Volume 40 Number 2
`
`February 1985
`
`iCell
`
` Miltenyi Ex. 1009 Page 1
`
`Miltenyi Ex. 1009 Page 1
`
`

`

`Cell
`
`Editor
`Benjamin Lewin
`
`European Editor
`Peter W. J. Rigby
`
`Reviews Editor
`Paula A. Kiberstis
`
`Senior Staff Editor
`Genevieve Maclellan
`
`Staff Editors
`Vicki Hengen
`Michelle Hoffman
`
`Editorial Assistant
`Elizabeth Salvucci
`
`Advertising l\~anager
`BethAnn Rosner
`
`Associate Editors
`Sidney Altman
`Michael Ashburner
`Richard Axel
`Piet Borst
`Jeremy Brockes
`George Brownlee
`Nicholas Cozzarelli
`Igor Dawid
`Gary Felsenfeld
`Werner Franke
`Joe Goldstein
`Thomas Graf
`Tony Hunter
`Richard Hynes
`George Khoury
`Marc Kirschner
`Jan Klein
`Ron Laskey
`Peter Lawrence
`Elias Lazarides
`Nicole Le Douarin
`Anthony Mahowald
`Tom Maniatis
`
`Howard Nash
`Kim Nasmyth
`Mary Osborn
`William Paul
`Robert Perry
`Charles Radding
`Martin Raff
`James Rothman
`Joe Sambrook
`Walter Schaffner
`Robert Schimke
`Phillip Sharp
`David Sherratt
`Frank Solomon
`George Stark
`Peter Starlinger
`Joan Steitz
`George Vande Woude
`Harold Varmus
`Harold Weintraub
`Robin Weiss
`Irving Weissman
`Charles Weissmann
`William Wood
`
`Editorial Office
`Cell
`292 Main Street
`Cambridge, Massachusetts 02142
`USA
`617-253-2890
`Telex 314765
`
`European Office
`Cancer Research Campaign
`Eukaryotic Molecular Genetics Group
`Department of Biochemistry
`Imperial College of Science
`and Technology
`London SW? 2AZ, England
`01-584-9913
`
`Cell is published monthly from January to November and twice monthly in December by The MIT Press, Cambridge, Mas(cid:173)
`sachusetts, and London, England. Subscriptions are available by the calendar year. The order rate direct from the pub(cid:173)
`lisher is $225 (USA and Canada) or $245 (elsewhere) for 1985 (volumes 40-43). Back issue rates for 1982-1984 are availa(cid:173)
`ble on request. Subscription correspondence should be addressed to: The MIT Press Journals Department, 28 Carleton
`Street, Cambridge, Massachusetts 02142 (617-253-2889).
`
`A charge of $35 per page is made for publication. Inability to pay will not influence decisions on acceptance, and authors
`unable to meet this charge should make the reason known upon publication. Copyright © 1985 by the Massachusetts
`Institute of Technology. Second class postage paid at Boston, Massachusetts, and additional mailing offices. Postmaster:
`send address changes to Cell (ISSN 0092-8674), 28 Carleton Street, Cambridge, Massachusetts 02142.
`
`Miltenyi Ex. 1009 Page 2
`
`

`

`Volume 40 Number 2 February 1985
`
`Cell
`
`Commentary
`Molecular Development: Is There
`a Light Burning in the Hall?
`
`Minireview
`mRNA Cap Binding Proteins: Essential
`Factors for Initiating Translation
`
`Review
`T Cell Antigen Receptors and the
`lmmunoglobulin Supergene Family
`
`Book Reviews
`A Retrospective Look at the Problem
`of Antibody Diversity
`Little Light Shed on Photosynthesis
`Little Things That Develop
`Books Received
`
`Articles
`
`The Isolation and Sequence of the Gene
`Encoding TS: A Molecule Defining Functional
`Classes of T Lymphocytes
`
`Cell Surface Expression of an In Vitro
`Recombinant Class II/Class I Major
`Histocompatibility Complex Gene Product
`
`Structure, Organization, and Somatic
`Rearrangement of T Cell Gamma Genes
`
`Developmentally Controlled and Tissue-Specific
`Expression of Unrearranged VH Gene Segments
`
`D. A. Littman, Y. Thomas,
`P J. Maddon, L. Chess,
`and A. Axel
`
`J. McCluskey, A. N. Germain,
`and D. H. Margulies
`
`A. C. Hayday, H. Saito, S. D. Gillies,
`D. M. Kranz, G. Tanigawa,
`H. N. Eisen, and S. Tonegawa
`
`G. D. Yancopoulos and F. W. Alt
`
`A Single Rearrangement Event Generates Most of
`the Chicken lmmunoglobulin Light Chain Diversity
`
`C.-A. Reynaud, V. Anquez,
`A. Dahan, and J.-C. Weill
`
`Role of Chromosomal Rearrangement in
`N. gonorrhoeae Pilus Phase Variation
`
`Menkes' Disease: Abnormal Metallothionein
`Gene Regulation in Response to Copper
`
`Effects of Temperature and Single-Stranded DNA
`on the Interaction of an RNA Polymerase Ill
`Transcription Factor with a tRNA Gene
`
`E. Segal, E. Billyard, M. So,
`S. Storzbach, and T. F. Meyer
`
`A. Leone, G. N. Pavlakis,
`and D. H. Hamer
`
`D. J. Stillman, P Caspers,
`and E. P Geiduschek
`
`P A. Lawrence
`
`221
`
`A. J. Shatkin
`
`223-224 __ /
`
`L. Hood, M. Kronenberg
`and T. Hunkapiller
`
`E. S. Golub
`
`A. C. Prince
`
`W. F. Loomis
`
`225-229
`
`231-232
`
`232-233
`
`233-234
`
`234-235
`
`237-246
`
`247-257
`
`259-269
`
`271-281
`
`283-291
`
`293-300
`
`301-309
`
`311-317
`
`(continued)
`
`Miltenyi Ex. 1009 Page 3
`
`

