`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`Miltenyi Ex. 1048 Page 1
`
`

`

`IFFICIAL JOURNAL OF INTERNATIONAL SOCIETY
`OR BIOLOGICAL THERAPY OF CANCER
`
`VOL. 32, NO. 7, Sep'l:ember 2009
`
`IDITOR-IN-CHIEF
`iteven A. Rosenberg, M.D., Ph.D.
`lethesda, Maryland
`
`lSSOCIATE EDITORS
`rlichael B. Atkins, M.D.
`!atrick Hwn, M.D.
`llichael T. Lotze, M.D.
`rancesco Marincola, M.D.
`1UDes J. Mule, Ph.D.
`11cholas P. Restifo, M.D.
`
`iJITORIAL COORDINATOR
`[annah Lee
`~one: 215-253-3551
`ax: 215-220-3450
`nail: joumalofimmunotherapy@gmail.com
`
`iITERNATIONAL SOCIETY FOR BIOLOGICAL
`THERAPY OF CANCER
`1tra Withington, Executive Director
`55 E, Wells Street
`lth Floor
`[ilwaukee, WI 53202-3823
`:I: (414) 271-2456; fax: (414) 276-3349
`nail: info@isbtc.org
`
`ffiLICATION STAFF
`1tvid Myers, Publisher
`1Dathan Pine, Senior Executive Editor
`
`EDITORIAL BOARD
`Michael Atkins
`Richard Barth
`Ernest Borden
`Alfred Chang
`Robert 0. Dillman
`Mary L. Disis
`Janice P. Dutcher
`Alexander Eggermont
`Soldano Ferrone
`Bernard A. Fox
`Michael S. Gordon
`Ronald B. Herberman
`Peter Hersey
`Yutaka Kawakami
`Ulrich Keilholz
`Steven K. Libutti
`Albert F. LoBuglio
`Kim A. Margolin
`James Lee Murray
`Elizabeth A. Repasky
`Licia Rivoltini
`Pedro Romero
`Michael Salgaller
`Noriyuki Sato
`Carmen Scheibenbogen
`Craig L. Slingluff, Jr.
`Paul M. Sondel
`Mario Sznol
`WalterUrba
`Louis Weiner
`Christine A. White
`Jon M. Wigginton
`
`· advertising inquiries, please contact Sherry Reed at sherry.reed@wolterskluwer.com, 4I0-528:8553.
`
`Miltenyi Ex. 1048 Page 2
`
`

`

`Journal of lmmunotherapy
`
`Volume 32
`
`Number 7
`
`September 2009
`
`Contents
`
`Basic Studies
`
`677
`
`689
`
`703
`
`713
`
`726
`
`737
`
`High-a,idity Autoreactive CD4+ T Cells Induce Host CTL, Overcome Tregs
`and Mediate Tumor Destruction
`Andrew G. Brandmaier, Wolfgang W: Leitner, Sung P. Ha, John Sidney, Nicholas P. Restifo,
`and Christopher E. Touloukian
`
`Construction and Preclinical Evaluation of an Anti-CD19 Chimeric Antigen Receptor
`James N. Kochenderfer, Steven A. Feldman, Yangbing Zhao, Hui Xu, Mary A. Black,
`Richard A. Morgan, Wyndham IL Wilson, and Steven A. Rosenberg
`
`Effect of Yeast-derived [3-glucan in Conjunction With Bevacizumab for the Treatment
`of Human Lung Adenocarcinoma in Subcutaneous and Orthotopic Xenograft Models
`Wangjian Zhong, Richard Hansen, Bing Li, Yihua Cai, Carolin.a Salvador, Grace D. Moore,
`and Jun Yan
`
`Inhibition of Tumor Growth by Targeted Toxins in Mice is Dramatically Improved by
`Saponinum Album in a Synergistic Way
`Christopher Bachran, Horst Diirkop, Mark Sutherland, Diana Bachran, Christian Muller,
`Alexander Weng, Matthias F. Melzig, and Hendrik Fuchs
`
`Genetic Modification of T Cells With IL-21 Enhances Antigen Presentation
`and Generation of Central Memory Tumor-specific Cytotoxic T-lymphocytes
`Anjum S Kaka, Donald R. Shaffer, Ryan Hartmeier, Ann Af. Leen, An Lu, Adham Bear,
`Cliona M Rooney, ';Ind Aaron E. Foster
`
`Activated T-cell-mediated Immunotherapy With a Chimeric Receptor Against CD38 in
`B-cell Non-Hodgkin Lymphoma
`Keichiro Mihara, Kazuyoshi Yanagihara, Misato Takigahira, Chihaya Imai, Akira Kitanaka,
`Yoshihiro Takihara, and Akiro Kimura
`
`( continued next page)
`
`r!PPincott
`tyilliams & Wilkins
`Nolters Kluwer
`Health
`
`Journal of lmmunotherapy (ISSN: #1524-9557) is published nine times a year in January, February, April, May, June, July,
`September, October, and November by Lippincott Williams & Wilkins, 16522 Hunters Green Parkway, Hagerstown, MD 21740-
`2116. Business and production offices are located at 530 Walnut Street, Philadelphia, PA 19106-3621. Periodicals postage paid at
`Hagerstown, MD and at additional mailing offices. Copyright (Q 2009 by Lippincott Williams & Wilkins.
`Annual Subscription Rates: United States- $600 Individual, $1585 Institution, $282 In-training. Rest of World-$700 Individual,
`$1867 Institution. $296 In-training.
`copy rate $206. All prices include a handling charge. Subscriptions outside of North
`America must add $14 for airfreight
`United States residents of AL, CO, DC, FL. GA, HI, IA, ID, IN, KS, KY, LA, MD,
`MO, ND, NM, NV, PR, RI, SC, SD, UT, VT, WA, V./V add state sales tax. The GST tax of7% must be added to all orders shipped to
`Canada (Lippincott Williams & Wilkins' GST Identification #895524239, Publications Mail Agreement #616346. Subscription
`prices outside the United States must be prepaid. Prices subject to change without notice. Visit us online at www.lww.com.
`Website: www.irnmunotherapy-journal.com
`Postmaster: Send address changes to Journal of Immunotherapy, P.O. Box 1550, Hagerstown, MD 21740.
`
`Miltenyi Ex. 1048 Page 3
`
`

