodes were per-
`formed in two steps. First, we used OligoAnalyzer (http://www.
`idtdna.com) to exclude (n = 4) by initial sequence analysis the
`RL MIDs that might form potential secondary structures (because
`of the introduction of the TaqMan-MGB probe complementary
`site) or that might have substantially different Gibbs free energy
`(∆G) in the formation of the stem of Y adapters from the rest of
`the MID ∆Gs. Second, experimental validation excluded two other
`RL MIDs barcodes (Y1 and Y12) that gave different proportions
`of sequencing yield than expected from the qPCR quantification.
`Because the qPCR quantification was applied to individual librar-
`ies, it cannot reflect possible interactions among the adapters when
`they are pooled in one reaction at a later stage. The remaining six
`RL MIDs barcodes and the two newly designed barcodes (Ya1 and
`Ya2) performed well in a panel.
`Because sequencing starts from the 3′ end of a library mole-
`cule and sequencing errors accumulate as the polymerases extend
`toward its 5′ end, we designed the qPCR probe complementary
`site at the 5′ end of a library molecule so that it does not waste
`the sequencing capacity (Fig. 2b). Currently, the 454 Titanium
`
`©2011 Nature America, Inc. All rights reserved.
`
`DNA sample. Conventional methods (e.g., a variety of Qiagen DNA kits)
`from different types of sample can be used for DNA extraction.
`Oligonucleotides for Y adapters. We used 16 HPLC-purified oligo-
`nucleotides (Integrated DNA Technologies) to form eight Y adapters.
`See Table 1.
`
`• •
`
`MaterIals
`REAGENTS
` crItIcal For all the reagents and buffers used, we have not noticed any
`adverse effect after storage in a freezer or refrigerator (per manufacturer’s
`recommendations) for up to 1 year, except that any solutions containing
`ethanol need to be freshly prepared.
`
`nature protocols | VOL.6 NO.9 | 2011 | 1369
`
`00003
`
`

`

`(Various vendors, salt purification); MGB probe 6FAM-CTATCCCCTGT
`TGCGTGTC-MGBNFQ (Applied Biosystems, HPLC purification)
` qPCR standards. The standards were prepared by cloning of an available
`library, PCR amplification of a single colony suspension, purification and
`dilutions, as described earlier5. Alternatively, a simple dilution method can
`be used12 (see INTRODUCTION).
`UltraPure glycerol (Invitrogen, cat. no. 15514011, http://www.invitrogen.com)
`MinElute PCR purification kit (Qiagen, cat. no. 28004, http://www.qiagen.com)
`T4 DNA ligase (Enzymatics, cat. no. L603-LC-L, http://www.enzymatics.
`com)
`Klenow (3′→5′ exo-) (Enzymatics, cat. no. 01-LC-L, http://www.enzymatics.
`com)
`Taq DNA polymerase, recombinant (Invitrogen, cat. no. 10342-020, http://
`www.invitrogen.com)
`dNTP mix (Enzymatics, cat. no. N205L)
`AMPure XP beads (Agencourt, product no. A63880, http://www.
`beckmancoulter.com)
`TaqMan Fast Universal PCR Master Mix (Applied Biosystems,
`part no. 4352042, http://www.appliedbiosystems.com)
`End-repair mix (low concentration; Enzymatics, cat. no. Y914-LC-L,
`http://www.enzymatics.com)
`Tris-EDTA (TE) buffer (10×, BioUltra Molecular Biology Grade, pH 8.0;
`Sigma, cat. no. 93283, http://www.sigmaaldrich.com)
`Buffer PB (Qiagen, cat. no. 19066, http://www.qiagen.com)
`Water, Molecular Biology (Sigma, cat. no. W4502-1L, http://www.
`sigmaaldrich.com)
`Ethanol (BioUltra, for molecular biology; Sigma, cat. no. 51976, http://www.
`sigmaaldrich.com)
`GelPilot DNA loading dye (5×, Qiagen, cat. no. 239901, http://www.qiagen.
