`
`UNITED STATES DEPARTMENT OF COMMERCE
`United States Patent and. Trademark Office
`
`March 14, 2022
`
`THIS IS TO CERTIFY THAT A1'\1NEXED HERETO IS A TRUE COPY FRO:\!
`THE RECORDS OF THIS OFFICE OF:
`
`Pre-Grant Publication Number: 2004/0043:J0J
`Pre-Grant Publication Date: 1Uarch 4, 200.J
`
`By Authority of the
`I Property
`Under Secretary of Commerce for Intellect
`and Director of the United States Patent
`d Trademark Office
`
`cer 4
`
`Ce t' . in°g~
`
`Miltenyi Ex. 1010 Page 1
`
`
`
`1111111111111111 IIIIII IIIII 11111 1111111111 11111 111111111111111 IIIII Hiil 111111111111111111
`US 2004(X)43401Al
`
`(19) United States
`(12) Patent Application Publication
`Sadelain et al.
`
`(10) Pub. No.: US 2004/0043401 Al
`Mar. 4, 2004
`(43) Pub. Date:
`
`(54) CHIMERIC 'f CELL RECEOTORS
`
`Publication C lnssification
`
`(75)
`
`lnventnrs: M ich el ~llrle la in, New York, NV (! JS);
`R enier Brcn~jcns, Now York, NY (US);
`J ohn Maher , London (GB)
`
`Correspondence Address:
`OPPEDAHL AND IARSON LLP
`P O BOX 5068
`DIL LON, CO 80435-5068 (US)
`
`(73) Assignee: Sloan Kettering Institute for Cancer
`Research, New York, NY
`
`(21) Appl. No.:
`
`10/448,256
`
`(22) Filed:
`
`May 28, 2003
`
`Relat~d U.S. Application Data
`
`(60) Pmvision~I application No. 60/383,872, filed on May
`28, 2002.
`
`(51) Int. Cl.7
`
`__ ......................... CUQ 1/68; C071 l 21/04;
`C'J2P ?.1/02; C'J2N 5/01,; C07K 14nfl',;
`C0?K 16/28
`(52) U.S. Cl. ......................... 435/6; 435/69.J; 435/320. l;
`435/325; 530/350; S30/388.22;
`536/23.5
`
`(57)
`
`ABSTRACT
`
`Cbimeric T cell receptors (TCR) are provided Lhar combine,
`in a single chimeric species, tbc iotrncellular domain of C'D3
`t;,-chain, a signaling region from a costimulatory protein
`such as CLJ2S, and a biodiog clement 1bat specilically
`interacLS with a selected target. Whea expres1;ed, for
`example in l:.Jymphocytes from !be individual 10 be treated
`for a conclition associated with the selected target, a T cell
`immune response is stimulated ia lbe iadividual to the target
`colJs. The chimeric TCR's are able to provide both the
`activation and the co-stimulation signals from a single
`molecule to more effectively direct 1~lymphocytc cytotox(cid:173)
`icity ngainsl lhe selected target and T-lymphocyte prolifera(cid:173)
`tion.
`
`JO
`
`11
`
`u
`
`13
`
`4
`
`~
`S"LTR u..-- ----H
`so
`
`SA
`
`EM V
`IRES E FP
`
`J'LTR
`
`Miltenyi Ex. 1010 Page 2
`
`
`
`Patent Application Publication Mar. 4, 2004 Sheet l of 8
`
`US 2004/0043401 Al
`
`JO
`
`11
`
`L3
`
`4
`
`12
`
`►
`S' LTR
`
`SD
`
`SA
`
`Fig. 1
`
`EM V
`IRES
`
`E fP
`
`PZ1
`
`P28Z
`
`PZ28
`
`P28
`
`J591 □
`SCFV
`COJC ■
`f2]
`CD28
`cos ~
`
`Fig. 2
`
`Miltenyi Ex. 1010 Page 3
`
`
`
`Patent Application Publication Mar. 4, 2004 Sheet 2 of 8
`
`US 2004/0043401 Al
`
`100
`
`80
`
`.,
`•
`>,, 60
`0
`
`0
`•
`c.. 40
`)!.
`
`(/)
`
`20
`
`100
`
`80
`
`20
`
`- - 0 - - 19z1 GFP
`Pz1 GFP
`■
`•
`P28z GFP
`Pz28 GFP
`
`- t ) ; -•
`
`-
`
`\
`
`..
`'
`\
`\ .
`\
`' .
`'
`\
`.
`' ' \-..
`'"'-,
`'
`
`';
`
`100
`
`3.7
`1l
`33
`EHector : target ratio
`
`1.2
`
`0.4
`
`Fig. 3A
`
`3T3 PSMA
`
`•
`- o - 3T3 Empty
`
`100
`
`11
`33
`Etfec;tor : targ•t ratio
`
`3.7
`
`1.2
`
`Fig. 3B
`
`Miltenyi Ex. 1010 Page 4
`
`
`
`Patent Application Publication Mar. 4, 2004 Sheet 3 of 8
`
`US 2004/0043401 Al
`
`l\llH:lTJ
`
`u n tr.ins f ectr-d
`
`7.000.000
`
`6.000,000
`
`.... s .000,000
`• 0
`E
`~
`C:
`
`'4,000,000
`
`~ 3,000.000
`
`CJ -~ --0 2.oco.000
`
`I-
`
`. ~
`
`3
`
`1
`
`2
`
`4
`
`s
`
`6
`
`;?
