`
`Cancer Therapy: Clinical
`
`A Phase I Study on Adoptive Immunotherapy Using Gene-Modified
`T Cells for Ovarian Cancer
`Michael H. Kershaw,1,3,4 Jennifer A.Westwood,1,3 Linda L. Parker,1Gang Wang,1,5 Zelig Eshhar,6
`Sharon A. Mavroukakis,1Donald E. White,1John R. Wunderlich,1Silvana Canevari,7 Linda Rogers-Freezer,1
`Clara C. Chen,2 James C. Yang,1Steven A. Rosenberg,1and Patrick Hwu1,5
`
`Abstract Purpose: A phase I study was conducted to assess the safety of adoptive immunotherapy
`using gene-modified autologousTcells for the treatment of metastatic ovarian cancer.
`Experimental Design: T cells with reactivity against the ovarian cancer ^ associated antigen
`a-folate receptor (FR) were generated by genetic modification of autologous T cells with a
`chimeric gene incorporating an anti-FR single-chain antibody linked to the signaling domain of
`the Fc receptor g chain. Patients were assigned to one of two cohorts in the study. Eight patients
`in cohort 1received a dose escalation of Tcells in combination with high-dose interleukin-2, and
`six patients in cohort 2 received dual-specificTcells (reactive with both FR and allogeneic cells)
`followed by immunization with allogeneic peripheral blood mononuclear cells.
`Results: Five patients in cohort 1 experienced some grade 3 to 4 treatment-related toxicity
`that was probably due to interleukin-2 administration, which could be managed using standard
`measures. Patients in cohort 2 experienced relatively mild side effects with grade1to 2 symptoms.
`No reduction in tumor burden was seen in any patient.Tracking 111In-labeled adoptively transferred
`T cells in cohort 1revealed a lack of specific localization of T cells to tumor except in one patient
`where some signal was detected in a peritoneal deposit. PCR analysis showed that gene-
`modified Tcells were present in the circulation in large numbers for the first 2 days after transfer,
`but these quickly declined to be barely detectable 1 month later in most patients. An inhibitory
`factor developed in the serum of three of six patients tested over the period of treatment, which
`significantly reduced the ability of gene-modified Tcells to respond against FR+ tumor cells.
`Conclusions: Large numbers of gene-modified tumor-reactive T cells can be safely given to
`patients, but these cells do not persist in large numbers long term. Future studies need to employ
`strategies to extend T cell persistence. This report is the first to document the use of genetically
`redirected T cells for the treatment of ovarian cancer.
`
`There is increasing interest in the use of immunotherapy for
`the treatment of malignant disease, and some dramatic clinical
`responses have led to intense activity in this field. In particular,
`the success of adoptive immunotherapy as a treatment for
`
`Authors’ Affiliations: 1Surgery Branch, Center for Cancer Research, National
`Cancer Institute; 2Department of Nuclear Medicine, Clinical Center, NIH, Bethesda,
`Maryland; 3Cancer Immunology Research Program, Peter MacCallum Cancer
`Centre; 4Department of Pathology, University of Melbourne, Melbourne, Australia;
`5Department of Melanoma Medical Oncology, The University of Texas M.D.
`Anderson Cancer Center, Houston, Texas; 6Department of Immunology, Weizmann
`Institute of Science, Rehovot, Israel; and 7Istituto Nazionale Tumori, Milan, Italy
`Received 5/16/06; revised 6/26/06; accepted 7/18/06.
`Grant support: The National Health and Medical Research Council (M. Kershaw),
`National Breast Cancer Foundation of Australia (M. Kershaw), Bob Parker Memorial
`Fund (J. Westwood), and Peter MacCallum Cancer Centre Foundation
`(J.Westwood).
`The costs of publication of this article were defrayed in part by the payment of page
`charges. This article must therefore be hereby marked advertisement in accordance
`with 18 U.S.C. Section 1734 solely to indicate this fact.
`Requests for reprints: Patrick Hwu, The University of Texas M.D. Anderson
`Cancer Center, 1515 Holcombe Boulevard, Unit 430, Houston, TX 77030. Phone:
`713-792-2921; Fax: 713-745-1046; E-mail: phwu@mdanderson.org.
`F 2006 American Association for Cancer Research.
`doi:10.1158/1078-0432.CCR-06-1183
`
`melanoma has prompted us to extend this therapy to ovarian
`cancer. Variables important in the application of this therapy
`have been identified in melanoma patients,
`including the
`requirement for tumor antigen-reactive lymphocytes, high-dose
`interleukin-2 (IL-2; ref. 1), and more recently the benefits of
`prior lymphoablation (2).