`

`Journal of lmmunotherapy • Volume 32, Number 7, September 2009
`
`Contents (continued)
`
`744
`
`A Novel Mouse Model for Evaluation and Prediction of HLA-A2-restricted
`CEA Cancer Vaccine Responses
`Antonella Conforti, Daniela Peruzzi, Patrizia Giannetti, Antonella Biondo, Gennaro Ciliberto,
`Nicola La Monica, and Luigi Aurisicchio
`
`Clinical Studies
`
`755
`
`765
`
`HSCT Recipients Have Specific Tolerance to MSC but not to the MSC Donor
`Mikael Sundin, A. John Barrett, Olle Ringden, Mehmet Uzunel, Helena Lonnies,
`Asa-Lena Dack/and, Birger Christensson, and Katarina Le Blanc
`
`Vaccination of Renal Cell Cancer Patients With Modified Vaccinia Ankara Delivering
`the Tumor Antigen 5T4 (TroVax) Alone or Administered in Combination With
`Interferon-ix (IFN-a): A Phase 2 Trial
`Robert J. Amato, William Shingler, Madusha Goonewardena, Jackie de Belin, Stuart Naylor,
`Jaros/aw Jae, James Willis, Somyata Saxena, Joan Hernandez-McClain, and Richard Harrop
`
`This journal is listed in Index Medicus/MEDLINE Current Contents/Life Sciences Scisearch,
`Biomedical Database, BJOSIS, EMBASE/Excerpta Medica, Chemical Abstracts, and Current Awamess in Biological Sciences.
`
`Address for non-member subscription information, orders, or change of address: Lippincott Williams & Wilkins, P.O. Box 1580, Hagerstown, MD 21741-1
`phone 800-638-3030 (outside the United States 301-223-2300); fax 301-223-2400. ln Japan, contact LWW Igaku-Shoin Ltd., 3-23-14 Hongo, Bunkyo-ku, T,
`113-0033; phone 81-3-5689-5400; fax 81-3-5689-5402. In Bru,)gladesh, India, Nepal, Sri Lanka, and Pakistan, contact Globe Publications Pvt. B-13 3rd F
`A Block, Shopping Complex, Naraina V!har, Ring Road,ffiw Delhi, 1 !0028; phone 91-11-579-3211; fax 91-11-579-8876.
`-~✓
`
`Lippincott Williams & Wilkins cannot beJielore;~onsible for errors or for any consequences arising from the use of the information contained in this journal.
`appearance of advertising in this joµmaf does not constitute an endorsement or approval by Lippincott Williams & Wilkins for the quality or value of the pre
`advertised or of the claims)yade for it by its manufacturer.
`
`PERMISSION TO PHOTOCOPY ARTICLES: This publication is protected by copyright. Permission to photocopy must be secured in writing f
`Permission Dept, Lippincott Williams & Wilkins, 351 West Camden Street, Baltimore, MD 21201, FAX: 410-528-8550; or Copyright Clearance Center (C
`222 Rosewood Dr., Danvers, MA 01923; FAX: 508-750-4470; or UMI, Box 49, 300 North Zeeb Road, Ann Arbor, MI 48106-1346; FAX: 313-761-1203.
`
`Article and issue photocopies and 16-mm microfilm, 35-mm microfilm, and 105-mm microfiche are available from UMI, 300 North Zeeb F
`Ann Arbor, MI 48106-1346.
`
`Miltenyi Ex. 1048 Page 4
`
`