`I
`1
`
`Qay
`
`Fig. 4A
`
`NlH3Tl 67.1
`
`---o-- P28 GFP
`pz-{ GFP
`•
`• - P.28z GFP
`PZ28 GFP
`·--'\'J•--
`19z1 GFP
`· -· ··~--
`
`1,000,000
`,~ •-·•v-
`
`oL
`
`0
`
`7.000,000
`
`6,000,000
`
`.._ 5,000,000
`Gt
`.0
`E :) d.,000.000
`
`C
`
`~ 3,000,000
`
`.. 0 ..,.. 2.000.000
`
`1,000,000
`
`0
`
`1
`
`2
`
`3
`
`4
`
`Day
`
`Fig. 4B
`
`Miltenyi Ex. 1010 Page 5
`
`
`
`Patent Application Publication Mar. 4, 2004 Sheet 4 of 8
`
`US 2004/0043401 Al
`
`7.000,000
`
`6,000,000
`
`~ 5,000.000
`V .a
`E :, 4.000,000
`C -"' u J,000,000
`Cl -0 .,_ "2,000,000 ·
`
`l .000,00-0,
`
`ol
`
`0
`
`NIH3T:l PSMA
`
`\
`
`f
`
`........ ------··- ---~
`
`_.
`
`---
`
`-
`
`'-iii!',·
`
`.
`
`._ -
`
`. ,
`
`--·-- - -
`
`2
`
`3
`
`s
`
`6
`
`7
`
`Day
`
`Fig. 4C
`
`NlHJTJ PSMA • B 1.1
`
`7 ,000.000
`
`6,000,000
`
`s,000,000
`
`.. u
`
`.0
`E
`::, 4,000,QOO
`C:
`• u 3,000,000
`:§
`0
`I- 2,000,000,
`
`1.000.000
`
`~,~
`
`0
`
`0
`
`,
`
`5
`
`6
`
`1
`
`3
`
`Oay
`
`Fig. 4D
`
`Miltenyi Ex. 1010 Page 6
`
`
`
`Patent Application Publication Mar. 4, 2004 Sheet 5 of 8
`
`US 2004/0043401 Al
`
`t◄.(X)O,GOJ
`
`12.000.uro
`
`NIHJTJ PSMA. - C08"'
`
`,.
`I
`
`I ..,
`
`.. lC.000.000
`i
`~ 8.000.C(X)
`• 0
`
`6.IXX>.COQ
`
`C
`
`4,000.000
`
`2.000.000
`
`o .
`
`0
`
`2
`
`~
`
`6
`Oay
`
`8
`
`10
`
`12
`
`H
`
`Fig. 5A
`
`NIHJTl PSMA - CD4.,
`
`1,500 ,a:()
`
`i
`E
`~ l,000,000
`• (.)
`
`!500,00}
`
`0
`
`2
`
`I
`
`6
`Oay
`
`10
`
`IZ
`
`14
`
`Fig. 5B
`
`Miltenyi Ex. 1010 Page 7
`
`
`
`Patent Application Publication Mar. 4, 2004 Sheet 6 of 8
`
`US 2004/0043401 Al
`
`1-t.(((J,CXXl
`
`NIHJTI PSMA • a7.l • C08 •
`
`!2..000.CO:
`
`IO ,000.t(X) !
`
`e.OOO:o:x>
`
`i
`E
`;J
`C: =
`~ G.000,000
`
`•.ooo.exx>
`
`2.0CO.lUJ
`
`/
`
`0
`
`0
`
`i
`
`..
`
`II
`
`g
`
`o.,
`
`ta
`
`l2
`
`, ..
`
`Fig. SC
`
`2.000,00)
`
`NIHJTJ PSMA + B7.1 -C04 •
`
`1..500.0C'O i
`! e
`
`~
`1:1,000,000
`(,)
`
`--o-- P28 GFP
`-..--- Pz1 GFP
`- ---· P28:z: GFP
`
`0
`
`2
`
`8
`
`8
`oa,
`
`\D
`
`1:Z
`
`t ◄
`
`Fig. 50
`
`Miltenyi Ex. 1010 Page 8
`
`
`
`Patent Application Publication
`
`Mar. 4, 2004 Sheet 7 of 8
`
`US 2004/0043401 Al
`
`,o .
`
`I '
`
`10 •
`
`!
`~
`C -~
`
`10 7
`
`D•'Y• In cutture
`
`Fig. 5E
`
`Dar14
`
`Fig. SF
`
`lJ
`
`60
`
`-.r =---------
`
`62
`
`20
`
`G.
`
`~
`
`;
`
`!:!
`
`~
`~
`
`.. !! ..
`1M ..
`~ -(J
`--.. ~
`l -.,. - -8 0
`
`, ..
`
`~
`
`IL
`0
`
`.!!