`However, endogenous tumor-reactive cells cannot be repro-
`ducibly found in ovarian patients. Nevertheless, several tumor-
`associated antigens have been identified for ovarian tumors,
`including Her-2 (3), tumor-associated glycoprotein 72 (4),
`Lewis-Y (5), and a-folate receptor (FR; ref. 6), and monoclonal
`antibodies exist recognizing these antigens. Recombinant genes
`encoding chimeric receptors incorporating antibody specificity
`can be used to genetically modify T cells to endow them with
`activity against tumor cells (7 – 17).
`We have previously reported the generation of FR-specific
`T cells by modification of T cells with a gene encoding a cell
`surface chimeric receptor linking single-chain (scFv) anti-FR to
`the transmembrane and cytoplasmic domains of the Fc receptor
`g chain. The scFv was derived from the MOv18 monoclonal
`antibody (18), and the chimeric gene is referred to as MOv-c.
`We showed that this gene could endow ex vivo transduced
`T cells with the ability to respond against FR+ tumor cells
`
`Clin Cancer Res 2006;12(20) October 15, 2006
`
`6106
`
`www.aacrjournals.org
`
`UPenn Ex. 2038
`Miltenyi v. UPenn
`IPR2022-00853
`
`
`
`Downloaded from http://aacrjournals.org/clincancerres/article-pdf/12/20/6106/1965492/6106.pdf by guest on 19 July 2022
`
`Adoptive Immunotherapy of Ovarian Cancer
`
`Cancer Institute, and informed consent was obtained from all patients
`before treatment.
`Patient eligibility. Patients had biopsy-proven recurrent, resected
`recurrent, or residual epithelial FR+ ovarian cancer that failed standard
`effective therapy,
`including cisplatin/carboplatin – or paclitaxel-
`containing regimens. Patients ranged in age from 33 to 60 years and
`had clinical Eastern Cooperative Oncology Group performance status of
`0 or 1. Eligibility criteria required serum creatinine levels V1.6 mg/dL
`and bilirubin <2.0 mg/dL. Blood eligibility criteria included hemoglo-
`bin >9.0 g/dL, WBC >3,000/mm3, and platelets >100,000/mm3 and an
`intact immune system as evidenced by a positive reaction to Candida
`albicans skin test, mumps skin test, or tetanus toxoid skin test on a
`standard anergy panel.
`Response assessment. Patients received radiologic evaluation by
`magnetic resonance imaging, computed tomography, or sonography
`immediately before treatment and at completion of therapy. Disease
`response was determined by comparison of pretreatment and post-
`treatment images. In addition, serum CA-125 levels were determined
`following treatment and compared with pretreatment CA-125 levels.
`T cell generation. A detailed description of the generation and
`characterization of T cells used in cohort 1 of the study has been
`published previously (22). Briefly, patient PBMCs derived from
`leukapheresis were stimulated with anti-CD3 (OKT3, Ortho Biotech,
`Raritan, NJ) and human recombinant IL-2 (600 IU/mL; Chiron,
`
`Emeryville, CA). After 3 days of culture, f5 107 to 1 108
`
`lymphocytes were taken and transduced with retroviral vector
`supernatant (Cell Genesys, San Francisco, CA) encoding the chimeric
`MOv-c gene and subsequently selected for gene integration by culture
`in G418.
`For the generation of dual-specific T cells used in cohort 2,
`stimulation of T cells was achieved by coculture of patient PBMCs
`with irradiated (5,000 cGy) allogeneic donor PBMCs from cryopre-
`served apheresis product (mixed lymphocyte reaction). The MHC
`haplotype of allogeneic donors was determined before use, and
`donors that differed in at least four MHC class I alleles from the
`patient were used. Culture medium consisted of AimV medium
`
`serum
`(Invitrogen, Carlsbad, CA) supplemented with 5% human AB
`(Valley Biomedical, Winchester, VA), penicillin (50 units/mL), strepto-
`mycin (50 mg/mL; Bio Whittaker, Walkersville, MD), amphotericin B
`(Fungizone, 1.25 mg/mL; Biofluids, Rockville, MD), L-glutamine
`(2 mmol/L; Mediatech, Herndon, VA), and human recombinant IL-2
`(Proleukin, 300 IU/mL; Chiron). Mixed lymphocyte reaction consisted
`
`of 2 106 patient PBMCs and 1 107 allogeneic stimulator PBMCs in
`
`2 mL AimV per well in 24-well plates. Between 24 and 48 wells were
`cultured per patient for 3 days, at which time transduction was done
`by aspirating 1.5 mL of medium and replacing with 2.0 mL retroviral
`supernatant containing 300 IU/mL IL-2, 10 mmol/L HEPES, and
`8 Ag/mL polybrene (Sigma, St. Louis, MO) followed by covering with
`plastic wrap and centrifugation at 1,000 g for 1 hour at room
`temperature. After overnight culture at 37jC/5% CO2, transduction was
`repeated on the following day, and then medium was replaced after
`another 24 hours. Cells were then resuspended at 1 106/mL in fresh
`medium containing 0.5 mg/mL G418 (Invitrogen) in 175-cm2 flasks for
`5 days before resuspension in media lacking G418.