`

`BASIC STUDY
`
`Construction ~nd Preclinical Evaluation of an Anti-CD19
`Chimeric Antigen Receptor
`
`James N. Kochenderfer,* Steven A. Feldman,* Yangbing Zhao,* Hui Xu,* Mary A. Black,*
`Richard A. Morgan,* Wyndham H. Wilson,t and Steven A. Rosenberg*
`
`Summary: T cells can be engineered to express the genes of
`chimeric antigen
`receptors
`(CARs)
`that
`recognize
`tumor(cid:173)
`associated antigens. We constructed and compared 2 CARs that
`contained a single chain variable region moiety that recognized
`CD19. One CAR contained the signaling moiety of the 4-IBB
`molecule and the other did not. We selected the CAR that did not
`contain the 4-IBB moiety for further preclinical development. We
`demonstrated that gammaretroviruses encoding this receptor could
`transduce human T cells. Anti-CD19-CAR-transduced cos+ and
`CD4+ T cells produced interferon-y and interleukin-2 specifically
`in response to CD19+ target cells. The transduced T cells
`specifically killed primary chronic lymphocytic leukemia (CLL}
`cells. We transduced T cells from CLL patients that had been
`previously treated with chemotherapy. We induced these T cells to
`proliferate sufficiently to provide enough cells for clinical adoptive
`T cell transfer with a protocol consisting of an initial stimulation
`with an anti-CD3 monoclonal antibody (OKT3) before trans(cid:173)
`duction followed by a second OKT3 stimulation 7 days after
`transduction. This protocol was successfully adapted for use in
`CLL patients with high peripheral blood leukemia cell counts by
`depleting CD19+ cells before the initial OKT3 stimulation. In
`preparation for a clinical trial that will enroll patients with
`advanced B cell malignancies, we generated a producer cell clone
`that produces retroviruses encoding the anti-CD19 CAR, and we
`produced sufficient retroviral supernatant for the proposed clinical
`trial under good manufacturing practice conditions.
`
`Key Words: chimeric antigen receptor, gene therapy, CDI9, T cell,
`gammaretrovirus, adoptive T cell therapy
`(J lmmunother 2009;32:689-702)
`
`Approximately 22,000 people die because of B cell
`
`malignancies each year in the United States. 1 Patients
`with some B cell malignancies
`including mantle cell
`lymphoma and chronic lympocytic leukemia (CLL) cannot
`be cured by therapies such as conventional chemotherapy
`and monoclonal antibodies,2•3 but some patients with these
`diseases can achieve prolonged disease-free survival after
`allogeneic stem cell
`transplantation.4-<i Unfortunately,
`
`Received for publication January 6, 2009; accepted April 21, 2009.
`From the •Surgery Branch of the National Cancer Institute; and
`tMetabolism Branch of the National Cancer Institute, National
`Institutes of Health, Bethesda, MD.
`This work was supported by intramural funding of the Center for
`Cancer Research, National Cancer Institute, NIH.
`Financial Disclosure: All authors have declared there are no financial
`conflicts of interest in regards to this work.
`Reprints: James N. Kochenderfer, Surgery Branch of the National
`Cancer Institute, NIH 10 Center Drive CRC Room 3-3888
`.Bethesda, MD 20892 (e-mail: kochendj@mail.nih.gov).
`Copyright © 2009 by Lippincott Williams & Wilkins
`
`allogeneic stem cell transplantation is limited by significant
`transplant-related mortality and a shortage of suitable
`donors. 2•6•7 In patients with B cell malignancies that relapse
`after allogeneic stem cell transplantation, infusion of
`allogeneic donor lymphocytes can induce remissions. 8- 10
`The effectiveness of these lymphocyte infusions provides a
`rationale for attempts to develop other cellular immuno(cid:173)
`therapies for B cell malignancies.
`Adoptive transfer of autologous T cells that are
`cultured from tumor infiltrating lympohocytes can cause
`regressions of advanced melanoma in humans. 11 •12 Because
`tumor-reactive T cells cannot be reliably cultured from
`most of human tumors, methods have been developed to
`engineer T cells to express genes encoding tumor antigen(cid:173)
`specific T cell receptors. 13•14 Adoptive transfer of these
`genetically modified T cells is a promising approach to
`cancer immunotherapy. 15 Another approach to adoptive
`T cell therapy is to engineer T cells to express chimeric
`antigen receptors (CARs). 16•17 CARs are made up of an
`antigen-recognizing receptor coupled to signaling molecules
`that can activate T cells expressing the CAR. 18- 20 The
`antigen-receptors most commonly incorporated into CARs
`are single chain variable region moieties (scFv) that consist
`of the light chain and heavy chain variable regions
`of a monoclonal antibody joined by a peptide linker.
`Murine models have shown that T cells transduced with
`retroviruses encoding CARs can protect mice from tumor
`challenges in vivo. 21 •22
`Our group has completed a phase I clinical trial in
`which patients with ovarian carcinoma were treated with
`T cells that were transduced with a CAR that was
`specific for
`the ovarian carcinoma-associated antigen
`ct-folate receptor. 23 No objective tumor regressions were
`seen. 23 The CAR used in this clinical trial incorporated the
`Fe receptor-y cytoplasmic signaling chain without any
`costimulatory molecules such as CD28 or 4-IBB. More
`recent work in mice has demonstrated that CARs contain(cid:173)
`ing the T cell receptor (TCR)-1; cytoplasmic signaling chain
`had superior in vitro function and in vivo antitumor efficacy
`than CARs containing the Fe receptor-y cytoplasmic
`signaling chain. 24 In addition, in vitro studies with human
`cells and murine
`in vivo studies have shown
`that
`incorporating the signaling domain of CD28 into CARs
`enhances function and in vivo antitumor efficacy. 22•25-27
`Signaling of the 4-1 BB costimulatory molecule has been
`shown to enhance T cell proliferation and persistence, 28•29
`and 4- I BB signaling enhanced the function of CARs in
`vitro. 30,31 Thus, significant advances in CAR design have
`occurred since our last clinical trial using CAR-transduced
`T cells.
`CD I 9 is a promising target for antigen-specific T cell
`therapies because CDl9 is expressed on most malignant
`
`J lmmunother • Volume 32, Number 7, September 2009
`
`www.immunotherapy-journal.com I 689
`
`Miltenyi Ex. 1048 Page 5
`
`

