Downloaded from
`
`http://cshprotocols.cshlp.org/
` on March 10, 2022 - Published by
`
` Cold Spring Harbor Laboratory Press
`
`Protocol
`
`Illumina Sequencing Library Preparation for Highly Multiplexed
`Target Capture and Sequencing
`
`Matthias Meyer1 and Martin Kircher
`Max Planck Institute for Evolutionary Anthropology, D-04103 Leipzig, Germany
`
`[Supplemental Material is available online at www.cshprotocols.org/supplemental/.]
`
`INTRODUCTION
`
`The large amount of DNA sequence data generated by high-throughput sequencing technologies
`often allows multiple samples to be sequenced in parallel on a single sequencing run. This is particularly
`true if subsets of the genome are studied rather than complete genomes. In recent years, target capture
`from sequencing libraries has largely replaced polymerase chain reaction (PCR) as the preferred
`method of target enrichment. Parallelizing target capture and sequencing for multiple samples
`requires the incorporation of sample-specific barcodes into sequencing libraries, which is necessary to
`trace back the sample source of each sequence. This protocol describes a fast and reliable method for
`the preparation of barcoded (“indexed”) sequencing libraries for Illumina’s Genome Analyzer platform.
`The protocol avoids expensive commercial library preparation kits and can be performed in a 96-well
`plate setup using multi-channel pipettes, requiring not more than two or three days of lab work.
`Libraries can be prepared from any type of double-stranded DNA, even if present in
`subnanogram quantity.
`
`RELATED INFORMATION
`
`Illumina’s “indexing” system differs from other sample barcoding methods for high-throughput
`sequencing in that the barcodes (“indexes”) are placed within one of the adapters rather than being
`directly attached to the ends of template molecules (e.g., Craig et al. 2008; Meyer et al. 2008b). The
`barcode sequence is identified in a separate short sequencing read. This setup allows for a high degree
`of flexibility in experimental design, because libraries are first prepared with universal adapters and
`different indexes can repeatedly be added by amplification with tailed primers just before target capture
`or sequencing. The library preparation protocol described here (see Fig. 1 for an overview) is based
`on the general principle of library preparation originally developed for 454 sequencing (Margulies et
`al. 2005). By exchanging adapter sequences, removing and shortening several reaction steps, and
`introducing an amplification scheme, the protocol has been redesigned for rapid preparation of
`Illumina multiplex sequencing libraries using a 96-well plate format. In the example shown in Figure
`2, the protocol was used to simultaneously capture and sequence target regions from 50 human
`samples using microarrays (HA Burbano, E Hodges, RE Green, AW Briggs, J Krause, M Meyer, JM Good,
`T Maricic, PLF Johnson, Z Xuan, et al., in prep.).
`
`MATERIALS
`
`CAUTIONS AND RECIPES: Please see Appendices for appropriate handling of materials marked with <!>, and
`recipes for reagents marked with <R>.
`
`1Corresponding author (mmeyer@eva.mpg.de).
`Cite as: Cold Spring Harb Protoc; 2010; doi:10.1101/pdb.prot5448
`
`© 2010 Cold Spring Harbor Laboratory Press
`
`1
`
`www.cshprotocols.org
`
`Vol. 2010, Issue 6, June
`
`00001
`
`EX1024
`
`