`com)
`GelRed nucleic acid gel stain (Biotium, cat. no. 41002, http://www.biotium.
`com/)
`EQUIPMENT
`7900HT Fast Real-Time PCR System or equivalent (Applied Biosystems,
`part no. 4329001, http://www.appliedbiosystems.com)
`Thermocycler
`Magnetic particle collector (MPC, DynaMag-2 magnet, cat. no. 123-21D,
`Invitrogen, http://products.invitrogen.com/ivgn/product/12321D)
`Nitrogen cylinder polyallomer tube (Beckman Coulter, part no. 357448,
`http://www.beckmancoulter.com) or other low-binding tube
`alternatives
`Nebulizers (Invitrogen, cat. no. K7025-05, http://www.invitrogen.com)
`PCR tubes
`Microcentrifuge tubes
`REAGENT SETUP
`Adapter annealing To a 200-µl PCR tube, add the following:
`
`•
`
`• • • • • • • • • • • • • • •
`
`• • • •
`
`• • •
`
`TE buffer (1×)
`
`Y adapter, top (100 µM)
`
`Y adapter, bottom (100 µM)
`
`80 µl
`
`10 µl
`
`10 µl
`
`Incubate at 95 °C for 1 min, 60 °C to 14 °C with − 0.1 °C per second, 14 °C
`hold. Dilute the annealed adapters tenfold with 1× TE into working
`concentration (1 µM). This can be stored at −20 °C for at least 1 year.
`Nebulizing buffer Nebulizing buffer is 10% (vol/vol) glycerol in 1× TE
`buffer. This buffer can be stored at 4 °C for at least 1 year.
`
`protocol
`
`taBle 1 | Oligonucleotides used to form Y adapters.
`
`number
`
`sequence (5′–3′)
`
`5′-C*C*A*T*C*T*CATCCCTGCGTGTCTCCGACGACTACACT*A
`*C*T*C*G*T-3′
`
`5′-pC*G*A*G*T*AGTGTGACACGCAACAGGGGATAGACAAGG
`CACACAGGG*G*A*T*A*G*G-3′
`
`5′-C*C*A*T*C*T*CATCCCTGCGTGTCTCCGACGACTACGAG*T
`*A*G*A*C*T-3′
`
`5′-pG*T*C*T*A*CTCGTGACACGCAACAGGGGATAGACAAGG
`CACACAGGG*G*A*T*A*G*G-3′
`
`5′-C*C*A*T*C*T*CATCCCTGCGTGTCTCCGACGACTACGTA*C
`*T*G*T*G*T-3′
`
`5′-pC*A*C*A*G*TACGTGACACGCAACAGGGGATAGACAAGG
`CACACAGGG*G*A*T*A*G*G-3′
`
`5′-C*C*A*T*C*T*CATCCCTGCGTGTCTCCGACGACTACGTA*G
`*A*T*C*G*T-3′
`
`5′-pC*G*A*T*C*TACGTGACACGCAACAGGGGATAGACAAGG
`CACACAGGG*G*A*T*A*G*G-3′
`
`5′-C*C*A*T*C*T*CATCCCTGCGTGTCTCCGACGACTACTAC*G
`*T*C*T*C*T-3′
`
`5′-pG*A*G*A*C*GTAGTGACACGCAACAGGGGATAGACAAGG
`CACACAGGG*G*A*T*A*G*G-3′
`
`5′-C*C*A*T*C*T*CATCCCTGCGTGTCTCCGACGACTACTAT*A
`*C*G*A*G*T-3′
`
`5′-pC*T*C*G*T*ATAGTGACACGCAACAGGGGATAGACAAGG
`CACACAGGG*G*A*T*A*G*G-3′
`
`5′-C*C*A*T*C*T*CATCCCTGCGTGTCTCCGACGACTCTACT*C
`*G*T*A*G*T-3′
`
`5′-pC*T*A*C*G*AGTAGGACACGCAACAGGGGATAGACAAGG
`CACACAGGG*G*A*T*A*G*G-3′
`
`5′-C*C*A*T*C*T*CATCCCTGCGTGTCTCCGACGACTGTACA*G
`*T*A*C*G*T-3′
`
`Y3
`
`Y5
`
`Y8
`
`Y9
`
`Y10
`
`Y11
`
`Ya1
`
`Ya2
`
`©2011 Nature America, Inc. All rights reserved.