`

`Genetically Separable Functional Elements
`Mediate the Optimal Expression and Stringent
`Regulation of a Bacterial tRNA Gene
`
`Molecular Genetics of the achaete-scute
`Gene Complex of D. melanogaster
`
`Sex-Specific Regulation of Yolk Protein
`Gene Expression in Drosophila
`
`Remote Regulatory Sequences of the
`Drosophila Glue Gene sgs3 as Revealed by
`P-Element Transformation
`
`DNA Repair in an Active Gene: Removal of
`Pyrimidine Dimers from the DHFR Gene of
`CHO Cells Is Much More Efficient than
`in the Genome Overall
`
`The Tetrahymena rRNA lntron Self-Splices in
`E. coli: In Vivo Evidence for the Importance
`of Key Base-Paired Regions of RNA for RNA
`Enzyme Function
`
`Mitotic Stability of Yeast Chromosomes: A
`Colony Color Assay That Measures Nondisjunction
`and Chromosome Loss
`
`Genetic Analysis of the Mitotic Transmission
`of Minichromosomes
`
`Phenotypic Analysis of Temperature-Sensitive
`Yeast Actin Mutants
`
`5-Azacytidine Permits Gene Activation in a
`Previously Noninducible Cell Type
`
`Cell Migration Pathway in the Intestinal
`Epithelium: An In Situ Marker System Using
`Mouse Aggregation Chimeras
`
`Fusion Mutants of the Influenza Virus
`Hemagglutinin Glycoprotein
`
`S. Campuzano, L. Carramolino,
`C. V. Cabrera, M. Rufz-G6mez, R. Villares,
`A. Boronat, and J. Modolell
`
`J. M. Belote, A. M. Handler,
`M. F. Wolfner, K. J. Livak, and B. S. Baker
`
`M. Bourouis and G. Richards
`
`V. A. Bohr, C. A. Smith,
`D. S. Okumoto, and P. C. Hanawalt
`
`R. B. Waring, J. A. Ray,
`S. W. Edwards, C. Scazzocchio,
`and R. W. Davies
`
`P Hieter, C. Mann, M. Snyder,
`and R. W. Davis
`
`D. Koshland, J. C. Kent,
`and L. H. Hartwell
`
`P Novick and D. Botstein
`
`C.-P Chiu and H. M. Blau
`
`G. H. Schmidt, M. M. Wilkinson,
`and B. A. J. Ponder
`
`R. S. Daniels, J. C. Downie, A. J. Hay,
`M. Knossow, J. J. Skehel, M. L. Wang,
`and D. C. Wiley
`
`Cellular Site and Mode of Fv-2 Gene Action
`
`R. R. Behringer and M. J. Dewey
`
`Movement of Organelles Along Filaments
`Dissociated from the Axoplasm of the Squid
`Giant Axon
`
`R. D. Vale, B. J. Schnapp,
`T. S. Reese, and M. P Sheetz
`
`Single Microtubules from Squid Axoplasm
`Support Bidirectional Movement of Organelles
`
`B. J. Schnapp, R. D. Vale,
`M. P Sheetz, and T. S. Reese
`
`A. I. Lamond and A. A. Travers
`
`319-326
`
`327-338
`
`339-348
`
`349-357
`
`359-369
`
`371-380
`
`381-392
`
`393-403
`
`405-416
`
`417-424
`
`425-429
`
`431-439
`
`441-447
`
`449-454
`
`455-462
`
`(continued)
`
`Miltenyi Ex. 1009 Page 4
`
`