`

`Downloaded from
`
`http://cshprotocols.cshlp.org/
` on March 10, 2022 - Published by
`
` Cold Spring Harbor Laboratory Press
`
`Reagents
`
`Agarose gel (2%) and reagents for agarose gel electrophoresis
`AMPure XP 60 mL Kit (Agencourt-Beckman Coulter A63881)
`ATP (100 mM) (Fermentas R0441)
`Bst DNA polymerase, large fragment (supplied with 10X ThermoPol reaction buffer) (New
`England BioLabs M0275S)
`DNA ladder (e.g., GeneRuler; Fermentas) (optional; see note before Step 6)
`For unknown reasons, ladders from New England BioLabs do not work for this purpose.
`dNTP mix (25 mM each) (Fermentas R1121)
`<R>EBT buffer
`Ethanol (70%, freshly prepared)
`H2O (HPLC grade)
`Illumina reagents for DNA sequencing (Illumina, Inc.)
`Cluster generation kit (e.g., GD-103-4001 [Standard Cluster Generation Kit v4], PE-203-4001
`[Paired-End Cluster Generation Kit v4])
`Multiplexing sequencing primer kit (PE-400-1002 [Multiplexing Sequencing Primers and PhiX
`Control Kit v1])
`Alternatively, the following primers may be used for sequencing:
`
`Read 1 Sequencing Primer: 5-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3
`
`Index Read Sequencing Primer: 5-GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-3
`
`Read 2 Sequencing Primer: 5-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3
`Sequencing kit (FC-104-4002 [36 Cycle Sequencing Kit v4])
`MinElute PCR Purification Kit (QIAGEN) (optional)
`<R>Oligo hybridization buffer (10X)
`Oligonucleotides (Sigma-Aldrich) (see Table 1)
`Phusion Hot Start High-Fidelity DNA Polymerase (New England BioLabs F-540L) (supplied with
`5X Phusion HF buffer)
`Positive control DNA (200- to 300-bp fragment, generated via PCR using unmodified primers
`and a polymerase with terminal transferase activity, e.g., Taq DNA polymerase) (200-500 ng)
`Sample DNA
`This protocol works reliably with as little as 100 pg and up to 1 µg of double-stranded sample DNA (e.g.,
`genomic DNA, long-range PCR products, or cDNA). The amount of starting material should be chosen so that
`the representation of target molecules in the final library is sufficient. The final yield of the library preparation
`process is ~10%-20%. Therefore, a library prepared from 1 ng of human genomic DNA (about 300 copies of
`the haploid genome), will contain 30 to 60 copies of the human genome.
`Standard for quantitative PCR (qPCR) (see Steps 21.i-21.ii)
`SYBR Green qPCR master mix (e.g., DyNAmo Flash SYBR Green qPCR Kit; New England BioLabs)
`Tango buffer (10X; Fermentas BY5)
`T4 DNA ligase (5 U/µL; Fermentas EL0011) (supplied with 10X T4 DNA ligase buffer and 50%
`PEG-4000 solution)
`T4 DNA polymerase (5 U/µL; Fermentas EP0062)
`T4 polynucleotide kinase (10 U/µL; Fermentas EK0032)
`<R>TET buffer
`Tween 20
`
`Equipment
`
`Centrifuge for 96-well plates
`DNA shearing device (e.g., Bioruptor UCD-200 [Diagenode]; Covaris E210 [Covaris Inc]) (for
`high-molecular-weight DNA; see Step 3)
`The Bioruptor UCD-200 can process 12 samples in parallel. Among the many alternative systems that are
`available for this step, the Covaris E210 system may be preferable, because it is compatible with the 96-well
`plate format.
`Equipment for agarose gel electrophoresis
`
`www.cshprotocols.org
`
`2
`
`Cold Spring Harbor Protocols
`
`00002
`
`