`

`Kochenderfer et al
`
`B cells, 32•33 and the only normal cells that express CD 19 are
`B cells and perhaps follicular dendritic cells. 33•34 Impor(cid:173)
`tantly, CD19 is not expressed on pluripotent hematopoietic
`stem cells. 35 Although destruction of normal B cells is a
`drawback to targeting CD19, destruction of normal B cells
`is well tolerated. In most patients that receive the widely
`the
`used anti-CD20 monoclonal antibody rituximab,
`number of normal peripheral blood B cells is severely
`depressed for several months, 36 yet patients that receive
`chemotherapy plus rituximab do not have an increased rate
`of infections when compared with patients that receive
`chemotherapy alone. 37 Finally, patients can be treated with
`intravenous infusions of IgG if necessary to increase IgG
`levels. 38
`We constructed 2 CARs that target CD19 and selected
`the one with the best in vitro function for further testing in
`preparation for a clinical trial. T cells that were transduced
`with gammaretroviruses encoding this CAR recognized
`in an antigen-specific manner
`CD 19-expressing cells
`and killed primary B cell CLL cells. We have optimized
`methods of T cell culture and transduction to generate
`highly active anti-CD19 CAR-expressing T cells from the
`blood of patients with CLL.
`
`MATERIALS AND METHODS
`Construction of the MSGV-FMC63-28Z and
`MSGV-FMC63-CD828BBZ Recombinant
`Retroviral Vectors
`The mouse stem cell virus-based splice-gag vector
`(MSGV)-FMC63-2SZ recombinant retroviral vector encodes
`the MSGV retroviral backbone and the FMC63-1SZ CAR.
`The FMC63-2SZ CAR consists of an anti-CD19 scFv that
`wa~ derived from the FMC63 mouse hybridoma, 39 a
`portion of the human CD2S ·molecule, and the intracellular
`component of the human TCR-~ molecule. The exact
`sequence of the CD2S molecule included in the FMC63-2SZ
`CAR corresponds to Genbank identifier NM_006139. The
`sequence includes all amino acids starting with the amino
`acid sequence IEVMYPPPY and continuing all the way
`to the carboxy-terminus of the protein. To encode the
`anti-CD19 scFv component of the vector, we designed a
`DNA sequence which was based on a portion of a
`previously published CAR. 40 This sequence encodes the
`following components in frame from the 5' end to the
`3' end: an XhoI site, the human granulocyte-macrophage
`colony-stimulating factor receptor ~-chain signal sequence,
`the FMC63 light chain variable region, 39 a linker peptide, 40
`the FMC63 heavy chain variable region, 39 and a Notl site.
`This sequence was synthesized by GeneArt AG (Regensburg,
`Germany), and a plasmid encoding this sequence was
`digested with XhoI and Notl (New England Biolabs). To
`form the MSGV-FMC63-2SZ retroviral vector, the XhoI
`and Natl-digested fragment encoding the FMC63 scFv was
`ligated into a second XhoI and Natl-digested fragment that
`encoded the MSGV retroviral backbone 14 as well as part of
`the extracellular portion of human CD2S, the entire
`transmembrane and cytoplasmic portion of human CD2S,
`the cytoplasmic portion of the human TCR-~
`and
`molecule. 41
`We also designed a second recombinant retroviral
`vector called MSGV-FMC63-CDS2SBBZ that consists of
`the following components in order from 5' to 3': the MSGV
`retroviral backbone, the FMC63 scFv, the hinge and
`
`690 I www.immunotherapy-journal.com