`

`Attachment of Terminal N-Acetylglucosamine to
`Asparagine-Linked Oligosaccharides Occurs
`in Central Cisternae of the Golgi Stack
`
`Letter to the Editor
`Correction: Apparent Alteration in Properties
`of Ari Mutants of E. coli
`
`W. G. Dunphy, R. Brands,
`and J. E. Rothman
`
`463-472
`
`J. B. Hays and B. E. Korba
`
`473
`
`Positions Available
`
`Announcements
`
`Directory of Advertisers
`
`The cover shows (in stereo) single amino acid substi(cid:173)
`tutions that alter the membrane fusion activity of the
`influenza hemagglutinin. For details see the article by
`Daniels et al. in this issue. (The figure was produced
`by Hydra, a graphics program written by Rod
`Hubbard.)
`
`Miltenyi Ex. 1009 Page 5
`
`

`

`Cell, Vol. 40, 237-246, February 1985, Copyright © 1985 by MIT
`
`0092-8674/85/020237-10 $02.00/0
`
`The Isolation and Sequence of the
`Gene Encoding TS: A Molecule Defining
`Functional Classes of T Lymphocytes
`
`Dan R. Littman,* Yolene Thomas, t
`Paul J. Maddon,+ Leonard Chess,t
`and Richard Axel*
`* Howard Hughes Medical Institute
`Columbia University
`t Department of Medicine
`:j: Department of Biochemistry
`College of Physicians and Surgeons
`Columbia University
`New York, New York 10032
`
`Summary
`
`The T cell surface glycoproteins T4 and TB are thought
`to mediate efficient cell-cell interactions in the im(cid:173)
`mune system and in this way may be responsible for
`the appropriate targeting of subpopulations of T cells.
`We have used gene transfer combined with subtrac(cid:173)
`tive hybridization to isolate both cDNA and functional
`genomic clones encoding the TB protein. The se(cid:173)
`quence of the cDNA reveals that TB is a transmem(cid:173)
`brane protein with an N-terminal domain which shares
`significant homology to immunoglobulin variable re(cid:173)
`gion light chains. This immunoglobulin-like structure
`is likely to be important in the function of TB during
`differentiation and in the course of the immune re(cid:173)
`sponse.
`
`Introduction
`
`During development thymocytes begin to express specific
`surface proteins that participate in both recognition and
`effector functions on the mature T lymphocyte. Analysis of
`these surface proteins indicates that T cells segregate into
`one of two classes: those that express the surface gly(cid:173)
`coprotein T4 and those that express the glycoprotein T8
`(Reinherz and Schlossman, 1980). This segregation oc(cid:173)
`curs late in intrathymic development, for immature thymo(cid:173)
`cytes express both T4 and T8 on their surfaces (Reinherz
`et al., 1980). In the periphery, the T4 molecule is largely
`expressed on helper T cells and T8 is expressed on cyto(cid:173)
`toxic and suppressor T cells, although T4+ killer and sup(cid:173)
`pressor cells have been identified (Thomas et al., 1981;
`Meuer et al., 1982). A more stringent relationship exists
`between T4 and TB cells and the histocompatibility pro(cid:173)
`teins of the target cells with which T cells interact. T4-
`positive T cells interact with target cells expressing class
`II MHC gene products, while TS-positive cells interact
`solely with targets expressing class I MHC molecules
`(Krensky et al., 1982; Swain, 1983; Engleman et al.,
`1981b; Biddison et al., 1982).