`
`Miltenyi Ex. 1010 Page 9
`
`
`
`Patent Application Publication Mar. 4, 2004 Sheet 8 of 8
`
`US 2004/0043401 Al
`
`50
`
`~
`\
`'· \
`'r.
`
`- - 0 - - 19Pz1
`Pt.1
`
`•
`•
`-~ P~a
`
`P28.z
`
`◄ 0 -• >-
`0 --u • a. 20
`
`30
`
`VJ
`
`~
`
`10
`
`Z5
`
`7,000.000
`
`6.000,000
`
`::J
`
`e s.000.000
`.... •
`C : ◄ ,000.000
`• u
`-; 3,000,000
`C
`t- 2,000,000
`
`IJ
`
`,..s
`EHec:tor ; target ratio
`
`6
`
`3
`
`0.7
`
`Fig. 6A
`
`0
`
`0
`
`1
`
`2
`
`3
`Day
`
`5
`
`6
`
`7
`
`Fig. 6B
`
`Miltenyi Ex. 1010 Page 10
`
`
`
`US 2004/0043401 Al
`
`Mar. 4, 2004
`
`1
`
`CHIMERIC T CELL RECEOTORS
`
`CROSS REFGR ENCE TO RELATl.m
`Al'l'LICATJONS
`
`[0001] This application claims the benelit of U.S. Provi(cid:173)
`sional Application No. 60/383,872, filed May 28, 2002,
`wilicb is incorporated herein by reforeoco.
`
`BACKUROUNI) OF fNVEN"rlON
`
`[0002] This application relates to nucleic acid polymers
`encoding c:h:imeric T ceU receptors (TCRs), to 1he chimeric
`TCRs, and to methods of using same to facilitate a T cell
`response to a selected target.
`
`[0003] Tile induction of potent tumor immunity presi:n1s a
`major cballenge for cancer immunotberapy. Tumor cells
`have many properties thnL facilitate immune evasion 1
`3
`·
`•
`Most tumor 11ntigens cbaracterit'.ecl LO elate, are self-antigens
`and are thus poorly immuuogcnic45
`. The paucity of target
`aotigeas, the difficulty of overcoming tolerance to self(cid:173)
`a.atigens, and impaired antigen presentation also contribute
`to compromise T-cell priming in cancer-bearing bosts1
`3
`0
`•
`-
`•
`10 . Furthermore, malignam cells may escape from tumor(cid:173)
`specific eU:ector T cells by downregulating major bistocom(cid:173)
`patibility complex (MIIC) and/or antigen expression, or by
`11
`3
`establishing an immunosuppressivc microenvironment 1
`"
`•
`.
`
`[0004] Genetic approaches offer a potential means to
`enhance immune recognition and elimfoation of cancer
`cells. One p romising strategy is to genetically engineer T
`lymphO(;ytes to express artific ial T CRs that clireet cytotox(cid:173)
`13
`icity toward tumor ce11s12
`• Artificial receptors typit:ally
`•
`comprise a tumor antigen-specific recognition element
`derived from a s ingle-chain antibody variable fragment
`(scFv). When used to reprogram l ~cell specificity. such
`Ci.1sion receptors permit MHC-inclepenclcnl rccogn.ilion of
`nativ1: rat b1:r !ban process1:d antigen I z. i ,,. ScFv-based TCRs
`are engineered to contain a signaling domain that delivers an
`
`activatiM st.imulus (signal 1) only1~"1, The TC R-1;, cyto(cid:173)
`plasmic domain, which <folivers a potent signal l in the
`absence of the remaining components of the TCR-CD3
`complex 1S-16, is well suited for activating cytolytic func(cid:173)
`tions. 111c potential clinic,tl utility of this strategy is sup(cid:173)
`ported by the demonstration !bat, despite feats about defec(cid:173)
`tive signaling in lymphocytes of tumor-bearing ;:;ubjects 17,
`s-chain fusion receptors retain potent activity in cancer
`patent cytotoxic T cells18
`.
`
`[0005] However, while sufficieot to elicit tumoricidal
`functions, the engagement of !;-chain fusion receptors may
`not suffice to elicit substantial IL-2 secretion .in the abstnce
`of a concomitant co-stimula tory signalrn. In physiologicnl
`T-cell responses, optimal lympbt1cyte actjvat io □ requires tbe
`engagement of one or more 1.:0-slimularory receptors (signal
`
`2), the be&I charoctcrized of wbich is CD28 10·2:.. Provision
`of signal I in the absence of C D28 signaling can result in a
`very poor Taccll proliferative re.sponse or in the induction of
`a.aergy or apoptosis1D-:!:!_ Consequently, it may be extremely
`valuable to engineer human T cells so that they receive a
`co-stimulatory signal in a tumor antigen-dependent manner.
`An important development in this regard has been the
`successful desiga of scPv-CD28 fusion receptors that trans(cid:173)
`duce a functiooal ant igen-dcpendeot co-stimulatory s ignal in
`human primary T cells, porm.ittiag sustained T-ccll prolif-
`
`eration when both the endogenous TCR llnd tbe ch imeric
`CD28 receptor arc engaged23
`• Soc U.S. patent applic;1tion
`Ser. No. 08/940,544.