`Cells were expanded to 2 109 and then restimulated with
`
`allogeneic PBMCs from the same donor to enrich for T cells specific
`for the donor allogeneic haplotype. Restimulation was done by
`
`incubating patient T cells (1 106/mL) and stimulator PBMCs
`(2 106/mL) in 3-liter Fenwall culture bags in AimV + additives and
`IL-2 (no G418). Cell numbers were adjusted to 1 106/mL, and IL-2
`
`was added every 2 days, until sufficient numbers for treatment were
`achieved.
`Cell lines, flow cytometry, and IFN-g secretion assay. Tumor cell
`lines used in assays of T cell function were the FR+ human ovarian
`
`melanoma cell lines Mel 526,
`cancer cell line IGROV-1 (23) and FR
`Mel 624, Mel 888, and Mel 1866 (Surgery Branch, National Cancer
`Institute, Bethesda, MD). Tumor cells were maintained in RPMI
`
`in vitro (19). In addition, adoptive transfer of anti-FR mouse
`T cells could inhibit tumor growth in lung metastases and i.p.
`models of disease in mice (20).
`More recently, we have generated FR-reactive cells from
`populations of T cells with endogenous
`specificity for
`allogeneic antigen. We showed that
`these T cells could
`respond to both tumor and allogeneic antigen and referred
`to these T cells as dual specific (21). The rationale behind the
`generation of dual-specific T cells was to provide a population
`of FR-reactive T cells that could expand in vivo in response
`to allogeneic immunization, which is not possible in response
`to FR alone. Indeed, adoptive transfer of mouse dual-specific
`T cells into mice followed by allogeneic immunization
`resulted in expansion of transferred cells and enhanced inhib-
`ition of s.c. tumor growth without the need for administration
`of IL-2 (21).
`Based on these encouraging results in mice, we initiated a
`two-cohort phase I clinical study in ovarian cancer patients.
`Cohort 1 patients were treated with adoptive transfer of bulk
`peripheral blood – derived T cells gene-modified with the anti-
`FR chimeric receptor in combination with high-dose IL-2.
`Cohort 2 involved the generation of dual-specific T cells from
`autologous peripheral blood mononuclear cells (PBMC) and
`their transfer into patients followed by s.c. immunization with
`allogeneic PBMCs.
`
`Materials and Methods
`
`Treatment regimen. Patients received adoptive transfer of auto-
`logous T cells gene-modified to express a chimeric receptor specific for
`the tumor-associated antigen FR. The study was divided into two
`cohorts, with cohort 1 receiving T cells and high-dose IL-2 and cohort 2
`receiving dual-specific T cells and s.c. immunization with allogeneic
`PBMCs but no IL-2.
`Eight patients were enrolled in cohort 1, each receiving up to three
`cycles of treatment, with each cycle consisting of administration of
`gene-modified T cells and IL-2 (720,000 IU/kg body weight).
`Approximately 4 weeks elapsed between the start of each cycle.
`Following activation, transduction, and G418 selection, T cells were
`expanded in culture, harvested, washed, and resuspended in 100 mL
`of saline and given to patients by i.v. drip over 20 to 30 minutes. The
`first five patients received a dose escalation regimen beginning at
`
`not easily rectified within 24 hours, the patient was eligible to proceed
`
`3 109 transduced T cells. If no grade 3 or 4 toxicity was observed,
`to the next dose level of 1 1010 T cells at the start of the next cycle and
`subsequently to the highest test dose level of 3 1010 to 5 1010 cells
`
`at the start of the third cycle. IL-2 was given i.v. on the day of T cell
`transfer and every 12 hours for up to six doses if tolerated.
`Six patients were enrolled in cohort 2, each receiving up to two cycles
`of treatment, with each cycle consisting of adoptive transfer of gene-
`modified dual-specific T cells followed by immunization with
`allogeneic PBMCs. Eight to 12 weeks elapsed between the start of each
`cycle. Following two in vitro allogeneic stimulations and expansion in
`culture, T cells were given to patients as in cohort 1. Allogeneic
`
`immunization consisted of s.c. injection of f2.0 109 to 4.0 109
`
`allogeneic PBMCs (viable and nonirradiated) from the same donor
`used to stimulate T cells during their generation in vitro. Each dose
`of allogeneic PBMCs was split into four equal parts and injected s.c.