`
`J lmmunother • Volume 32, Number 7, September 2009
`
`transmembrane regions of the CDS molecule, the cytoplasmic
`the cytoplasmic
`portions of CD2S and 4- lBB, and
`component of the TCR-~ molecule. MSGV-FMC63-
`CDS2SBBZ was constructed using a multistep strategy.
`A fragment encoding the CDS, CD2S, 4-lBB, and TCR-~
`components was generated using an overlapping polymerase
`chain reaction (PCR) method42 using the following primers:
`1. Notl-CDSF: 5' -acgGCGGCCGCA ttcgtgccggtcttcctgc-3';
`2. 2Scyto-CDSR: 5'- gcctgctcctcttactcctgttcctgtggttgcagta
`aag-3';
`3. CDS-2ScytoF: 5'- ctttactgcaaccacaggaacaggagtaagaggag
`caggc-3';
`4. BamHI-zetaR: 5'- ttat GGATCC ttagcgagggggcagggcc-3'.
`The Notl-CDSF and 2Scyto-CDSR oligonucleotide
`primers were used to generate a PCR product that encoded
`the hinge and transmembrane region of CDS by using human
`CDS~ cDNA as a template. An overlapping fragment
`encoding the cytoplasmic portions of CD2S, 4-1 BB, and
`TCR-~ components in the order of CD2S-4-1BB-CD3~
`was generated using forward primer CDS-2ScytoF and
`the BamHI-zetaR reverse primer. The 2 PCR products were
`combined and the full-length construct generated using
`the Notl-CDSF and the BamHI-zetaR primers. DNA
`encoding this full-length construct and DNA encoding the
`into the MSGV retroviral
`FMC63 scFv were ligated
`backbone to form the MSGV-FMC63-CDS2SBBZ retro(cid:173)
`viral vector.
`the SP6 scFv43 was kindly
`A plasmid encoding
`provided by Z. Eshhar. This scFv was cloned into the
`MSGV retroviral vector along with a portion of the CD2S
`gene and the gene for cytoplasmic portion of the CD3~
`the MSGV-SP6-2SZ plasmid. This
`to form
`molecule
`plasmid encoded a receptor that is referred to as SP6-2SZ
`in this paper. The SP6-2SZ receptor recognizes the hapten
`2, 4, 6-trinitrobertzenesulfonic acid and served as a negative
`·
`control.
`
`Culture Media
`T cells were always cultured in T cell medium
`which consisted of AIM V medium plus 5% AB (blood
`type AB) serum (Gemini Bioproducts, Woodland, CA),
`100 U /mL penicillin, 100-µg/mL streptomycin, and 1.25 µg/
`mL amphotericin B. Rl0 medium consisted of Roswell
`Park Memorial Institute 1640 medium plus 10% fetal
`bovine serum (FBS), 100 U/mL penicillin, 100 µg/mL
`streptomycin and 2 mM L-glutamine. D 10 medium con(cid:173)
`sisted of Dubecco Modified Eagle Medium, 10% FBS,
`100 U /mL penicillin, 100 µg/mL streptomycin, nonessential
`amino acids, and 2 mM L-glutamine. SupB I 5 medium
`consisted of Iscove Modified Dulbecco's Medium plus
`20% FBS, 100 U /mL penicillin, 100 µg/mL streptomycin,
`2 mM L-glutamine, and 0.055 mM 2-mercaptoethanol.
`Cytotoxicity medium was phenol red-free Roswell Park
`Memorial Institute medium plus 5% AB (blood type AB)
`serum (Gemini Bioproducts), 100 U/mL penicillin, and
`100 µg/mL streptomycin. All cell culture media ingredients
`except the AB (blood type AB) serum were from Invitrogen
`(Carlsbad, CA). Recombinant human interleukin (IL)-2
`was obtained from Chin;m (Emeryville, CA).
`Transient Retrovirus Production
`To transiently produce retroviruses, 293GP packaging
`cells44 were transfected with either the MSGV-FMC63-2SZ
`plasmid, the MSGV-FMC63-CDS2SBBZ plasmid, or the
`MSGV-SP6-2SZ plas~id along with a plasmid encoding
`
`© 2009 Lippincott Williams & Wilkins
`
`Miltenyi Ex. 1048 Page 6
`
`