`These observations suggest that the specificity of inter(cid:173)
`action of subpopulations of T cells with different targets
`may result from the direct interaction of T4 and T8 with the
`products of different MHC genes. Monoclonal antibodies
`directed against T4 or T8 (or against the murine homologs,
`
`L3T4 and Lyt2) inhibit specific T cell function in vitro and
`appear to do so by diminishing the strength of interaction
`of the T cell with its target (Engleman et al., 1981a; Swain,
`1981; Landegren et al., 1982; Biddison et al., 1984; Mar(cid:173)
`rack et al., 1983). Thus the presumed interaction between
`T4 and T8 and the MHC proteins may be essential for T
`cell function.
`The elucidation of the structure of these surface pro(cid:173)
`teins and of their role in T cell-target cell interactions will
`be facilitated by the isolation of the genes that encode
`them and by the subsequent ability to manipulate their ex(cid:173)
`pression in different cell types. We have therefore used
`gene transfer and subtractive hybridization to isolate
`cDNA and functional genomic clones encoding the T8
`glycoprotein. The sequence of the cDNA clones indicates
`that T8 is a transmembrane protein with an N-terminal do(cid:173)
`main that has striking homology to the immunoglobulin
`variable region light chain family. This structural relation(cid:173)
`ship with the immunoglobulin superfamily may have sig(cid:173)
`nificant implications regarding the function of the T8
`glycoprotein in T cell differentiation and in cell-cell inter(cid:173)
`actions.
`
`Results
`
`Experimental Strategy
`The approach we used to isolate the T8 gene initially in(cid:173)
`volved gene transfer to generate mouse L cell cotransfor(cid:173)
`mants expressing T8 on their surface. cDNA synthesized
`from the mRNA of these transformants was hybridized to
`a vast excess of mRNA from nontransformed L cells,
`generating a cDNA probe enriched for those sequences
`introduced into the L cell via gene transfer.
`This probe, highly enriched for T8 sequences, was used
`to screen a library of cDNA clones prepared from the
`mRNA of human peripheral T cells. The identities of cDNA
`clones obtained in this manner were verified by hybridiza(cid:173)
`tion to mRNA from TS-positive and TS-negative cells and,
`ultimately, by the isolation of a functional T8 gene from a
`library of human chromosomal DNA.
`
`Isolation of Cotransformed L Cells Expressing
`T Cell Antigens
`We have previously demonstrated that tk· mouse L cells
`transformed to the tk+ phenotype integrate other physi(cid:173)
`cally unlinked DNA sequences at high frequency (Wigler
`et al., 1979). In a typical transformation containing 100 ng
`of pTK, along with 20 µg of human genomic DNA, a tk+
`transformant can be expected to contain approximately
`103 kb of human DNA linked to the tk gene in a single,
`contiguous, integrated unit (Wigler et al., 1978; Perucho et
`al., 1980). Since the human genome contains about 3 x
`106 kb, then any human gene capable of being expressed
`in an L cell should be expressed in 1 out of 3000 transfor(cid:173)
`mants. To obtain cotransformants expressing T cell sur(cid:173)
`face markers, L cells were exposed to 100 ng of pTK, along
`with 20 µg of DNA from the T cell leukemia OT-CLL (Fried-
`
`Miltenyi Ex. 1009 Page 6
`
`