`
`[0006] Notwithstanding
`there
`fo regoing efforts,
`thi::
`remains a continuing need for more effective chimeric
`TCRs. Tbe present inveotion offers chimeric TCRs that are
`able Lo provide both the activation and the co-stimulation
`s ignaL5 from a singk molccuJe lo more effectively direct
`T-Jympbocyte cytotoxicity against a deftnecl target anct
`T-lymphocyte proliferationJ;
`
`SUMMARY OF INVENTION
`
`[0007] The present invention provides chimeric T CR's,
`nucleic acid polymer encoding the chimeric TCR 's and
`methods of using tbe chimeric TCR's to facilitate T cell
`response 10 a specific target. The chimeric TCR 's of tbe
`invention combine, in a s ingle chimeric species, the inLra(cid:173)
`cellular domain of CD3 ~-chain (",-:eta chain portion"), a
`s ignaling region from a costimulatory protein such as CD28
`and a binding e lement tbat specifically interacts with a
`selected target. Thus, in accordance with a first aspect of the
`invention, there is provided a nucleic acid encoding a
`cbirncric T cell receptor, said chimeric r cell receptor
`comprising a zeta chain, a CD28 signaling region a □d a
`binding element that specifically interacts with a selected
`target. In accordance with a second aspect of the invention,
`there is provided a chimeric T cell receptor com prising a zeta
`chain portion, a CD28 signaling region and a binding
`e lement.
`
`In accordance with the method of the invention a
`[0008]
`chimeric TCR is provided wbicb comprises a zeta chain
`portion, a co-stimulatory signaling element and a binding
`elcmcnl which specifically interacts with a cellular marker
`associated with target cells.
`
`[0009) T-lyropbocytes from the individual to be treated,
`for example ~ hu man individual, arc transduced wilb tbc
`ch·imeric TCR. This transduct ion may occur ex vivo, after
`which the transduced cells are reiocrocluced into the indi(cid:173)
`vidual. A'> a resul4 T cell immune response is s timulated in
`the .individual to the larger cells.
`
`BRIEF DESCRIPTION OF DRAWl NGS
`
`[0010] FIG. 1 shows a Schematic of a nucleic acid poly(cid:173)
`mer within Lhe scope of the invention.
`[OOU] FIG. 2 shows a series of chimeric TCR's.
`
`[0012] J<'IGS. 3A a nd B show specific target lysis by
`PSMA redirected T cells.
`[0013] F[CS. 4A nnd B. The P28z fusion receptor renders
`human T lymphocytes t:apable o f PSMA-clepeodent expan(cid:173)
`sion. Human T 1.:ells were transduced with the fo llowing
`relroviral coustrucls (gene transfer cfficicucy indicated in
`parentheses): SFG l 9z1 (60%), SFG P28 (53%), SFG Pz l
`(68%), SFG P28z (23%), and SFG Pz28 (32%). 'luree days
`later, 5:x105 transduccd T cells were co-cultured in 20 U/ ml
`IL-2 with irrncliated Nll13T3 feeder cells as follows: (/\)
`unmodified (B) NJH3T3-B7.l (C) N LH3T3, PSMA, o r (D)
`N1113T3-PSMA+B7.L Cell numbers were counted o n days
`3 and 7, aud data presented arc mcao Ir;/ s .d. of triplicate
`evaluations. Similar results were obtained in three experi(cid:173)
`ments.
`
`Miltenyi Ex. 1010 Page 11
`
`
`
`US 2004/0043401 A l
`
`Mar. 4, 2004
`
`2
`
`[0014] FIGS. SA-F. Primary aod secoodary stimulation of
`traosduced T cells in response to PSMA. Peripheral blood T
`cells wen: Lransduced with the following retroviral con(cid:173)
`strucL'i (gene transfer efticieocy indicated io parentheses):
`P28 {27%), P:d (36%), or P2Sz (17%). Theo the ceUs were
`subjected to two roundi, of stimulation on N1113T3 fibroblast
`feeder layers (indicated by arrows). For the primary stimu(cid:173)
`lation, lxl0~ trnosducecl Tcclls were C.'0-culture<l io IL-2 (20
`U/rnl) with irradiated N1H3T3 cells exprossing PSMA(pao(cid:173)
`els A and 13) or PSM/\+87.l (panels C and D). ON day 7,
`cultures were re-stimulated by co-culture with a similar
`mono layer. Absolute numbers of Lrans<luced CD8+ (panels/\
`and C) and CD4+ T cells (panels B and D) were calculated
`as the product of pcrccmage lransduccd (determined by liow
`cytometry) x tott1l cell count Co-culture of au lransduccd
`PBL popu.la1ions with B7.1 -cxpross.ing or unmodified
`Nll 13T3 ce;:lls resulted in a progressive decline in total cell
`number and content of transduced T cells (data not sbtlwo).
`(E) P28z-tnmsd1Jced T cells were expanded by sequential
`re-stimulation on NlH3T3 PSMA libroblasl" feeder faycrs, as
`indicated by the arrows. Cultures worn maintained in fl-2
`(20 U/ml), wb.ich was added every tbree days.
`
`[0015] Tbe data represent \be mean 'r:/ s.d. of six data
`poiors (triplicate cell counts from two separate c:uJtures).