`

`J lmmunother • Volume 32, Number 7, September 2009
`
`Construction and Evaluation of an Anti-CD/ 9 CAR
`
`the RD 114 envelope protein45 using Lipofectamine 2000
`(lnvitrogen). The transfected cells were incubated at 37°C
`for 6 to 8 hours in DI0 medium without antibiotics. The
`medium used for transfection was then replaced with fresh
`D10 medium and the cells were incubated for another
`36 to 48 hours. During and after transfection, the 293GP
`cells were cultured on poly-n-lysine coated dishes (BD
`Biosciences, San Jose, CA). Supernatant containing retro(cid:173)
`viruses was removed from the dishes and centrifuged to
`remove cellular debris. The supernatant was snap frozen
`on dry ice and stored at - 80°C. Transiently produced
`retroviruses were us~d in the experiments described in
`
`Figures l and 2 and in Table 1. In addition, all retroviruses
`encoding the SP6-28Z CAR were produced transiently.
`
`Generation of the MSGV-FMC63-28Z PG 13
`Producer Cell Clone, H3
`PG 13 packaging cell clones were generated using
`the PG I 3 gibbon ape leukemia virus packaging cell line
`(A TCC, Manassass, VA), and
`the human ecotropic
`packaging cell line, Phoenix Ecotropics (kindly provided
`by Gary Nolan, Stanford University, Stanford, CA). All
`cells were cultured in D 10 medium without antibiotics.
`Cells were maintained at 37°C and 5% CO2•
`
`A
`
`8
`
`C
`
`D
`
`E
`
`FMC63 single chain Fv
`
`CD28 TCR-1;
`
`Isotype
`
`0.01
`
`Anti-Fab
`
`0.10
`
`...
`
`CDJ
`Isotype
`
`o.oo
`
`o.o
`
`0.22
`
`(DJ
`Anti-Fab
`
`19.3
`
`CDJ
`
`o.oo
`
`CDJ
`Anti-Fab
`
`0.2
`
`0.03
`
`II
`
`C. a J!!
`
`3
`
`(DJ
`CDJ
`FIGURE 1. A comparison of the design and transduction efficiency of 2 anti-CD19 chimeric antigen receptors. A, A diagram of the
`recombinant retroviral vector MSGV-FMC63-28Z is shown (LTR, long terminal repeat; Fv, variable regions; CD28, part of the
`extracellular region and all of the transmembrane and intracellular regions of CD28; TCR-1;, the entire cytoplasmic region of the TCR-~
`molecule). B, A diagram of the recombinant retroviral vector MSGV-FMC63-CD828BBZ is shown (LTR, long terminal repeat; Fv, variable
`regions; CDS, CDS hinge region; CD28, CD28 cytoplasmic region; 4-1 BB, 4-1 BB cytoplasmic region; TCR-~ the cytoplasmic region of
`the TCR-~ molecule. C, PBMC were started in culture with OKT3 and IL-2 on day 0. The cells were transduced with retroviruses encoding
`FMC63-28Z on days 2 and 3. On day 8, expression of FMC63-28Z was detected on 45% of T cells when the cells were stained with anti(cid:173)
`Fab antibodies and anti-CD 3. Staining with isotype-matched control antibodies and anti-CD3 is also shown. D, A PBMC culture from the
`same donor as in (C) was initiated on day 0. Cells were transduced with retroviruses encoding FMC63-CD828BBZ on days 2 and 3, and
`stained with either anti-Fab antibodies or isotype-matched control antibodies on day 8 in the same manner as in (C). Expression of
`FMC63-CD828BBZ was detected on 19% of T cells. E, A PBMC culture from the same donor as in (C) and (D) was initiated on day 0. The
`cells were not transduced. On day 8 the cells were stained with either anti-Fab or isotype-matched control antibodies in the same
`manner as in (C) and (D). This.experiment was performed using cells from the same cultures that were tested in the experiments
`described in Table 1 and Figure 2. The results presented in (C), (D), and (E) are representative of 6 experiments that used cells from 6
`different donors. MSGV indicates mouse stem cell virus-based splice-gag vector; PBMC, Peripheral blood mononuclear cell; TCR, T cell
`receptor.
`
`© 2009 Lippincott Williams & Wilkins
`
`www.immunotherapy-journal.com I 691
`
`l
`
`Miltenyi Ex. 1048 Page 7
`
`