`

`ljJ
`
`0 0
`
`0
`
`0
`0
`
`Q
`
`Cell
`238
`
`..
`
`...
`
`Xl
`
`0
`
`cP>
`w O
`
`0
`
`'> -~ o,
`
`0 • 0
`
`0
`
`0
`
`0 •
`
`. (
`0 0,
`.,
`
`0
`
`,
`
`(
`
`< .
`
`A B C D E F G H
`
`I J K L M N
`
`-
`
`ABCDEFGH I J KLMN
`
`-
`
`+ 2-ME
`
`-2-ME
`
`92k-
`
`68k-
`
`43k-
`
`26k-
`
`92k-
`
`68k -
`
`43k -
`
`26k-
`
`Figure 1. Microscopic View of Rosetted TB· L Cells
`T8-tk7 cells were mixed with rs- cells and plated out at low density. The
`rosetting assay was performed after 2 weeks with monoclonal antibody
`OKT-8. A TB· colony and its satellites are shown adjacent to a TB·
`colony Magnification: 40x.
`
`man et al., 1982). After 12 days of HAT selection, approxi(cid:173)
`mately 1000 to 2000 independent tk· colonies were pres(cid:173)
`ent on each of twenty 10 cm plates.
`Colonies expressing human T cell antigens were de(cid:173)
`tected immunologically using an in situ rosetting assay
`that permits the rapid identification of a single positive
`clone amid the thousands of colonies in a dish. Tk' colo(cid:173)
`nies were first incubated with mouse monoclonal antibod(cid:173)
`ies directed against TB. The culture dish was washed free
`of antibody and then exposed to human red blood cells
`coated with rabbit anti-mouse immunoglobulin. The ac(cid:173)
`cumulation of significant numbers of red cells on positive
`clones allowed visualization of these clones with the na(cid:173)
`ked eye. A microscopic view of one such clone is shown
`in Figure 1. The frequency of T8' colonies obtained by
`rosetting was approximately 1 in 5000. Colonies positive
`with a single monoclonal antibody also screen positive
`with other antibodies for distinct epitopes on the T8
`molecules. We have also used the DNA of primary T8'
`transformants as donor to construct a series of secondary
`transformants expressing T8. These colonies were cloned
`and continued to express the T8 antigen stably. In no in(cid:173)
`stance have we observed a rosette-positive clone in cells
`transformed in the absence of human DNA.
`We also screened these transformations for a variety of
`T cell antigens including T1 , T4, T9, and T11 and observed
`
`Figure 2. lmmunoprecipitation of TB from Transformed L Cells
`'"I-labeled cell surface proteins from peripheral T cells (lanes A, H),
`TB' L cell prlmary (B, C, I, J) and secondary (D-F, K-M) transformants,
`and 18· L cells (G, N) were precipitated with OKTB monoclonal anti·
`body (A-G) or with control anti·HLA monoclonal antibody (H-N). The
`proteins were electrophoretically separated in a 10% SDS- polyacryla·
`mide get. Lanes Band I, LT9; C and J, LT10; D and K, TB-tk7; E and
`L. TB-tk2; F and M, TB-AT3. The samples were separated under reduc(cid:173)
`ing (top) and nonreducing (bottom) conditions. Molecular weights in
`kilodaltons are Indicated on the left.
`
`that these antigens are stably expressed by transformed
`L cells at a frequency from 1 in 10,000 to 1 in 20,000. It is
`of interest that although the original donor DNA was de(cid:173)
`rived from a leukemia cell line expressing T4, but not T8,
`this DNA was capable of generating TS-positive transfor(cid:173)
`mants.
`
`lmmunoprecipitation of TS from Transformed L Cells
`To demonstrate that transformed colonies positive in the
`rosetting assay express the T8 protein, we chemically la(cid:173)
`beled the cell surface proteins of several TB' transfor(cid:173)
`mants with 1251 and compared the immunoprecipitated
`proteins with those of peripheral T cells. Under reducing
`conditions (Figure 2, top), a 34 kd glycoprotein present in
`T cells {lane A) is precipitated with anti-T8 in all rs· L cell
`clones (lanes 8-F). This protein is not immunoprecipi(cid:173)
`tated in control L cells (lane G). Under nonreducing condi(cid:173)
`tions (Figure 2, bottom), a 68 kd homodimer, as well as
`multimeric forms, is immunoprecipitated with anti-TB in T
`cells and in the transformed L cells. These bands are ab(cid:173)
`sent in control immunoprecipitates with anti-HLA. These
`
`Miltenyi Ex. 1009 Page 7
`
`