`into separate sites on the lower extremities in 1 mL saline per site.
`Immunization was done 1 day after T cell transfer and again 1 week
`later because multiple allogeneic immunizations had shown better
`effect in mouse studies (21).
`Patient treatment and monitoring procedures were reviewed by the
`Institutional Review Board of the Center for Cancer Research, National
`
`www.aacrjournals.org
`
`6107
`
`Clin Cancer Res 2006;12(20) October 15, 2006
`
`UPenn Ex. 2038
`Miltenyi v. UPenn
`IPR2022-00853
`
`
`
`Downloaded from http://aacrjournals.org/clincancerres/article-pdf/12/20/6106/1965492/6106.pdf by guest on 19 July 2022
`
`Cancer Therapy: Clinical
`
`supplemented with 10% FCS (Invitrogen), penicillin (50 units/mL),
`streptomycin (50 mg/mL), amphotericin B (1.25 mg/mL), and
`L-glutamine (2 mmol/L). A melanoma-specific T cell
`line used in
`some experiments was derived from tumor-infiltrating lymphocytes of
`a patient at National Cancer Institute and maintained in T cell culture
`medium described above.
`Expression of chimeric MOv-g receptor by transduced T cells
`was determined using flow cytometry following staining with phyco-
`erythrin-conjugated Id18.1, a monoclonal antibody specific for the
`MOv-18 idiotype (24). T cells were stained with phycoerythrin-
`conjugated mouse IgG1 as a control for nonspecific binding.
`Transduced T cells were assessed for their ability to respond against
`the FR antigen by coculture with IGROV-1 ovarian cancer cells. T cells
`
`(1 105) were incubated with IGROV-1 cells (1 105; or FR-negative
`
`control tumor cells) in triplicate wells of 96-well plates. After overnight
`culture, supernatant was taken and assayed for IFN-g using ELISA
`kits according to manufacturer’s instructions (Endogen, Woburn, MA).
`T cells in cohort 2 of the study were also assessed for their ability to
`secrete IFN-g in response to allogeneic stimulator PBMCs freshly
`thawed from cryopreserved stocks. Anti-human CD3 (OKT3) was also
`used to stimulate T cells to gauge their maximal capacity to respond to
`TCR-CD3 engagement. OKT3 was immobilized on 96-well plastic
`plates at 0.5 Ag/well in 100 AL PBS overnight at 4jC.
`In some experiments, a 25% proportion of patient serum was
`included in T cell cocultures to determine possible effects of patient
`serum on T cell function. In some assays, protein G (Amersham
`Biosciences, Piscataway, NJ; 20 AL/mL) was added to serum before
`coculture and incubated for 1 hour at 4jC with gentle rocking to
`deplete patient serum of immunoglobulin.
`Serum FR titer assay. A double-determinant assay was done
`essentially as described (25) using MOv19, a non – cross-reacting
`antibody directed against FR (18), as catcher. Briefly, 96-well flat-
`bottomed maxisorp plates (Nunc, Roskilde, Denmark) were coated
`
`Table 1. Sites of disease and treatment history
`
`Patient
`
`Prior treatment
`
`with 200 AL of MOv19, at 1 Ag/mL in PBS, and incubated overnight
`at 4jC. Plates were washed and blocked for 1 hour with 200 AL/well
`of 0.5% bovine serum albumin in PBS; 100 AL of sample was added to
`wells. A positive control consisted of tissue culture supernatant from
`IGROV-1 cells. Plates were incubated 2 hours and washed, and 100 AL
`of biotinylated MOv18 (0.25 Ag/mL) were added followed by
`incubation at room temperature for 2 hours. Plates were washed,
`and streptavidin-horseradish peroxidase in PBS/0.5% bovine serum
`albumin was added 100 AL/well and incubated for 0.5 hour. Plates were
`washed, and 100 AL/well trimethylbenzidine was added and incubated
`for 5 to 10 minutes, and reaction was stopped with 1 mol/L H2SO4.
`Plates were read on spectrophotometer 450 nm within 0.5 hour of
`stopping reaction. Concentrations of FR in patient sera were expressed
`as dilution until absorbance reached background levels of media alone.
`T cell tracking. A fraction of transduced T cell cultures (17-50%,
`
`1.5 109 to 7.5 109 cells) were radiolabeled with 111In-oxine
`as described previously (26). Briefly, this involved incubation with
`750 ACi 111In-oxine per 1010 cells in 30 to 50 mL PBS for 15 minutes
`with gentle rocking. Labeled cells were then washed and resuspended in
`100 mL of saline containing 5% human serum albumin and 75,000 IU
`IL-2 for i.v. infusion into patients over a period of 10 to 20 minutes.