`

`Downloaded from
`
`http://cshprotocols.cshlp.org/
` on March 10, 2022 - Published by
`
` Cold Spring Harbor Laboratory Press
`
`Equipment and reagents for target capture from sequencing libraries (optional)
`Several systems are available; see e.g., Hodges et al. (2009) for a target capture approach using
`Agilent microarrays.
`
`Ice
`Multichannel pipettes
`Multichannel reagent basins (e.g., Thermo Scientific 9510027)
`PCR plates (96-well, 200-µL capacity) and strip caps
`Real-time PCR cycler (e.g., Mx3005P QPCR System; Agilent Technologies-Stratagene)
`Sequencing machine (Genome Analyzer II/IIx/IIe or HiSeq2000; Illumina)
`Spectrophotometer for DNA quantification (e.g., NanoDrop; Thermo Scientific)
`SPRIPlate 96R-Ring Super Magnet Plate (Agencourt-Beckman Coulter A32782)
`Thermal cycler
`Tubes (microcentrifuge, 0.5-mL)
`Tubes (PCR)
`Vortex mixers for tubes and 96-well plates
`
`METHOD
`
`The protocol can be interrupted after Steps 3, 12, 16, 19, 24, and 26 by freezing the DNA at −20°C. Up to 94 samples
`can be processed in parallel on a 96-well reaction plate; two wells should be reserved for a blank and a positive control.
`Seal each reaction plate with strip caps and centrifuge to 2000g in a plate centrifuge after setting up each reaction in
`order to collect the liquid in the bottom of the wells. This prevents cross-contamination while removing the caps.
`
`Preparation of Adapter Mix
`
`This step produces sufficient adapter mix for 200 reactions. The adapter mix can be used repeatedly and stored at −20°C
`before and after usage.
`
`1. Assemble the following hybridization reactions in separate PCR tubes:
`
`Reagent
`
`Volume (µL)
`
`Final concentration in 100-µL reaction
`
`200 µM
`200 µM
`1X
`
`Hybridization mix for adapter P5 (200 µM):
`IS1_adapter_P5.F (500 µM)
`40
`IS3_adapter_P5+P7.R (500 µM)
`40
`Oligo hybridization buffer (10X)
`10
`H2O
`10
`Hybridization mix for adapter P7 (200 µM):
`IS2_adapter_P7.F (500 µM)
`40
`IS3_adapter_P5+P7.R (500 µM)
`40
`Oligo hybridization buffer (10X)
`10
`H2O
`10
`2. Mix and incubate the reactions in a thermal cycler for 10 sec at 95°C, followed by a ramp from
`95°C to 12°C at a rate of 0.1°C/sec. Combine both reactions to obtain a ready-to-use adapter mix
`(100 µM each adapter).
`
`200 µM
`200 µM
`1X
`
`Fragmentation and Purification of Sample DNA
`
`This step in the method is not always required. Prior to library preparation, high-molecular-weight sample DNA must be
`sheared into fragments of suitable size for Illumina sequencing (<600 bp). If samples other than high-molecular-
`weight DNA are used (e.g., short PCR products, highly degraded DNA, or short double-stranded cDNA), fragmentation
`may not be necessary. Step 3 describes DNA shearing by sonication using the Bioruptor UCD-200.
`
`3. Shear the DNA as follows:
`i. Transfer the samples to 0.5-mL tubes, and add H2O to reach final volumes of 50 µL.
`
`www.cshprotocols.org
`
`3
`
`Cold Spring Harbor Protocols
`
`00003
`
`

`

`Downloaded from
`
`http://cshprotocols.cshlp.org/
` on March 10, 2022 - Published by
`
` Cold Spring Harbor Laboratory Press
`
`FIGURE 1. Schematic overview of the protocol and alternative amplification schemes. (A) Sample DNA is sheared into
`small fragments (not depicted). During blunt-end repair, overhanging 5- and 3-ends are filled in or removed by T4 DNA
`polymerase. 5-phosphates are attached using T4 polynucleotide kinase (Steps 1-13). Two different adapters, P5 and P7,
`are ligated to both ends of the molecules using T4 DNA ligase (Steps 14-16). Ligation is nondirectional and also produces
`molecules which have the same adapters attached to both ends (not depicted). Such molecules do not interfere with
`sequencing and—due to the formation of hairpin structures—amplify very poorly during indexing PCR. Since the
`adapters do not carry 5-phosphates, ligation joins only single strands. Nicks are removed in a fill-in reaction with Bst
`polymerase, which possesses strand-displacement activity (Steps 17-21). Indexes and full length adapter sequences are
`added by amplification with 5-tailed primers (Steps 22-26). Indexed libraries are pooled in equimolar ratio. The pool is
`ready for target capture and/or sequencing on one of Illumina’s sequencing platforms (Steps 27-28). Indexes are read in
`a separate sequencing read. Read 2, the paired end read, is optional. (B) Alternative amplification schemes can be used.
`Using the primers IS7 and IS8, libraries can be amplified prior to indexing. Using IS5 and IS6, single or pooled indexed
`libraries can be amplified, for example after target enrichment. (For color figure, see doi: 10.1101/pdb.prot5448 online
`at www.cshprotocols.org.)
`
`ii. Expose the DNA four times to sonication cycles of 7 min, using the energy setting “HIGH”
`and an “ON/OFF interval” of 30 sec. If liquid spills to the tube walls, shake it down to the
`bottom of the wells after each sonication cycle.
`This produces a fragment size distribution between 100 bp and 400 bp, with a mean around 200 bp.
`
`iii. Transfer the sheared DNA samples to a 96-well PCR plate.
`The fragment size distribution obtained from sonication is well-suited for sequencing. However, if a very
`narrow fragment size distribution is desired, the fragmented DNA may be separated on an agarose gel and
`isolated from a gel slice to obtain a more narrow distribution. In the example given in Figure 2, no gel
`excision was performed.
`
`www.cshprotocols.org
`
`4
`
`Cold Spring Harbor Protocols
`
`00004
`
`