`
`5′-pC*G*T*A*C*TGTACGACACGCAACAGGGGATAGACAAGG
`CACACAGGG*G*A*T*A*G*G
`Complementary nucleotides that anneal to form the Y-adapter stem and barcode are shown in underlined
`text. Asterisks (*) indicate a phosphorothioate-modified bond, p indicates a phosphorylation.
`
`•
`
`Oligos for qPCR. emPCR A 5′-CCATCTCATCCCTGCGTGTC-3′ (various
`vendors, salt purification); emPCR B 5′-CCTATCCCCTGTGTGCCTTG-3′
`
`proceDure
`Dna nebulization ● tIMInG 1 h for eight samples
`1| Add 590 µl of nebulizing buffer to a nebulizer. Add 10 µl of DNA sample. Connect the nebulizer to a nitrogen cylinder
`connected to a regulator and apply 30 psi for 1 min.
` crItIcal step If larger sample volumes are used, the total volume should be adjusted to 600 µl.
`
`2| Add 2.5 ml of PB buffer and mix by pipetting.
`
`3| Transfer 650 µl of the liquid into a MinElute spin column, centrifuge at 10,000g for 15 s and discard the flow-through.
`
`1370 | VOL.6 NO.9 | 2011 | nature protocols
`
`00004
`
`

`

`protocol
`
`4| Repeat Step 3 until all of the nebulized sample has been transferred to the spin column.
`
`5| Add 700 µl of 70% (vol/vol) ethanol to the column, centrifuge at 10,000g for 1 min and discard the flow-through.
`
`6| Elute the sample in 25 µl of 1× TE buffer according the manufacturer’s instructions.
` crItIcal step If you start with small amounts of DNA (less than 10 ng), low-binding tubes (e.g., polyallomer tubes),
`should be used throughout the library preparation, including for the storage of the library in the freezer.
` crItIcal step The DNA nebulization steps (Steps 1–6) can be skipped if the starting sample is of low molecular weight
`(such as degraded archived formalin-fixed and paraffin-embedded tissue samples). The volume of AMPure XP beads used in
`the fragment size selection (Steps 7–11) should also be adjusted to avoid losing the sample fragments.
`
`Fragment size selection ● tIMInG 30 min for one sample, 5 more min for each additional sample
`7| To the nebulized and purified DNA fragments, add an appropriate amount of AMPure XP beads (e.g., 11.5 µl of beads
`into 25 µl of sample to bind fragments longer than 900 bp; calibration is needed for each batch), and mix by pipetting.
` crItIcal step Calibration of the AMPure XP beads should be done according to the manufacturer’s instructions before library
`construction. The example given above was based on a calibration result showing that 11.5 µl of beads added to 25 µl of sample
`captured fragments longer than 900 bp, and that 14.5 µl of beads in 25 µl of sample captured fragments longer than 500 bp.
`
`8| Transfer to a 1.5-ml tube and incubate at ambient temperature for 5 min.
`
`9| Place the tube on the MPC. After the beads are pelleted (about 1 min), pipette the supernatant, which contains
`fragments shorter than 900 bp, into a new tube.
`
`10| Add an appropriate amount of AMPure XP beads (e.g., 3.0 µl) to the tube, mix by pipetting and incubate at ambient
`temperature for 5 min.
`
`11| Place the new tube on the MPC. After the beads are pelleted, pipette and discard the supernatant, which contains
`fragments shorter than 500 bp. The fragments that remain on the beads are in the size range of 500–900 bp.