`

`Isolation and Sequence of TS
`239
`
`ABCDEFGH
`
`JK
`
`-28S
`
`-18S
`
`' '
`
`Figure 3. Northern Blot Analysis of RNA from TS· and rs· L Cells and
`Human Cells
`Three micrograms (lanes A.B,D-H) or 0.3 i,Q (lane C) of poly(A)' RNA
`or 12 1'9 ot total RNA (lanes 1- K) was separated on a 0.S% formalde(cid:173)
`hyde-agarose gel. blotted onto GeneScreen (New England Nuclear),
`and hybridized to nick-translated pTS.B cDNA insert. Lane A, untrans(cid:173)
`formed L cells: lane B, LTD-4 L cells (T4· TB·): lane C, T8-tk7 L cells:
`lane D. Hela cells; lane E. human neuroblastoma cells: lane F. SK-7
`T cell t,ybridoma (T4'T8· ): lane G, OT-CLL leukemia (T4·TS·); lane H,
`fro 2.2 leukemia (T4·TB'); lane I, T4-enriched peripheral T cells; lane
`J , TB-enri ched periphera.1 T cells: lane K, human thymocytes.
`
`results indicate that the TS gene is expressed in these
`rosette-positive Lcells, and that its product is inserted into
`the membrane as a homodimer consisting of individual 34
`kd components, as observed for this gene product in pe(cid:173)
`ripheral T cells.
`
`Isolation of TS cDNA Clones
`In initial experiments, we attempted to isolate the TS gene
`from the DNA of secondary transformants by assuming
`that this gene. like most human genes, would be closely
`linked to one member or the human Alu family of se(cid:173)
`quences. TS sequences would therefore be readily identi(cid:173)
`fied by the isolation of Alu-positive clones from a library
`of transformed cell DNA (Gusella et al , 1980). In Southern
`blotting experiments, however, we were disappointed to
`observe that some of the TS secondary transform ants con(cid:173)
`tained no Alu sequences whatsoever. Furthermore, among
`those transformants that did contain Alu sequences, no
`common bands were observed. These results suggested
`that the TS gene may be present In a statistically rare re(cid:173)
`gion of the genome relatively free of Alu-like sequences.
`We proceeded to isolate TS cDNA clones by the tech(cid:173)
`nique of subtractive hybridization. Surface radioiodination
`and flow cytometry indicated that one clone, T8-Tk7, ex(cid:173)
`pressed significantly more TS than did all other transfor(cid:173)
`mants (Figure 2, lane D). 32P-labeled cDNA was prepared
`from poly(A)" RNA of this cell line and was hybridized to
`a vast excess of poly(A)· RNA from untransformed L cells.
`using the procedure of Davis et al. (1984). Single-stranded
`cDNA incapable of hybridizing to L cell RNA was isolated
`by hydroxyapatite chromatogrc1phy, and this enriched
`cDNA was then used to screen a human peripheral T cell
`cDNA library prepared in >.gt10. In a screen of 40,000
`cDNA clones, 15 positives were identified with the en-
`
`riched probe and were plaque-purified. All positive clones
`shared homologous sequences, and one of these clones,
`pT8.B, was characterized further to determine whether it
`encoded a portion of the T8 gene.
`The 1.95 kb pT8.B cDNA was first used to probe RNAs
`from a variety of TS· and rs- lymphocytes and L cells on
`a Northern blot (Figure 3). This clone hybridizes to a 2.4
`kb RNA present in the RNAs from T8.:fk7 cells (lane C),
`but not in RNAs from untransformed L cells or from the T4-
`positive L cells (lanes A, B). This cDNA clone therefore en(cid:173)
`codes an RNA species that is expressed in the TS-positive
`L cell used to prepare the enriched probe. In addition, this
`2.4 kb RNA is present in RNAs from TS-enriched periph(cid:173)
`eral T cells. human thymocytes, and a TS-positive T cell
`leukemia, Fro 2.2 (lanes J, K, H). No hybridizing RNA is
`present in two T4-positive human T cell leukemias (lanes
`F, G), in TS-depleted peripheral T cells (lane I), or in Hela
`and neuroblastoma cells (lanes D, E). The expression of
`the 2.4 kb RNA detected by pT8.B is therefore restricted to
`TS· cells.
`Southern blotting experiments were performed to dern•
`onstrate that sequences homologous to this cDNA clone
`were present in human DNA as well as in primary and sec(cid:173)
`ondary TS-transformed mouse cells, but not in untrans(cid:173)
`formed mouse cell DNA. A variety of human and mouse
`L cell DNAs were digested with the enzyme Eco RI and
`analyzed by genomic blotting using pTB.B as a probe (Fig(cid:173)
`ure 4). This cDNA clone identifies Eco RI fragments of 5
`kb and 7.3 kb in human DNA from a variety ot lymphoid
`and non lymphoid sources (lanes H- P). Hybridizing bands
`are also seen in TS' primary (lanes B-O), secondary
`(lanes E, F), and tertiary (lane G) transformants. The varia(cid:173)
`tion in the size of these bands in transformed cells is due
`to DNA breaks incurred in the transformation process.
`DNA from L cells transformed with the T4 gene shows no
`hybridizing bands (lane A). Thus pT8.B is homologous to
`a human sequence present only in mouse cells trans(cid:173)
`formed to the TS' phenotype. It is of interest that while T8-
`tk7 expresses at least a 50-fold higher level of TB protein
`and mRNA than the other TB transformants, this is accom(cid:173)
`panied by an amplification of the TS gene of no more than
`3 to 5 fold (lane F). In this respect, our result differs from
`that of Kavathas and Herzenberg (1983), who found am(cid:173)
`plification of the TS gene on double minute chromosomes
`in their L cell transformants.
`
`Isolation of a Functional TS Gene
`A human genomic library prepared in the .l phage Charon
`4A (Maniatis et al., 1978) was then screened with pT8.B,
`and positive clones were isolated and characterized by re(cid:173)
`striction mapping, blotting, and transformation. The re(cid:173)
`striction map of one such clone, HM1 , is shown in Figure
`5B. The 5 kb and 7.3 kb Eco RI fragments detected in the
`genomic blotting experiments are both present in this
`clone.
`The DNA from HM1 was then used in gene transfer ex(cid:173)
`periments to test whether it was capable of transforming
`L cells to the TS' phenotype at high frequency. Tk- L cells
`were transformed with 1 µg of ATM1 DNA, along wlth 100
`ng of pTK, and HAT-resistant colonies were examined for
`
`Miltenyi Ex. 1009 Page 8
`
`