`

`Downloaded from
`
`http://cshprotocols.cshlp.org/
` on March 10, 2022 - Published by
`
` Cold Spring Harbor Laboratory Press
`
`FIGURE 2. Example of a result from multiplex target capture and sequencing. Indexed libraries were prepared from 50
`human samples from the CEPH human genome diversity panel as described in this protocol. Shearing was performed
`using the Bioruptor with no subsequent gel excision (see Step 3). The pool of libraries was loaded on a million-feature
`array from Agilent to capture 12,871 targets from the human genome with an average size of 232 bp (overall 2.9 million
`bp), following the protocol of Hodges et al. (2009). The array eluate was amplified for 12 cycles using primers IS5 and
`IS6 and sequenced on 5 lanes of the Illumina flow cell (2 × 100 cycles + 6 cycles index read). Shown are the results
`from mapping the sequences against the human genome (A) and the distribution of sequences among samples (B).
`
`Blunt-End Repair
`If the sample DNA is not dissolved in H2O, Tris-Cl buffer (e.g., QIAGEN’s Buffer EB), or TE buffer, purify the DNA as
`described in Steps 6-13 prior to beginning Step 4. If the sample volume exceeds 50 µL, purification can be used for
`concentrating the DNA. We strongly recommend carrying a positive and a blank control through Steps 4-18 of the
`protocol. As a positive control, 200-500 ng of a purified PCR product with a discrete size of 200-300 bp may be used.
`The product should be generated using unmodified PCR primers and a polymerase with terminal transferase activity
`(e.g., Taq DNA polymerase).
`4. Add a blank control (50 µL of H2O) and a positive control to two empty wells of the reaction plate.
`Prepare a master mix as below for the required number of reactions. Mix carefully by flicking the
`tube with a finger. Avoid vortexing after addition of enzymes.
`
`Reagent
`
`Volume (µL) per sample
`
`Final concentration in 70-µL reaction
`
`H2O
`Buffer Tango (10X)
`dNTPs (25 mM each)
`ATP (100 mM)
`T4 polynucleotide kinase (10 U/µL)
`T4 DNA polymerase (5 U/µL)
`
`7.12
`7
`0.28
`0.7
`3.5
`1.4
`
`1X
`100 µM each
`1 mM
`0.5 U/ µL
`0.1 U/ µL
`
`5. Using a multichannel pipette, add 20 µL of master mix to 50 µL of sample. Mix and incubate in a
`thermal cycler for 15 min at 25°C followed by 5 min at 12°C. Place plate on ice or immediately
`proceed to the next step.
`
`Reaction Clean-Up Using Solid Phase Reversible Immobilization (SPRI)
`
`Carboxyl-coated magnetic beads (SPRI beads) are ideally suited for reaction purification in a 96-well plate setup.
`However, under the conditions described here, SPRI purification does not retain molecules shorter than 100-150 bp.
`The exact size cutoff may vary among different batches of beads. If retention of short molecules is desired, the size
`cutoff can be adjusted by varying the volume of SPRI bead/buffer suspension added to the sample. The appropriate
`ratio of SPRI suspension to sample volume can be empirically determined using a DNA ladder (e.g., GeneRuler ladders).
`If retention of very short molecules is desired (30-80 bp), all SPRI purification steps should be replaced by spin column
`purification using the MinElute PCR Purification Kit.
`
`www.cshprotocols.org
`
`5
`
`Cold Spring Harbor Protocols
`
`00005
`
`