` crItIcal step Every time before you pipette the AMPure XP beads, you should vortex the bead tube thoroughly to obtain
`a homogeneous solution. The size selection is based on the amount of solution containing the AMPure XP beads, not the
`amount of beads per se, in relation to the sample volume. Fragments longer than 500 bp will remain on the beads in Step 11
`when applying 58% (= 14.5/25) of beads, where 14.5 is the total volume of AMPure XP bead solution (11.5 µl from Step 7
`plus 3.0 µl from Step 10) and 25 is the volume of sample from Step 6.
`
`12| Add 500 µl of 70% (vol/vol) ethanol, incubate for 30 s and then pipette and discard the ethanol.
`
`13| Repeat Step 12 once and remove any residual liquid drops at the bottom or on the walls of the tube.
`
`14| Leave the tube open (on the MPC) to dry at ambient temperature for 2 min.
`
`15| Remove the tube from the MPC and add 25 µl of 1× TE buffer (or 14 µl if starting with small amount of sample).
`Pipette to mix the bead pellet.
`
`16| Place the tube back onto the MPC. After the beads are pelleted (about 1 min), collect the aqueous phase,
`which contains 500- to 900-bp-long fragments, into a new tube.
`
`©2011 Nature America, Inc. All rights reserved.
`
`end-polishing, phosphorylation and da extension ● tIMInG 1 h
`
`17| To a 200 µl PCR tube, add the following:
`
`Size-selected DNA sample from Step 16 (add 1× TE up to 14 µl)
`dNTP mix (25 mM)
`
`SLOW ligation buffer, 10× (component of T4 DNA ligase kit)
`
`Buffer for Taq polymerase, 10× (Mg2 + free)
`
`End-repair mix (low concentration)
`
`Klenow exo-
`
`Taq polymerase
`
`Total
`
`14.0 µl
`1.0 µl
`2.5 µl
`2.0 µl
`2.0 µl
`0.5 µl
`0.5 µl
`22.5 µl
`
`nature protocols | VOL.6 NO.9 | 2011 | 1371
`
`00005
`
`

`

`protocol
`
` crItIcal step Klenow exo- is optional and can be omitted if input DNA concentration is high (e.g., >10 ng). Note that
`Invitrogen ‘Platinum’ Taq should not be used—Taq polymerase becomes active when the temperature rises and is fully active
`at 72 °C, when it adds dA to the 3′ end of dsDNA. The Platinum Taq polymerase, however, requires a heat activation step,
`which would disassociate the dsDNA and should therefore be avoided.
`
`18| Place on a thermocycler and apply the following program (with a heated lid): 12 °C for 15 min, 37 °C for 15 min and
`72 °C for 15 min; finally, hold at 4 °C.
`
`adapter ligation and purification ● tIMInG 1 h or 8 h, depending on starting amount
`19| To the reaction tube from Step 18, add the following:
`
`Annealed Y adapter (with or without barcodes, 1 µM)
`
`Ligase (enzymatic, low concentration)
`
`Total
`
`1.0 µl
`
`2.0 µl
`
`25.0 µl
`
`20| Adapter ligation should be performed using option A for large amounts of starting DNA or option B for small amounts of
`starting material:
`(a) large starting amount of Dna
`
`(i) If a large amount is used, such as 100 ng, incubate at 22 °C for 20 min.
`(B) small starting amount of Dna
`
`(i) If less than 10 ng is used, incubate at 12 °C for 8 h or overnight.
` crItIcal step The yield of the ligation product increases with ligation time. When starting amounts of samples
`are between 10 and 100 ng, ligation time can be adjusted on the basis of the amount of sequence yield needed.
`We previously used 1 ng of nebulized fragments and generated sufficient library for 10 Titanium runs5.
`
`21| Purification. To remove free adapters (or potential adapter dimers and residual fragments shorter than 500 bp), add the
`same amount of AMPure XP beads as the total of those used in Steps 7 and 10 (in our example, 14.5 µl of beads) to the
`25-µl ligation reaction from Step 19. Follow the manufacturer’s instructions and elute the library with 50 µl of 1× TE buffer
`into a low-binding tube. However, if DNA samples are highly degraded (such as from old biopsies) with fragments shorter
`than 100 bp, the library fragments will be shorter than 200 bp (after being appended by adapters on both sides). In this
`case, it might be a better choice to use a sequencing platform other than 454 with a higher throughput.