`Gamma camera images were obtained at intervals for up to 5 days
`where practicable.
`T cell persistence: PCR-ELISA. Patient peripheral blood was ana-
`lyzed for persistence of transduced T cells by detection of the neomycin
`phosphotransferase (neo) gene using a PCR-ELISA DIG Detection kit
`(Roche, Basel, Switzerland), as per the manufacturer’s directions using
`50 pmol forward neo primer (ATTGAACAAGATGGATTGCACGCAG),
`50 pmol reverse neo primer (TCAGAAGAACTCGTCAAGAAGGCG),
`0.25 unit Taq DNA polymerase (Promega, Madison, WI) and 50% by
`volume of patient PBMC lysate. A series of lysed samples of Jurkat-22
`neo cells (containing 1 copy of neo per cell) was prepared as standards,
`consisting of 1% of cells and decreasing in multiples of 2 down to
`
`1
`
`2
`
`3
`
`4
`5
`6
`7
`8
`
`9
`10
`
`11
`
`12
`
`13
`
`14
`
`Hysterectomy, BSO, debulked, Taxol, Carboplatin, Cisplatin,
`bone marrow transplant, etoposide
`THA/BSO, omentectomy, appendectomy, nodectomy,
`Taxol, Cisplatin, Topotecan, Hexamethylmelamine
`Radical hysterectomy, debulked, Carboplatin, Cytoxan,
`Adriamycin, Mitoxantrane, Tamoxifen, etoposide, radiation
`TAH/BSO Taxol, Carboplatin, Doxil, Topotecan, Gemzar
`TAH/BSO, Carboplatin, Cytoxan, Taxol, Topotecan
`Debulked, Carboplatin, Taxol, Doxil
`TAH/BSO, debulked, Carboplatin, Taxol
`TAH/BSO, debulked, Cisplatin, Cytoxan, Carboplatin,
`Taxol, Topotecan, Doxel
`TAH/BSO, debulked, Carboplatin, Taxol, Cytoxan
`TAH/BSO, debulked, Carboplatin, Taxol, Cisplatin, Taxol,
`monoclonal vaccine, Tamoxifen
`TAH/BSO, omentectomy, appendectomy, pancreatic reduction,
`splenectomy, Cytoxan, Cisplatin, vincristine, Hexalen,
`etoposide, Taxol, Carboplatin, Adriamycin, Topotecan, Gemzar
`TAH/BSO, omentectomy, Taxol, Carboplatin, bone marrow
`transplant, Taxane, Doxil, Herceptin, Gemcitabine, Topotecan
`Ovarian cystectomy, hysterectomy, pelvic lymphadenectomy,
`Taxotere, Carboplatin, Topotecan, Doxyl, Gemzar
`TAH/BSO, omentectomy, pelvic and para-aortic lymphadenectomy,
`Taxol, Cisplatin, external beam radiation, Topotecan,
`Thalidomide, etoposide, Hexalen
`
`Metastatic disease status on enrollment in study
`
`Lower abdominal s.c. mass, two inguinal nodules
`
`Retroperitoneal and left cervical lymph nodes
`
`Liver and vaginal cuff
`
`Perihepatic lesion, midabdominal s.c. nodule
`Perihepatic, ascites, sigmoid mass, omental disease
`Pelvic mass, para-aortic adenopathy
`Multiple sites periaortic retroperitoneal adenopathy
`Liver, pericolonic, pelvic lymph node
`
`Liver and rectal muscle mets
`Omentum, peritoneal implants, diaphragm,
`right supraclavicular nodes, pelvis
`Peritoneal implants, left pleural effusion, liver,
`retroperitoneal nodes
`
`Pelvic and mediastinal mets
`
`Omentum, mediastinum
`
`Epigastric intra-abdominal mass, right pelvic mass
`
`NOTE: Patients had advanced ovarian cancer with metastases to various sites. Before enrolling in the current study, total abdominal
`hysterectomy and bilateral salpingo-oophorectomy were done, and most patients had undergone debulking surgery (patients 1-8 enrolled in
`cohort 1 and patients 9-14 in cohort 2).
`Abbreviations: TAH, total abdominal hysterectomy; BSO, bilateral salpingo-oophorectomy.
`
`Clin Cancer Res 2006;12(20) October 15, 2006
`
`6108
`
`www.aacrjournals.org
`
`UPenn Ex. 2038
`Miltenyi v. UPenn
`IPR2022-00853
`
`
`
`Adoptive Immunotherapy of Ovarian Cancer
`
`Downloaded from http://aacrjournals.org/clincancerres/article-pdf/12/20/6106/1965492/6106.pdf by guest on 19 July 2022
`
`Fig. 1. Growth and phenotype of gene-modified Tcells. A, following allogeneic
`stimulation, 8 107 Tcells were transduced with retroviral vector encoding the
`MOv-g receptor and maintained at 1to 2 106/mL in media containing IL-2.