`

`Downloaded from
`
`http://cshprotocols.cshlp.org/
` on March 10, 2022 - Published by
`
` Cold Spring Harbor Laboratory Press
`
`Table 1. Oligonucleotides and sequences
`
`Oligo ID
`
`Sequencea
`
`IS1_adapter.P5
`IS2_adapter.P7
`IS3_adapter.P5+P7
`IS4_indPCR.P5
`IS5_reamp.P5
`IS6_reamp.P7
`IS7_short_amp.P5
`IS8_short_amp.P7
`BO1.P5.F
`BO2.P5.R
`BO3.P7.part1.F
`BO4.P7.part1.R
`BO5.P7.part2.F
`BO6.P7.part2.R
`
`A*C*A*C*TCTTTCCCTACACGACGCTCTTCCG*A*T*C*T
`G*T*G*A*CTGGAGTTCAGACGTGTGCTCTTCCG*A*T*C*T
`A*G*A*T*CGGAA*G*A*G*C
`AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTT
`AATGATACGGCGACCACCGA
`CAAGCAGAAGACGGCATACGA
`ACACTCTTTCCCTACACGAC
`GTGACTGGAGTTCAGACGTGT
`AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-Pho
`AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT-Pho
`AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-Pho
`GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-Pho
`ATCTCGTATGCCGTCTTCTGCTTG-Pho
`CAAGCAGAAGACGGCATACGAGAT-Pho
`
`a5-3; * indicates a PTO bond; Pho indicates a 3-phosphate.
`See Supplemental Material (Indexing_Oligo_Sequences.doc) for indexing oligo sequences.
`All oligos (HPLC purified, 0.2 µmol synthesis scale) should be dissolved in TE or H2O. Oligos 1-3 should be
`dissolved to 500 µM, oligos BO1-BO6 to 200 µM, and all other oligos to 10 µM. The indexing oligos should be
`transferred to a 96-well plate to allow for multichannel pipetting. HPLC purification can potentially introduce
`cross-contamination among indexing oligos. It is therefore important to (1) instruct the company to properly
`wash the HPLC column before loading a new oligo and (2) synthesize the oligos in a different order than listed
`here. This makes sure that cross-contamination induced during synthesis can be detected after sequencing by
`the appearance of index sequences that were not used in the experiment. When designing index sequences,
`the following criteria were taken into account: (1) Index sequences differ by at least three substitutions. This
`reduces the chance of converting one index into another by sequencing and amplification errors. (2) Indexes
`cannot be converted into one another by deleting the first base, which is the only insertion/deletion error
`common with Illumina sequencing. (3) Index sequences do not contain three or more identical bases in a row
`to ensure that they can be differentiated from artifact sequences. (4) Stretches of bases illuminated with the
`same laser (ACA, CAC, GTG, and TGT) are avoided. Software for designing alternative index sequences, for
`example, with a length of 6 or 8 nt, and for selecting appropriate subsets for pooling is provided at
`http://bioinf.eva.mpg.de.
`
`6. Resuspend the stock solution of SPRI bead suspension (AMPure kit) by vortexing. To make subsequent
`pipetting easier, add Tween 20 to the bead suspension to a final concentration of 0.05% (i.e., add
`1 µL of Tween 20 to 2 mL of bead suspension).
`
`7. Add SPRI bead suspension to the reactions as follows:
`
`i. Add a 1.8-fold volume of SPRI bead suspension to each reaction (e.g., add 126 µL of SPRI
`beads to a 70-µL sample or 72 µL of SPRI beads to a 40-µL sample).
`
`ii. Seal the wells with caps and vortex for several seconds. Ensure the beads are properly
`suspended and repeat vortexing if necessary.
`
`iii. Let the plate stand for 5 min at room temperature.
`
`iv. Collect the liquid at the bottom of the wells by briefly centrifuging in a plate centrifuge
`to 2000g.
`
`8. Place the plate on a 96-well ring magnetic plate, and let it stand for 5 min to separate the beads
`from the solution. Pipette off and discard the supernatant without removing the beads.
`
`9. Leave the plate on the magnetic rack, and wash the beads by adding 150 µL of freshly prepared
`70% ethanol. Let stand for 1 min and remove the supernatant.
`
`10. Repeat Step 9.
`
`11. Using a multichannel pipette, remove residual traces of ethanol. Let the beads air-dry for 20 min
`at room temperature without caps.
`
`www.cshprotocols.org
`
`6
`
`Cold Spring Harbor Protocols
`
`00006
`
`