`
`library dilution before qpcr (optional) ● tIMInG 5 min for each sample
`22| If the amount of starting DNA is high (such as 500 ng), it is advisable to dilute the library into 1:10, 1:100 and 1:1,000
`dilutions and use them for the qPCR quantification.
` crItIcal step the diluted libraries should be stored in low-binding tubes.
` pause poInt before proceeding to the emPCR, the library can be maintained on ice for several hours while waiting for the
`qPCR results, or stored at − 20 °C for a longer time.
`
`library quantification by qpcr ● tIMInG 2 h
`23| Set up the qPCRs, with each sample in triplicate. Total number of samples = 3 × (5 standards + 1 nontemplate control +
`number of libraries):
`
`©2011 Nature America, Inc. All rights reserved.
`
`H2O2
`
`Fast Master Mix, 2×
`
`Primer emPCR A (10 µM)
`
`Primer emPCR B (10 µM)
`
`TaqMan-MGB probe (10 µM)
`
`Total
`
`4.0 µl
`
`10.0 µl
`
`1.8 µl
`
`1.8 µl
`
`0.4 µl
`
`18.0 µl
`
` crItIcal step The Fast Master Mix already contains the polymerase and dNTPs needed.
`
`1372 | VOL.6 NO.9 | 2011 | nature protocols
`
`00006
`
`

`

`protocol
`
`p
`
`n 1 2 3 4
`
`b
`
`n 1 2 3 4 5 6 7
`
`Figure 3 | Quality control. qPCR-amplified products analyzed by
`1% (wt/vol) agarose gel electrophoresis and visualization under UV light,
`as described in Step 26. (a) Lanes 1–4 represent individual samples that
`show no detectable adapter dimer in the libraries, and thus would be
`suitable for subsequent amplification and sequencing. ‘p’ and ‘n’ denote
`positive (a previously used library) and negative (water) controls for
`the qPCR reaction. The expected size of adapter dimers is 79 bp for
`the nonbarcoded Y adapters and 91 bp for those with barcodes. The size
`range of expected qPCR products is 300–700 bp. (b) Example of poor-quality results—lanes 1, 3, 6 and 7 show the presence of adapter dimers and lane 2
`shows a suboptimal library fragment length distribution; thus, these samples should not be used for sequencing.
`
`a
`
`600 bp
`
`100 bp
`
`600 bp
`
`100 bp
`
`24| Dispense 18 µl of the mix into each well, and then add 2 µl of sample library (from Step 21 or 22) or standards
`(103, 104, 105, 106, 107 copies per µl) per well.
`
`25| Run qPCR using cycling conditions as follows: 95 °C for 2 min; 35 cycles of 95 °C for 15 s; 60 °C for 60 s; and 68 °C for 60 s.
`
`Quality control ● tIMInG 1 h
`26| Analyze the qPCR-amplified products by 1% (wt/vol) agarose gel electrophoresis under standard conditions. We use 4 µl
`of qPCR products from one of the triplicates and mix it with 1 µl of 5× DNA loading dye and load onto a 1% (wt/vol) agarose
`gel prestained with GelRed. This gel can be prepared while the qPCR is running. We apply 130 V for 45 min on a gel tray
`with a 15-cm distance between electrodes. Ensure that there are no apparent bands of the sizes of adapter dimers (79 bp for
`nonbarcoded Y adapters (see ref. 5) and 91 bp for the barcoded adapters). As an example, lanes 1–4 in Figure 3a indicated
`no detectable adapter dimer in the libraries, whereas lanes 1, 3, 6 and 7 in Figure 3b showed the presence of adapter dimers
`(and should not be used for the emPCR). Although lane 2 in Figure 3b did not show apparent adapter dimers, it indicated a
`suboptimal library fragment length distribution when started with high-molecular-weight DNA samp