`T hese cultmes were subjected to tbree-co.lor Uow cytomelry
`al intervals to detect transduced (eG£lP+) cells of the CD4+
`and CDS+ subset.s. Sim ilar dutu were obta.i ned upon analysis
`of both cultures, and data shown are from one reprcsentatfvc
`example (l•l
`
`[0016] FIGS. 6A and B. PSMA+ tumor cells activa.tu
`uytolytiL· and proliferative responses in P28?.-lransduce<l
`PBl.s. (A) Specific tumor cell lysis by PSMA-redirected
`T-cclls. T cell~ were lransduced with 19z1 (control), l1 zl,
`P28z GFP, and Pr.28 GFP. four days aller completion of
`gene transfer, equivalent numbers of transduced T cells were
`added to LNCoP bu man prostate ceUs. All PSMA•sµecil1c T
`cells (Pzl, P28z, and Pz28) demonstrated cytotoxic activity
`similar to that demonstrated against Nll 13T3 PSM/\+ fibro(cid:173)
`blasts. Dackground cytotoxic activity seen with 19z1 control
`T cells may be clue to alloreaclivity (which i& not seen with
`the murine Nlll3T3 fibroblasts: FIG. 3). (B) The P28z
`fusion receptor renders T lymphocytes capable of PSMA(cid:173)
`dependen t, 137.1-im)ependent exp,lnsion following co-cuJLi(cid:173)
`vntion witb LNCaP tumot calls. 19zl-. Pzl-. and Pz28-
`1ransduced ·r cells did not expand.
`
`DETAILED DESCRIPTION
`
`[0017]
`In accordance with tbc present invention, activa(cid:173)
`tion and co-stimul,Hioo are providtJd by a single chimeric T
`cell receptor comprising a :t:ela chain portion, a costimula(cid:173)
`tory signaling region and a target-specific binding element.
`The T cell re<.-eptor is suitably generated in situ in T
`lympbocytcs by c.xprnssioo of a nucleic acid polymer encod(cid:173)
`ing the three pmtions of the chimeric T cell receptor.
`
`[0018] As used in the specification and c laims of this
`application, the term "CostimuJatory signa.li.ng region'' refers
`to a portion of tbe chimeric T cell receptor ct1mprising ti1e
`intracellular domain of a costirnul atory molecule. Costimu(cid:173)
`la10ry are cell surface molecules other than antigens recep(cid:173)
`tors or their ligands that are required for an efficien1 response
`of lympbocytes to antigen. Examples of such molecules
`iocludc CD28. 4-lBB, DAP-10 and lCOS. Thus, while lhe
`
`invention in ex-emµlifted primarily with CD28 as U1e co(cid:173)
`stimuiatory signaling clement. other cos!irnulatory clements
`are within the scope uf the inwntion. For example, chimeric
`TCR containing the intracellular domain of 4-1J3B (full
`sequence given in Seq m No: 15), l COS (l'ull sequence
`given in Seq TD No: I 6) and IJAP-10 (full sequenc:t given
`by Seq. ID No: 17) arc also suitably employed in 1he
`invention.
`
`[0019) FIG. 1 shows a schematic of a nucleic acid poly(cid:173)
`mer within the scope of the invention in which the;: T cell
`receptor is positioned within an SrG onco-retmviral vector.
`As shown, tbe nucleic 11cid polymer comprises th.e 5'-long
`tl'rminal repeat (1.TR) and the packaging signal '4' portion of
`the vector, followed by the CDS a -hinge 10 and tbe binding
`element 11. SD and SArepresen11he splice donor and splice
`acceptor, respectively. The next region 12 encodes the zeta
`chain portion ancJ CD:18 sequences, am.I may additionally
`include transmembrane sequences from other sources, for
`example from CD8. The zeta and CD28 may he disposed in
`lbc nucleic acid polymer is either order. Next in order comes
`an EMCV IRES 13, followed by a sequence 14 encoding a
`marker protein, such as enhanced green fluorescent protein
`(EGFP). Al ibe 3' end of the nucleic acid polymer as
`illustrated in FIG. 1 is a 3'-LTR from the SFG onco(cid:173)
`retroviral vector. While tbe structure in F £G. 1 reflects 1be
`vector which was used in the examples described below.
`other vectors wrucb rcsull in expression of tbe chimeric T CR
`of the invention may a.lso be employed.
`
`[0020] The zeta chaio portion sequence employed in Lbe
`present appl ication includes the inlraccUular domain. This
`domain, which spans amino acid residues 52-163 (Seq. ID
`No: 14 (nucleotides 154-489, Seq, ID No. 3) of tbe human
`CD3 zeta chain, can be amplified using tbe primers of Seq.
`ill Nos. l and 2.
`
`[0021) CD28 sequences can be found in lbe present appli•
`catioo on either side of the zeta chain portion sequence. ln
`either ca.se, tbe C.IJ28 sequences include tbe signaling ele(cid:173)
`ments from CD28. In om: embodiment. where CD 28 is
`between the zeta cbaio portion and the scFv, the CD28
`portion suitably includes Ille transmembriJ_ne and signaling
`domains of CD28, i.e., lbc portion of CD28 cDNA spanning
`nucleotides 336 to 663, .including tbc stop codon (amino
`acids 144-220). This portion of CD28 can be amplified by
`PCR using the primers o[ Seq. ID NO. 4 and 5. The full
`sequence of this region is set forth in Seq. ID No: 6.