`

`Downloaded from
`
`http://cshprotocols.cshlp.org/
` on March 10, 2022 - Published by
`
` Cold Spring Harbor Laboratory Press
`
`12. Elute as follows:
`
`i. Add 20 µL of EBT to the wells and seal the plate with caps.
`
`ii. Remove the plate from the magnetic rack, and resuspend the beads by repeated vortexing.
`
`iii. Let stand for 1 min, and then collect the liquid in the bottom of the wells by briefly
`centrifuging the plate to 2000g.
`Occasionally the beads may appear clumpy after vortexing; this does not have a negative effect on DNA recovery.
`
`13. Place the plate back on the magnetic rack, let stand for 1 min, and transfer the supernatant to a
`new 96-well reaction plate.
`Carryover of small amounts of beads will not inhibit subsequent reactions.
`
`Adapter Ligation
`
`14. Prepare a master mix for the required number of ligation reactions as shown below. If white
`precipitate is present in the 10X DNA ligase buffer after thawing, warm the buffer to 37°C and
`vortex until the precipitate has dissolved. Since PEG is highly viscous, vortex the master mix before
`adding T4 DNA ligase and mix gently thereafter.
`
`Reagent
`
`Volume (µL) per sample
`
`Final concentration in 40-µL reaction
`
`H2O
`10
`1X
`4
`T4 DNA ligase buffer (10X)
`5%
`4
`PEG-4000 (50%)
`2.5 µM each
`1
`adapter mix from Step 2 (100 µM each)
`0.125 U /µL
`1
`T4 DNA ligase (5 U /µL)
`When starting from low template quantities (50 ng or less), the amount of adapter mix can be reduced to 0.2
`µL per reaction.
`
`15. Add 20 µL of master mix to each eluate from Step 13 to obtain reaction volumes of 40 µL. Mix
`and incubate for 30 min at 22°C in a thermal cycler.
`
`16. Perform reaction purification exactly as described in Steps 6-13. Elute in 20 µL of EBT.
`
`Adapter Fill-In
`
`17. Prepare a master mix for the required number of reactions.
`
`Reagent
`
`Volume (µL) per sample
`
`Final concentration in 40-µL reaction
`
`H2O
`ThermoPol reaction buffer (10X)
`dNTPs (25 mM each)
`Bst polymerase, large fragment (8 U/µL)
`
`14.1
`4
`0.4
`1.5
`
`1X
`250 µM each
`0.3 U/µL
`
`18. Add 20 µL of master mix to each eluate from Step 16 to obtain reaction volumes of 40 µL. Mix
`well and incubate in a thermal cycler for 20 min at 37°C.
`
`19. Perform reaction purification exactly as described in Steps 6-13. Elute the library in 20 µL of EBT.
`
`Library Characterization
`
`In addition to agarose gel electrophoresis (Step 20), performance of qPCR (Step 21) prior to indexing PCR (Steps 22-24)
`is strongly recommended, particularly if little sample DNA was used for library preparation. This is the only option to
`directly measure the number of molecules in the library. If the mean average fragment length and the size of the
`genome are known, this number can be used to determine whether the average coverage of genomic targets in the
`library is sufficiently high for subsequent target capture or direct sequencing. Step 21 describes a qPCR assay using
`SYBR Green (for more details, see Meyer et al. 2008a).
`
`20. To verify the success of the library preparation, load 10 µL of the positive control library side-by-
`side with 100 ng of the original positive control sample and a size marker on a 2% agarose gel and
`perform electrophoresis.
`If all enzymatic reactions worked properly, the band produced by the control library should be shifted upward by 67 bp.
`
`www.cshprotocols.org
`
`7
`
`Cold Spring Harbor Protocols
`
`00007
`
`