`

`Cell
`240
`
`ABCDEFGH JKL MN OP
`
`-•
`
`·-·· .. ---
`
`•
`
`23
`-
`9.4
`-
`- 6 . 6
`
`- 4 . 4
`
`- 2 .3
`- 2 . 0
`
`Figure 4. Southern Blot of TS.:rransformed L
`Cells and Human T, B, and Nonlymphoid Cells
`Cellular DNAs were digested with Eco RI,
`separated on a 0.8% agarose gel, and probed
`with the pT8.B cDNA insert. lane A: LTD-4.
`Lanes 8 - 0 : primary TB transformants LT9,
`LT10, and LT13. Lanes E, F: secondary TB trans(cid:173)
`formants T8-tk2. T8-lk7, lane G: tertiary TB
`transformant TB-3. Lanes H-K: human T cell
`lines Jurkatt, Of.CLL, 86, and RPMl-8602.
`Lanes L, M: human B cell lines CB and GV.
`Lane N: HeLa cells. Lane 0 : human colonic
`carcinoma. Lane P: human neuroblastoma
`IMR-32 .
`
`•
`
`-
`
`0.6
`
`the expression of TS on their surface. Using both
`cytofluorometry and in situ rosetting analysis, we ob(cid:173)
`served that approximately 30% of tk· colonies cotrans(cid:173)
`formed with HM1 expressed the TS' phenotype. This Is i n
`contrast to a frequency of TS expression of 1 in 5000 when
`total human genomic DNA is used as donor. We have
`further analyzed the TS molecules expressed in trans(cid:173)
`formants obtained following transfer with HM1 DNA by
`surface radioiodination and subsequent immunoprecipi(cid:173)
`tation (Figure 6). This experiment demonstrates that these
`transformants express the 34 kd TS molecule (lanes A, B),
`which is also expressed in peripheral T cells (lane E) but
`not in T4-positive L cells (lane D). These observations con(cid:173)
`firm that the clone HM1 contains the entire sequence of
`the TS structural gene, along with sequences permitting
`its expression in L cells.
`
`Sequence of the TS cDNA and Protein
`The complete coding sequence of the TB gene was ob(cid:173)
`tained by sequencing both strands of the pTS.B cDNA
`clone as well as the 5' end of the full-length clone, pT8.F1,
`which was obtained by probing a cDNA library prepared
`from the T cell leukemia Fro 2.2 with pTS.B. The restriction
`maps of these clones and the strategy used in sequencing
`them are shown in Figure SA, and the DNA sequence and
`the predicted protein sequence are illustrated in Figure
`7A. A signal peptide of 21 residues is followed by a se(cid:173)
`quence that corresponds exactly to the 22 N-terminal
`residues recently obtained by Snow et al. (1984), The se(cid:173)
`quence of the first 113 amino acid residues of the mature
`protein shows striking homology to sequences of light
`chain variable regions. In the sequence alignment shown
`in Figure 7B, there are 29 residues within the first 104
`residues of T8 that match with Vx, In particular, Cys 22 and
`Cys 94 of T8 are in regions of very significant homology
`to light chain variable regions and correspond to Cys 23
`
`and Cys 88, which form an intrachain disulfide bond in
`kappa and lambda light chains. The sequence compari(cid:173)
`son indicates that 10 of the 18 invariant residues of varia(cid:173)
`ble region light chains are conserved in corresponding po(cid:173)
`sitions in TS (Kabat et al. , 1983). Significant homology is
`also found between residues 78-94 of TS and 70-86 of
`mouse Thy-1 (Figure 78; Williams and Gagnon, 1982).
`Statistical analysis according to Doolittle (1981} indicates
`that the homologies between TS and variable region light
`chains are 8-9.5 standard deviations away from chance
`scores.
`The lg-like domain of TS is followed by a stretch of 48
`amino acid residues and by a putative membrane-span(cid:173)
`ning sequence of 25 nonpolar residues. The proposed cy(cid:173)
`toplasmic C-terminal domain consists of a highly charged
`sequence of 28 amino acids. The complete protein, minus
`the signal peptide, thus consists of 214 amino acid resi(cid:173)
`dues and has a molecular weight of 23,550. The TS glyco(cid:173)
`protein migrates with an apparent molecular weight of
`32,000-34,000 on SDS-polyacrylamide gels. It therefore
`appears that there must be a fair amount of glycosylation
`to account for this size difference. The sequence of TS in(cid:173)
`dicates that there is a single residue, Asn 28, which is a
`candidate for N-linked glycosylation. Snow and Terhorst
`(1983), however, found TB to be resistant to endoglycosi(cid:173)
`dase F, suggesting that only O-linked glycosylation is
`present. Moreover, treatment of the TS molecule with the
`reagent trifluoromethane sulfonic acid (TFMS), Which hy(cid:173)
`drolyzes glycosidic linkages on glycoproteins, reduced
`the apparent molecular weight of TS by only 2000 (Snow
`et al. 1985b}. To verify independently the molecular weight
`that we deduced from the nucleotide sequence, we in(cid:173)
`serted the full-length cDNA pT8.F1 into the RNA expres(cid:173)
`sion vector SP6 (Zinn et al., 1983). RNA was synthesized
`and translated in vitro, and a single protein product of 24
`kd was generated (data not shown). Thus sequence analy-
`
`Miltenyi Ex. 1009 Page 9
`
`