`Alternatively, when the 7,eta sequence lies between the
`CD28 sequence and the binding e lement, the 41 amino acid
`intracellular domain of CD28 (amino acid residues given by
`Seq. lD No. 9) is suitably used alone. This fragment of CD28
`cDN/\can be amplilied using primers of Seq. ID. Nos. 7 anti
`8.
`
`[0022)
`Ilintling elements used in 1he invention are selected
`10 provide the chimeric TCR with lhe ability to recognize a
`target of interest. The target to which the chimeric T cell
`receptors of tbc invention arc directed can be any target of
`clinical interest to which it would be desirable to induce a T
`cell response. Tb.is would include mark-ers associated with
`cancers of various types, including without lirnjtation pros(cid:173)
`tale cancer (for example using a binding element that binds
`10 PSMA), breast cancer (for example using a binding
`clement that targets Hcr-2) and ncurol)laslomas, melanomas,
`small cell lung carcinoma, sarcomas and brain lumors (for
`
`Miltenyi Ex. 1010 Page 12
`
`
`
`US 2004/0043401 Al
`
`Mar. 4, 2004
`
`3
`
`example using a binding element that targets GD~)- Known
`binding eJemcms used in cb.imeric TCR's arc gcncraJJy
`useful in the present invention. and include without limita(cid:173)
`tion Lbose described in commonly assigned PCT Publication
`97 /36434 and U.S. patent applications Ser. Nos. 08/940,544
`and 09nS6,502 which are incorponited hert:in by reference
`in their entirety.
`[0023] The hiadtng elements used in the invention arc
`suitably antibodies that recognize a selected target. For
`convenience, the antibody used as the binding e lement is
`preforahly a single cbaio antibody (scFv). Single cbain
`antibodies may be cloned from tile V region genes of a
`hybridonrn specific for a desired target. The production of
`sucb bybridomas has bocomo routine, aocl the procedure will
`not be repeated here. A technique which can be u~ed for
`cloning the variable region beavy chain (V11) and variable
`region light cbain (V.) has been described in Orlandi e t al.,
`Proc.:. Natl Acad. Sci. (USA) 86: 3833-3837 ( I 989). nrie0y,
`mRNA is isolated rrom the bybridoma cell line, and reverse
`transcribed iolo<:omplemeotnry DNA(cDNA), for example
`using a reverse traoscriptasc polymerase chain reaction
`(RT-PCR) kit. Sequenco-spccific primers correspo nding to
`the sequence of the Vu and V L genes arc used. Sequence
`a.nalysis or the cloned products iilld comp,1ri.son Lo the
`known sequenci: for tbe V Lt and V L genes 1,;ao be used 10
`show that the cloned V H gene matched expectations. The V 1-1
`and VJ.. genes a re then attached together, for example using
`an oligouucleotidc encoding a (gly-ser~)s liokor.
`[0024] As is reflected in the examples below, the trans(cid:173)
`membrane domain does not need to be the CD28 lraasmem(cid:173)
`brane dorn11in, and indeed is CD28 in the embodiment witb
`the centrally-positiooed largely as a matter of coaveaieoce
`to minimize the numbor of amplification/cloning s teps that
`need to be performed. Other transmembranc domains that
`may be employed include the CDS and CD3 zeta transmem(cid:173)
`br:uie domains.
`[0025]
`In addition to the zeta chajn ptirlion, CD28 und
`binding elt:ments, tile chimeric TCR may include a selection
`e lement. For example, dihydrofolate reductase {DI r PR) may
`he included in lr.e TCR lo allow ex vivo or in viv~1 selection
`for lranscluccd cells nsiog metbotrexate. (Soc comrnooly(cid:173)
`assigaed PCT Publication 97/33988, whicb is iocorporuted
`ber1,;io by reference).
`[0026] FIG. 2 shows a series or chimeric TCR 's specific
`for PSMA that were prepared in o rder lo evaluate the
`efficacy of 1h~ iovention. TCR PZ 1, a control species,
`contains a PSMA-specific scfV, the 'v hinge and transmem(cid:173)
`br:uie portions from CD8, and the intraceUular domain of
`CD3 zeta. P28, the other control species contains a PSMA(cid:173)
`specific scFV and the intracellular, transmembrane and
`much of the extracellular portions oF CD28. P28Z and PZ28
`represent TCR 'sin accordance with the invention. lo P2SZ,
`the intracellular zeta chain portion is joined to Lhe C-tenni(cid:173)
`nus o r P28. Tn PZ28. the intracellular 41 amino acids (Seq.
`ID No. 9) of CD28 arc joined to the C-tcrminus of the PZl
`receptor.
`
`[0027] The expansion of fuoc:tiooal tumor-specitl<: T lym(cid:173)
`phocytes is of central import ,tnce in tumor immunity.