`Transduced Tcells were restimulated with allogeneic PBMCs on day 21, which
`resulted in further expansion of Tcells. Using this method, large numbers of
`dual-specificTcells could be generated. T cell expansion depicted is for patient 9.
`Representative of all six patients in cohort 2. The phenotype of transduced Tcells
`from cohort 2 of the study was determined with respect to T cell subset markers
`and chimeric receptor expression using specific antibodies and flow cytometry.
`B, although the relative proportions of CD4+ and CD8+ T cells varied between
`patients, the culture was made up predominantly of CD4+ and CD8+ cells as seen in
`the representative plot. C, expression of the chimeric MOv-g receptor was evident
`following staining with anti-idiotype antibody (thick line) compared with isotype
`control antibody (thin line). Representative of all patients.
`
`All T cells were transduced, as indicated by G418 resistance,
`and expressed the chimeric MOv-g receptor, as determined,
`in flow cytometry, by an increase in fluorescence staining in
`presence of Id 18.1, an anti-MOv18 idiotype monoclonal
`antibody compared with staining in presence of isotype control
`antibody (Fig. 1C). Although expressed at
`low level,
`the
`chimeric receptor endowed T cells with the ability to respond
`specifically against FR+ target cells (see next section).
`IFN-g secretion by T cells in response to tumor cells and
`allogeneic stimulator PBMC. T cell cultures from patients in
`cohort 1 were shown to secrete IFN-g specifically in response to
`FR, and this has been previously reported (22). IFN-g levels in
`response to FR+ IGROV-1 cells varied from 1,749 to 28,560
`pg/mL. With respect to patients in cohort 2, an important
`requirement of dual-specific T cells was their ability to respond
`
`0.016%. PCR cycling consisted of 96jC for 6 minutes followed by
`35 cycles of 95jC for 1 minute, 57jC for 1 minute, and 72jC for
`2 minutes. The ELISA was done using 7.5 AL of the PCR product and
`15 pmol/mL probe (Biotin-AGCAAGGTGAGATGACAGGAGAT), with
`hybridization done at 48jC.
`
`Results
`
`Patient characteristics. All patients had been diagnosed with
`metastatic ovarian cancer. Sites of metastases varied between
`patients but
`involved peritoneal disease with lymph node
`involvement (Table 1). Previous treatments received by patients
`before enrollment in the study varied but included surgical
`removal of primary lesion, debulking, and chemotherapy
`(Table 1). Previous therapies ceased at least 2 weeks before
`receiving gene-engineered T cells.
`Characterization of gene-modified T cells used in cohort 1. A
`complete characterization of T cells used in cohort 1 has
`already been described previously (22), but briefly, T cell
`cultures were stimulated with anti-CD3 antibody and were
`shown to expand from 11,000- to 3,000,000-fold. The mean
`time of culture of T cells from patients in cohort 1 was 47 days
`(range, 25-56 days). The T cells secreted IFN-g specifically in
`response to FR and could lyse FR+ tumor cells. Phenotypically,
`the bulk lymphocyte population was composed of both CD4+
`and CD8+ T cells and was shown to consist of a diverse range of
`clones able to secrete a variety of cytokines, including IFN-g,
`IL-10, granulocyte macrophage colony-stimulating factor,
`
`and IL-2, in response to FR. Percentages of CD4+CD8
`T cells
`
`CD8+ T cell percentages
`varied between 1% and 39%, and CD4
`ranged from 47% to 94%.
`In this cohort of the
`Expansion of T cells used in cohort 2.
`study, T cells received an initial stimulation with allogeneic
`stimulator cells and transduction with retroviral vector for a
`culture period of between 21 and 38 days. During this
`stimulation period, T cell expansion from patients varied from
`12- to 325-fold. To further expand T cell numbers and enrich
`for allo-specific T cells, a second stimulation with PBMCs from
`the original PBMC donor was done. This restimulation resulted
`in a further expansion in T cells of f50-fold. A representative
`growth curve for T cells over two stimulations is presented in
`Fig. 1A. The mean time of T cell culture for cohort 2 was
`40.5 days (range, 37-48 days).
`To promote high levels of allo stimulation, stimulator
`PBMCs were HLA typed at MHC class I loci to check for allelic
`differences to patient HLA type. Patient HLA type was
`determined to be largely dissimilar to stimulator HLA, with
`differences in at least four of six alleles.