`

`Isolation and Sequence of T8
`241
`
`A
`pT88
`
`,.,v~
`<F'
`~~
`.r.,.'r' ___ i,,, __ , ___ .Li
`c5'
`
`:;,
`
`.._,, ...,
`,.,v
`,.,«r-
`~
`,.._.;
`s'
`_1...j_J(LV---1j..l.(L( _«r-_ _ _lj ___ !1__---1!_ 3 1
`"
`0
`_
`
`,.,«r-,._,....,
`,,,o ,.:. o"~,.:,
`
`"-r
`-..."
`
`B
`
`O
`
`O
`"'"
`
`0 ~ 0
`
`0
`
`0
`
`fl ~ ~
`~~
`~ ~ "-, $',._,
`~
`A '<,t,
`'<,c. 45'
`~ 4Y <tJ
`..... 1 _ _ \ ..... V __ ~,--~' ~I - - - - - ~'-'~----1~
`~rco -+-Q
`~1-L.1 _ _
`5'
`
`oO
`
`"-
`
`3'
`
`-0 . IKb
`-I Kb
`
`Figure 5. Restriction Maps of T8 cONA and Genomic Clones and Strategy for the cONA Sequencing
`(A),Maps of the cDNA clones pT8.B and pT8.F1. Shaded regions correspond to the coding sequence. The arrows beneath each map correspond
`10 the regions that were subctoned into M13 and sequenced. (B) Map of the .U-M1 genomic clone used for transfection studies.
`
`A
`
`8
`
`C
`
`D
`
`E
`
`9 2 -
`6 8 -
`
`4 3 -
`
`2 6 -
`
`18 -
`
`-
`
`Figure 6. lmmunoprecipitation of T8 from L Cells Transformed with the
`TB Genomic Clone .cTM1
`'"I-labeled cell surface proteins from two independent L cell clones
`cotransformed with pTK and .\TM1 (lanes A. B), T8-tk7 cells (C). LT0-4
`cells (0), and penpheral human T cells (E) were precipitated with the
`monoclonal antibody OKT-8. The precipitates were analyzed on a
`100/o SDS-polyacrylamlde gel under reducing conditions. Molecular
`weights in kilodaltons are marked on the left.
`
`sis of one clone and in vitro translation of another clone
`both indicate that the size of the unprocessed T8 precur(cid:173)
`sor is 25 kd. The discrepancy between our results and
`those of Snow and Terhorst is probably attributable to re(cid:173)
`sistance of the T8 glycoprotein to treatment with en(cid:173)
`doglycosidase F and/or TFMS.
`In addition to the two cysteines that are postulated to
`form an intramolecular disulfide bond, there are cysteines
`
`present at positions 33, 143, 160, 172, 185, 194, and 196.
`Since formation of interchain disulfide bonds requires
`only the membrane-spanning cyanogen bromide frag(cid:173)
`ment of T8 (Snow and Terhorst, 1983), only those residues
`beyond Met 82 are likely to be involved in such covalent
`linkage. Since T8 is found not only as a homodimer but
`also as a multimer and as a heterodimer/hetero-oligomer
`with the T6 glycoprotein in the thymus (Snow et al.,
`1985a), more than one of these cysteine residues is likely
`to be involved in interchain disulfide bond formation.
`A partial sequence of the 7.3 kb Eco RI genomic frag(cid:173)
`ment of T8 has allowed us to assign the intron-exon
`boundaries within the coding region of the T8 gene (Fig(cid:173)
`ure 7A, arrowheads). The genomic organization of T8 is
`similar to that of the other genes within the large immuno(cid:173)
`globulin superfamily. The signal peptide, the individual
`immunoglobulin-like domain, the membrane-spanning re(cid:173)
`gion, and the cytoplasmic tail are each encoded by indi(cid:173)
`vidual exons.
`
`Discussion
`
`Peripheral T lymphocytes recognize foreign antigens in
`association with MHC gene products on the surface of
`stimulating and target cells (Zinkernagel and Doherty,
`1979). Recognition of diverse foreign antigens requires
`that at least one component of the T cell surface be highly
`polymorphic. This recognition function is likely to be car(cid:173)
`ried out by the T cell antigen receptor (Kappler et al., 1983;
`Acuto et al., 1983). The T cell, however, expresses other
`nonpolymorphic surface proteins that have been i mpli-
`
`Miltenyi Ex. 1009 Page 10
`
`

`

`Cell
`242
`
`A
`
`-10
`-20
`m2t ala leu pro val thr ala leu leu leu pro leu ala
`'ITG CX CTG CCG CTG GCC 104
`CGGCTCCCGCGCCGCereccereGCGCCCGAGCITCGAGCCAAGCAGCGTCCTGGGGAGCGCGTC ATG GCC TIA CCA GI'G ACC GCC
`
`*
`+20
`+10
`+l
`-1
`leu leu leu his ala ala arg pro ser gln phe arg val ser pro leu asp arg thr trp asn leu gly glu thr val glu leu lys cys
`'ITG CTG ere CAC GCC GCC AGG CCG AGC CAG 'ITC CGG GI'G TCG CCG CTG GAT CGG ACC TGG AAC CTG GGC GAG ACA GI'G GAG CTG AAG TGC 194
`.A.
`+50
`+40
`+30
`CHO
`gln val leu leu ser asn pro thr ser gly cys ser trp leu phe gln pro arg gly ala ala ala ser pro thr phe leu leu tyr leu
`'ITC ere CTA TAC ere 284
`CAG GI'G CTG CTG TCC AAC CCG ACG TCG GGC TGC TCG TGG ere 'ITC CAG CCG CGC GGC GCC GCC GCC AGJ' CCC II.CC
`~o
`~o
`+~
`ser gln asn lys pro lys ala ala glu gly leu asp thr gln arg phe ser gly lys arg leu gly asp thr phe val leu thr leu ser
`TCC CAA AAC AAG CCC AAG GCG GCC GAG GGG CTG GAC ACC CAG CGG 'ITC TCG GGC AAG AGG 'ITG GGG GAC ACC