`Whether in the con1ex1 of in vivo immunization or ex vivo
`T-cell expansion, the biologica I requ iremeats for T-oell
`priming and amplification have to he met to attain mean(cid:173)
`ingful immune responses. Co-stimulation is crucial in this
`
`process ' 9-= and is thus central to Lhe development of effec(cid:173)
`tive adoptive icnmunotberapy of canccr19
`
`.
`
`29
`
`·
`
`[0028) The present invention describes chimeric TCRs
`and in particular sc:Fv-based chimeric receptors designed to
`provide bo(h TCR-like and co-stimulatory signals upon
`binding of the tumor antigen PSMA. To achieve this, the
`intracellular domains of human TCR!'; and CD28 have beea
`fu:sed in series within a single molecule, thereby recruiting
`these s.ignaliog motifs to the site of au1igon engagement at a
`fixed s toichiometry of l :1. Most important, our study was
`perfom1ed in human primary T lymphocytes-that is, in
`biologically and tberapeutically relevant cells. Tbe abi.lity to
`sustain T-cell expansion and tumoricidal functions could
`tberefore b<.:- waluatcd, which is not possible in leukemic
`cells30·n _ We show here tbat, following conrnct witb cell(cid:173)
`bound PSMA, activated human PBL.s engioeercd to express
`the P28z receptor produ1,;e I L-2, undergo sequential rounds
`of expansion, and maintain thereaner their ability to execute
`specific Iysis of PSMA-expres.-;ing target cells.
`
`[0029) Tbe most important fmding in th.is sh1dy is tbo
`demonstration that expression of P28z enables T .:ells lo
`undergo repeated rounds of antigen-dependent stimulation
`aod expansion. Tbis pro.:uss was ac.:ompanicd by a progres(cid:173)
`s ive increase in the proportion of traosduced T cell<; with in
`bulk cultures, consistent with the expected selective advan(cid:173)
`tage conferred by the receptor. The capacity of P28z to
`clclivor signal l is demonstrated by production of IL-2 and
`induction of cell proliferation upon stimu lntion with PSMA+
`87.1, which are compitrable to tbose obtained in T cells
`expressing Pzl (which contains TCRl; but oo CD2S
`lysis of PSMA+ Largels also reflects
`sequeaces). Specilk
`functional activation through tllil TCR pathway. Importantly,
`the P 28z fasion receptor can also provide potent co-stimu(cid:173)
`lation (signal 2). Thus, in the absence of exogenous
`B7•driven co•stimulation, engagement of PSMA elicits 11....-2
`production and proliferation. Under tbe same conditions.
`P zl-transclucod cells fail to secrete IL-2 and proliferate,
`corroborating findings by Finney el al. obtained in Jurkat
`cells31
`•
`[0030) The relative positions of the TCR!;, and CD28
`signaling olomeats within the fusion receptor proved crucial.
`[n P28¼ tbc hinge, transrnembrane, and proximal iulraccl(cid:173)
`lular portions of the molecule were derived from CD28,
`followed by the signaling domain of 'fCRt Wbco CD2S
`sequences were !'used IO the C termiousof'TCR!;, as in P7.28,
`the functional activity was substantially compromised rcla•
`tive to P28z, panicularly with regard to sustaining prolif(cid:173)
`eration. 1bis occurred despite comparable cell-surface
`expression of the two receptors. Pz28 retained the ability to
`deliver a TCR-like sigO!ll upon PS MAbinding, as evidenced
`by cytoly tic activity and 137.1 -<lopcndont proli£eratioll and
`fL-2 production. l lowever the co-stimulatory potem:y of
`P128, as evaluated in the absence of B7. J, was no better than
`that or Pzl.
`
`[0031) One potential explanation for this fiolliog is Lba1 the
`conformational integrity of the fusion receptor is disrupted
`when the C D28 signaling domain is placed downstream of
`TCR.l;. It is noteworthy in tbis regard that western biol.ling
`analysis indicated that 1he Pr28 receptor exhibited less
`bomodimerization in bumao Tcells tbao eitbcr P28z or Pzl.
`An alternative explanation is tbat membrane proximity is
`more criti.:al for CD28 lban for TCRl;. ' lbus, placement of
`
`Miltenyi Ex. 1010 Page 13
`
`
`
`US 2004/0043401 Al
`
`Mar. 4, 2004
`
`4
`
`the CD28 moiety distal lo TCRt; might impair i1s ability to
`associaf"c with dowoslroam sigoaling molecules, such ,ls
`ps6"-" (ref. 32), ,vhich rnside in very c lose proximity to the
`cell membrane. A third possib'ilily is that lhesti fusion
`receptors diller i.o their ability Lo i11terac1 wi1b negative
`reg11J.11ors, for example, MAP kinase phosphatase;,-6 (MKP-
`6)33. II is plausibk that the ability of P28z to bind MKP-6
`might be impaired as a resull of steric hindrance. thereby
`enhancing co-stimulatory activity. Coovcrsely, io the case of
`Pz28, the binding of this phospha1ase a1 the C tem1inus may
`adversely affect the .signaling potency of this receptor. Tbi.s
`hypothesis is supported by findings indicating that Pz.28 was
`not only less actwe io eliciting IL-2 secretion than P28z, bul
`also less active than Pz l. A final possible explanation ror the
`superior function or 1'28z is that it contains the C D28
`Lra□smembraoo domain, unlike Pz28 and Pz l. However, Ibis
`is unlike ly because the cytoplasmic portion of CD28 is
`sufficient for co-stimulatory aclivity3".