`

`Kochenderfer et al
`
`J lmmunother • Volume 32, Number 7, September 2009
`
`A
`
`FMC63-28Z-transduced
`NGFR-K562
`
`CD19-K562
`
`5.73
`
`48.45
`
`U.18
`
`FMC63-CD828BBZ-transduced
`NGFR-K562
`CD19-K562
`
`3.37
`
`3.01
`
`19.61
`
`U.UB
`
`0.2
`
`CDS
`
`CDS
`
`B
`
`FMC63-28Z-transduced
`NGFR-K562
`
`CD19-K562
`
`FMC63-CD828BBZ-transduced
`NGFR-K562
`CD19-K562
`
`U.86
`
`2.
`
`a.11
`
`U.1
`
`1
`
`N
`
`~
`
`..
`J
`.....
`••,: :•• .:
`
`.
`~ :-·
`:!! ~•1.·
`
`•
`
`. I
`
`•
`
`FIGURE 2. A comparison of cytokine production by T cells transduced with different anti-CDl 9 chimeric antigen receptors. Peripheral
`blood mononuclear cell cultures were initiated on day O and transduced on days 2 and 3 after culture initiation. On day 11 after the
`cultures were initiated, cells that were transduced with either FMC63-28Z or FMC63-CD828BBZ were stimulated with either
`CDl 9-K562 cells or NGFR-K562 cells for 5 hours and intracellular staining for IFNy (A) and IL-2 (B) was performed. The transduced
`T cells produced IFNy and IL-2 in a CDl 9-specific manner. The plots are gated on CD3+ lymphocytes, and the percentage of cells in each
`quadrant is shown on the plots. This experiment was performed using cells from the same cultures that were tested in the experiments
`described in Figur_e 1 and Table 1. This experiment is representative of 6 experiments that used cells from 6 different donors.
`added to each well followed by centrifugation (2000 x g) at
`32°C for 3 hours. After centrifugation, supernatant was
`removed and 5 x 105 PG13 cells were added to each well,
`and the plates were centrifuged (1000 g) for 10 minutes at
`32°C. The transduction was repeated the next day, and then
`PG 13 producer cell clones were generated by limiting
`dilution cloning. Owing to lack of a selectable marker, high
`titer clones were identified by RNA dot blot as described
`previously. 14,46 Retroviral supernatant from the 6 highest
`titer clones was generated. Briefly, 175 cm2 tissue culture
`
`A PG 13 retroviral producer cell clone was generated as
`described previously 14 with the following changes. Phoenix
`Ecotropic cells were transfected with 9 µg of plasmid DNA
`(MSGV-FMC63-28) using the Lipofectamine 2000 trans(cid:173)
`fection reagent (Invitrogen). After 48 hour, supernatant
`was harvested and used to transduce retroviral packaging
`cell line, PGl3. Nontissue culture treated 6-well plates were
`coated with 20 µg/mL recombinant fibronectin fragment
`(RetroNectin) as described by the manufacturer (Takara,
`Madison, WI). Retroviral vector supernatant (4mL) was
`
`TABLE 1. Interferon y Enzyme Linked lmmunosorbent Assay Comparing FMC63-28Z and FMC63-CD828BBZ
`CD19-Targets
`CD19+Targets
`A549
`SupB15
`
`bv173
`
`CLL
`
`MDA231
`
`CCRF-CEM Effectors Alone
`
`Effector cells
`7
`10
`30
`2970
`301
`6150
`17450
`FMC63-28Z
`7
`20
`7
`640
`15
`2700
`13500
`FMC63-CD828BBZ
`8
`15
`6
`16
`57
`17
`118
`Nontransduced
`100,000 effector cells were cultured overnight with 100,000 target cells, and an interferon-y ELISA was performed. Effector cells were T cells that were
`transduced with the FMC63-28Z CAR, T cells that were transduced with the FMC63-CD828BBZ CAR, or nontransduced T cells from the same donor that
`were cultured in the same manner. This assay was performed on day 8 after initiation of cultures. Transductions were performed on day 2 and day 3 after
`culture initiation. All values are pg/mL of IFN-y (mean of duplicate wells). CLL refers to primary CLL cells. These data are representative of the results
`obtained in 2 separate experiments with cells from 2 different donors. The cells used in this experiment were from the same cultures used in the experiments
`reported in Figures 1 and 2.
`Bold values indicate specific recognition of CD 19-expressing target cells.
`
`692 I www.immunotherapy-journal.com
`
`© 2009 Lippincott Williams & Wilkins
`
`Miltenyi Ex. 1048 Page 8
`
`