`Phenotype of T cells in cohort 2. T cells are characterized into
`two major phenotypic subsets, either CD4+ or CD8+, which have
`different fundamental abilities of helper function or cytotoxic
`function, respectively. Because this could affect on the overall
`function of bulk T cell populations and interpretation of clinical
`results, the relative proportions of CD4+ and CD8+ T cells were
`determined for each culture. Following two stimulations with
`allogeneic PBMCs, expression of CD4 and CD8 T cell markers
`was determined using specific monoclonal antibodies and
`
`flow cytometry. Percentages of CD4+CD8
`T cells varied
`
`CD8+ T cell percentages
`between 2% and 82%, and CD4
`
`
`CD8
`cells were present in all
`ranged from 13% to 85%. CD4
`cultures but only as a minor population (2-15%; Fig. 1B).
`
`www.aacrjournals.org
`
`6109
`
`Clin Cancer Res 2006;12(20) October 15, 2006
`
`UPenn Ex. 2038
`Miltenyi v. UPenn
`IPR2022-00853
`
`
`
`Cancer Therapy: Clinical
`
`Table 2. Anti-FR and anti-allo responses of transduced T cells from patients in cohort 1 and 2 of the study
`
`Cohort 2
`
`Cohort 1, median
`
`Media alone
`
`)
`Melanoma (FR
`IGROV-1 (FR+)
`Allogeneic stimulator PBMCs
`Autologous PBMCs
`OKT3
`
`Pt. 9
`
`36
`35
`1,375
`2,270
`210
`5,784
`
`Pt. 10
`
`Pt. 11
`
`Pt. 12
`
`Pt. 13
`
`Pt. 14
`
`Median
`
`60
`54
`2,960
`1,555
`456
`13,317
`
`34
`28
`8,010
`2,995
`36
`9,620
`
`42
`26
`1295
`5625
`140
`2890
`
`0
`14
`1,340
`>4,320
`39
`>3,760
`
`19
`27
`9,050
`603
`298
`>59,000
`
`35
`28
`2,168
`2,633
`175
`7,702
`
`153
`139
`6,501
`
`7,457
`
`NOTE: T cell reactivity towards the FR tumor antigen and allogeneic stimulator PBMCs was determined by assaying IFN-g secretion (pg/mL)
`using ELISA following overnight incubation of T cells with the targets listed. Plastic-coated anti-CD3 (OKT3) was used as an indicator of maximal
`T cell response. Transduced T cells from all patients were reactive with FR, and T cells from patients in cohort 2 were reactive with allogeneic
`PBMCs. Nontransduced T cells did not respond against IGROV-1, except for patient 14 in whom 548 pg/mL IFN-g was secreted (data not shown).
`
`Downloaded from http://aacrjournals.org/clincancerres/article-pdf/12/20/6106/1965492/6106.pdf by guest on 19 July 2022
`
`to both FR and allogeneic stimulator PBMCs that were to be
`used as immunogen following T cell transfer. IFN-g secretion
`following coculture of T cells with tumor or allogeneic PBMC
`was used as an indicator of T cell response. Although there was
`some variation between patients in IFN-g levels in response to
`
`FR+ IGROV-1 cells (1,295-9,050 pg/mL; Table 2), secretion
`
`melanoma cells
`was always greater than that in response to FR
`(14-54 pg/mL), thereby showing that transduced T cells could
`respond specifically against FR. The specificity of the response
`was also supported by the observed lack of IFN-g secretion
`
`Table 3. Summary of treatment regimen and toxicity for patients receiving gene-modified T cells
`
`Patient
`
`Cycle no.
`
`1
`
`2
`
`3
`
`4
`
`5
`6
`
`7
`8
`
`9
`
`10
`
`11
`12
`13
`14
`
`1
`2
`3
`1
`2
`3
`1
`2
`3
`1
`2
`3
`1
`1
`2
`1
`1
`2
`
`Cycle no.