`[0032] How might adoptive transfer of cells expressing
`P28z be developed for Lberapy directed against PSMA(cid:173)
`exprcssing tumors or tumor-associated vasculaturc? As
`this fosion receptor enables traosduccd T cells to proliferate
`in an antigeo-dependeol manner, U1.is raises tile prospect that
`these cells couJd be expanded both i.o vitro. before infusion,
`and, most importantly, in vivo in the lumor-btJaring host.
`Then: is substantial preclinical evidcm.:e indicating 1ha1
`success of adoptive T-cell therapy depends largely on the
`relative numbers and growtb kinetics of tumor cells and
`therapeutically administered T cells3-s.s6
`. Consequently,
`Lrcatmenl with T cells expressing a rccepwr like P28z may
`require smaller T-cell doses (and lbus shorter in vitro culture
`periuds) and allow for T-cell expansion following infusion.
`As P287.-transcluced T cells expanded on PSMA-positive
`cells retained their speciik cytolylic activity, such a cell
`culture pmcodurc could provide a useful means lo selec(cid:173)
`tively expand lransduccd T cell,;. Importantly, P28z provides
`a means to acti.v,llc and expand T ceUs upon engaging cells
`that lack MHC and/ or co-slimula1ory molecules., and may
`thus target lhe lraosduced lyrnphocyt1:s to ceUs lbat escape
`immune recognition.
`[0033]
`In summary, we have shown that artificial receptors
`hased upon fusion of the signaling domains of TC Rs and
`CD28 can be used to redirect 1be specificity of primary
`bumao T cells to a tumor antigen. The transduced T cells
`undergo selective expansion following contact with cell(cid:173)
`bound PSMA wh!le maintaining the ability
`lo mediate
`specific lysis of tumor cells. The availability of a s.ingle
`chimeric receptor providing both activation and co-stimu(cid:173)
`latory functions facilitates lymphocyte transduction and
`hence clioicaJ applic~b.ility.
`[0034] Thus, tbe present invention also provides a method
`for stimulating a T cell mediated immune response:: to a
`target cell population in a subject individual comprising the
`step of administering 10 the subject irJdividual a chimeric T
`ceJJ receptor comprising a zeta chain portion comprisiog the
`i.ntracelh1lar domain of buruan CD3 ~ chain, a CD28 sig(cid:173)
`naling rt!gion aod a binding element that specilically inter(cid:173)
`acts witb a selected large! such that Lbe chimeric T ce□
`receptor is expressed in T lymphocytes of the s ubject
`individual, wherein tbe binding element is sele<:ted to spe(cid:173)
`cifically recognize the target cell population.
`[0035] As used in tbc spcciJkatioo and c laims of this
`application, lbe term ·'administering" includes any motbod
`
`which is eJiective to result in expression of a. chimeric TCR
`of1he ioveotioo in Tlympbocylcs of the subject individual.
`One method for administering the chimeric TCR is therdore
`by ex vivo lrnnsducli.oo of peripheral blood T cells or
`heroatopoietic pmgeotior eel.ls (which would eventually be
`allogeneic) with a nucleic acid construct in aCt:c,rdance with
`the invent ion and returning tbc transduced cells. preferably
`after expansion to the subject inclividuaL
`[0036) As used in tbe specifica.1ioo and claims of this
`appliC'dtion, the term ''subject individual" r;efers lo a Living
`organism i □ which lhe immune response to the target cell
`population is 10 be induced. The subject inclivi.dual is pref(cid:173)
`erably mammalian, inc luding humans, companion a nima ls
`such ~s clogs and cat5, horses, agricull11ral mammals such as
`cattle, pigs and sheep, and laboratory animals including
`mice and rats.
`[0037] Tbe invt!nlioo will now be further descri.be::d witb
`rel'erence lo the following non-liruitiog examples.
`
`EXAMPLE J
`
`[0038) Recombioanl receptors ilild reLroviral vectors. All
`fusion rcc~lors contain a scPv derived from lbc J591
`hybridoma as describedrn 1b facilitate• detectio n o r 1rani;(cid:173)
`duced cells. all constructs contained the encephalomyocurdi(cid:173)
`Lis vims internal ribosome entry site (BMCV-IRES)37 and
`the eGI7P gene in~erted in tbe SPG vector-38
`. In Pzl, the
`1591 scFv is coupled through human CD8'v' h inge and
`Lraosmembraoe sequences to the, intracellular domain of
`bu.man 'J'CR~ (re[. 18). P28 comprises a fusion of the J S91
`scFv lo human CD28 as described::3·39
`• To construct P28z,
`nucleotides 336-660 of CD28 were amplilie<.l using primers
`51-GGCGGCCG CAATIGAAGTIATGTATC-3' (Seq. ID.
`No. 4) and 5'-TGCGCTCCTGCTGAACITCACTCTG(cid:173)
`GAGCGATAGGCTGCGAAGTCGC0-3 (Se