`

`J lmmunother • Volume 32, Number 7, September 2009
`
`Construction and Evaluation of an Anti-CD] 9 CAR
`
`flasks (Nunc, Cole-Parmer, Vernon Hills, IL) were seeded
`at 4 x 104 cells/cm2. A medium exchange (30 mL) was
`performed on day 3. Supernatant was harvested 24-hour
`later and aliquoted. The supernatant was stored at - 80°C
`until further use. Supernatant from each clone was
`evaluated by transducing T cells as described below
`under "Retroviral Transductions" and measuring CAR
`expression on the surface of transduced T cells as described
`below under "CAR Detection on Transduced T cells". The
`ability of the transduced T cells to produce interferony
`(IFNy) in a CD19-specific manner was measured in an
`enzyme-linked immunosorbent assay (ELISA). One clone,
`which was designated H3, was selected for production of a
`master cell bank and subsequent production of retroviral
`supernatant under Good Manufacturing Practice (GMP)
`conditions.
`
`MSGV-FMC63-28Z Retrovirus Production Using
`PG13 Producer Cell Clone H3 Under GMP
`Conditions
`A total of 26 1700 cm2 expanded surface roller bottles
`were seeded on day 0 at a cell density of 4 x 104 clone
`H3 cells/cm2 in 200mL of Dl0 medium. On day 3, the
`medium was exchanged and replaced with 120mL DlO
`medium. Medium containing the retroviral vector was
`harvested daily with bottles being refed with 120 mL of
`medium. Glucose levels were monitored daily using Roche's
`Accu-check system (Roche, Basal, Switzerland). If glucose
`levels dropped below 2 g/L, the volume of the medium
`exchange was doubled to 240mL/roller bottle for all
`subsequent harvests. All harvests were aliquoted and stored
`at - 80°C until further use. All clinical products were
`subjected to an extensive biosafety testing program m
`accordance with current regulatory guidelines. 47- 50
`
`Patient Samples and Cell Lines
`Nonleukemic peripheral blood mononuclear cell
`(PBMC) samples were obtained from melanoma patients
`that were enrolled on institutional review board-approved
`protocols in the Surgery Branch of the National Cancer
`Institute. Leukemic PBMC were obtained from patients
`with CLL that were enrolled on National Cancer Institute
`protocol number 1997-C-0! 78. PBMC were cryopreserved
`in 90% FBS plus JO¾ dimethyl sulfoxide (Sigma, St Louis,
`MO). The following CD19-expressing immortalized cell
`lines were used: bv 173 ( chronic myeloid leukemia in
`lymphoid blast crisis, a kind gift of Dr A. Wiestner
`National Heart Lung and Blood Institute, Bethesda,
`MD), NALM-6 (acute lymphoid leukemia from DSMZ,
`Braunschweig, Germany), SupB15
`[acute
`lymphoid
`leukemia from American Type Culture Collection (A TCC),
`Manassass, VA], and Toledo (B cell diffuse large cell
`lymphoma from A TCC). The following CD 19 - cell lines
`were used: A549 (lung carcinoma, from ATCC), CCRF(cid:173)
`CEM (T cell leukemia from A TCC), K562 ( chronic myeloid
`leukemia from A TCC), MDA23 l (breast carcinoma from
`ATCC), TC71 (Ewing sarcoma, a kind gift of Dr M. Tsokos,
`National Cancer Institute, Bethesda, MD), and 624
`(melanoma, derived in Surgery Branch, National Cancer
`Institute). All cell lines were maintained in RIO medium
`except for SupB15. SupB15 was cultured in SupB15
`medium. When CLL PBMC were used as targets in assays,
`the cells were cultured in RIO medium for 12 to 18 hours
`before the assay.
`
`T Cell Culture
`PBMC were thawed and washed once in T cell
`medium. PBMC were suspended at a concentration of
`I x I 06 cell/mL in T cell medium containing 50 ng/mL
`of the anti-CD3 monoclonal antibody OKT3 (Ortho,
`Bridgewater, NJ) and 300 IU /mL of IL-2. Twenty micro(cid:173)
`liters of this suspension were added to 75 cm2 culture flasks
`(Corning, Corning, NY). The flasks were cultured upright
`at 37°C and 5% CO2• This method of T cell stimulation in
`which OKT3 was added directly to media is referred to as
`solubilized OKT3 and was used for the initial stimulation
`of PBMC in all experiments repor