`
`1
`2
`1
`2
`1
`1
`1
`1
`
`No. T
`cells 10
`3.0
`3.0*
`10.0
`3.0c
`9.0
`47.0c
`3.0
`10.0
`17.5
`3.0
`11.4c
`21.9c
`3.0
`28.57c
`11.0
`22.0c
`44.0c
`43.5
`
`No. T
`cells 10
`46.5
`169.0
`13.17c
`50.0
`4.0
`11.7
`36.7
`9.0
`
`No. IL-2 injections
`
` 9
`
`Grades of
`adverse events
`
`Grade 1 and 2
`toxicity events
`
`6
`5
`3
`5
`4
`4
`5
`3
`1
`5
`1
`0
`3
`6
`6
`0
`2
`1
`
` 9
`
`No. allo
`immunizations
`
`x
`
`2
`2
`2
`2
`2
`2
`2
`2
`
`1, 2, 3, 4
`2, 3
`2, 3
`1, 2
`
`HB, FAT, NAU, PU, PE
`ED
`ED, LEU, PCD, PU, PE
`PCD, FAT, NAU, BIL, PU
`
`3
`2
`3
`
`3
`
`2
`2
`2
`2, 4
`3
`2
`
`No. allo
`cells 10
` 9
`4.55
`6.5
`4.5
`7.0
`7.8
`7.32
`6.72
`7.45
`
`LUO
`
`ASC
`FAT, DIA
`FAT
`RIG, VOM
`
`DYS
`
`Grades of
`adverse events
`
`1, 2
`None
`1, 2
`None
`2
`1
`None
`1, 2
`
`Grade 3 and 4
`toxicity events
`
`LEU, HYP, PCD
`RIG
`HB, HYP
`
`DIA, FAT
`
`HYP, STC
`
`DYS
`
`DYSb
`HYP
`
`Grade 1 and 2
`toxicity events
`
`ISR, URT, DYS
`
`RIG, ISR, NAU
`
`ISR
`ISR
`
`HYP, RIG, FAT,
`ISR, NAU, VOM
`
`Abbreviations: ASC, ascites; HB, hemoglobin; PE, pleural effusion; BIL, bilirubin increased; HYP, hypotension; PU, pulmonary; DIA, diarrhea;
`LEU, leukopenia; RIG, rigors; DYS, dyspnea; LUO, low urine output; STC, sinus tachycardia; ED, Edema; NAU, nausea; URT, urticaria; FAT,
`fatigue; PCD, platelet count decreased; VOM, vomiting; ISR, injection site reaction (allogeneic immunization).
`*No progression to higher dose in this cycle due to grade 4 toxicity in previous cycle.
`cSome of these cells were labeled with 111In for trafficking.
`bOff protocol after one cycle due to dyspnea concerns.
`xDose divided into two to four injections given on day 1 and 8 following MOv-g T cells.
`
`Clin Cancer Res 2006;12(20) October 15, 2006
`
`6110
`
`www.aacrjournals.org
`
`UPenn Ex. 2038
`Miltenyi v. UPenn
`IPR2022-00853
`
`
`
`Adoptive Immunotherapy of Ovarian Cancer
`
`Downloaded from http://aacrjournals.org/clincancerres/article-pdf/12/20/6106/1965492/6106.pdf by guest on 19 July 2022
`
`Fig. 2. Biodistribution of radiolabeled Tcells. Patients received up to 7.5 109
`111In-labeled Tcells, and imaging was done using a gamma camera at intervals
`followingTcell transfer. A, representative image of four transfers that were done
`withTcells that received a single stimulation with OKT3. B, representative image of
`three transfers that were done usingTcells that had received two stimulations with
`OKT3. Radioisotope signal was detected in lungs, liver, and spleen. Radiolabeled
`cells were preferentially retained in lungs of patients that received twice stimulated
`Tcells. C, anteroposterior image of the abdomen of patient 4 at 48 hours after
`receivingTcells in cycle 2 with evidence of Tcell localization to a peritoneal tumor
`(bottom) in addition to localization to liver (top).
`
`has been shown to correlate with response in mice and humans
`(27). To determine if anti-FR – transduced T cells trafficked to
`sites of ovarian cancer metastases, a proportion of T cells in
`cohort 1 were labeled with 111In before adoptive transfer, and
`imaging was done at intervals for up to 5 days later. Three
`patients received radiolabeled T cells during a single cycle of
`therapy, and another two patients received radiolabeled cells
`during two cycles (Table 3). Radiolabeled T cells accumulated
`initially in lung and subsequently in liver and spleen (Fig. 2A).
`Interestingly, T cells persisted longer in the lungs of patients
`who received T cells that had been subjected to relatively
`prolonged culture and restimulation in vitro. Restimulation
`was sometimes done to generate sufficient cell numbers for
`treatment. Restimulation consisted of a second round of
`
`upon coculture of nontransduced T cells with IGROV-1 cells
`(data not shown).
`Transduced T cells from all patients in cohort 2 also
`responded against their specific allogeneic stimulator PBMCs,
`although here again the level of IFN-g secreted varied between
`patients (603-5,625 pg/mL; Table 2). No correlation was
`observed between response against FR and allo PBMCs, with
`the anti-FR response sometimes greater than, and sometimes
`less than, the allo response. However, OKT3-induced IFN-g
`secretion was always greater than that induced by IGROV-1.
`Patient treatment details. Because hi