`

`Downloaded from
`
`http://cshprotocols.cshlp.org/
` on March 10, 2022 - Published by
`
` Cold Spring Harbor Laboratory Press
`
`See Troubleshooting.
`
`21. Measure the number of molecules by qPCR:
`
`i. Prepare a standard dilution series by incrementally diluting an indexed sequencing library
`of known molecular concentration 10-fold in TET buffer.
`
`ii.
`
`If no such library is available, amplify 0.5 µL of the positive control in an indexing PCR (see
`Step 22). Purify the PCR product as described in Steps 6-13, determine its mass concentration
`on a spectrophotometer, calculate the molecular concentration, and use it as a standard as
`described in Step 21.i.
`
`iii. In a real-time PCR machine, amplify in parallel 1 µL of each standard dilution and each
`sample using primer IS4 and one of the indexing oligos; we recommend using a commercial
`PCR master mix containing SYBR Green (e.g., DyNAmo Flash SYBR Green qPCR kit). Set the
`annealing temperature to 60°C, and otherwise follow the instructions provided by the
`manufacturers of the kit and the real-time PCR machine.
`The concentration of molecules in the blank library (adapter dimers) should be at least one order of
`magnitude lower than in the sample libraries.
`It is often necessary to measure dilutions of the samples (e.g., 1000-fold in EBT) to obtain values within the
`detection range of the qPCR system.
`
`Indexing PCR and Pooling
`
`To avoid a downstream failure of Illumina’s image analysis software, subsets of indexes must be chosen in a way that
`prevents unbalanced usage of the four nucleotides or the two laser channels during any cycle of index sequencing.
`The indexes provided with this protocol (see Supplemental Material [Indexing_Oligo_Sequences.doc]) are in an
`appropriate order to fulfill these requirements and should be used accordingly. For example, the first 22 indexes should
`be used if 22 indexes are needed. Fewer than four indexes should never be used in any experiment. Additional sets of
`indexes with different length and varying edit distance between indexes are provided on http://bioinf.eva.mpg.de. It
`will often not be necessary to use the entire library as template for indexing PCR. In this case, it is advisable to keep
`a backup that can be later used to add a different barcode to the sample.
`Note that Phusion polymerase has proofreading activity. If this property is not desired (e.g., if deoxyuracil is present in
`the template DNA), another polymerase can be chosen for indexing PCR.
`22. Prepare a PCR master mix for the required number of reactions. Dispense the master mix into a
`96-well reaction plate, and then add template DNA and a different indexing primer to each well
`using a multichannel pipette.
`
`Reagent
`
`Volume (µL) per sample
`
`Final concentration in 50-µL reaction
`
`37.1 − x
`10
`0.4
`1
`0.5
`
`Master mix:
`H2O
`Phusion HF buffer (5X)
`dNTPs (25 mM each)
`Primer IS4 (10 µM)
`Phusion Hot Start High-Fidelity DNA
`Polymerase (2 U/µL)
`Add separately to each well:
`1
`Indexing primer (10 µM)
`x
`Template DNA (library)
`If large amounts of sample DNA were used for library preparation (>100 ng), only a fraction of the library
`containing the equivalent of ~100 ng of starting material should be used for indexing PCR in order to prevent
`saturation of the PCR with template DNA.
`23. Mix and perform cycling using the following temperature profile:
`
`1X
`200 µM each
`200 nM
`0.02 U/µL
`
`200 nM
`
`Initial denaturation
`Denaturation/cycle
`Annealing/cycle
`Elongation/cycle
`Final extension
`
`98°C
`98°C
`60°C
`72°C
`72°C
`
`30 sec
`10 sec
`20 sec
`20 sec
`10 min
`
`www.cshprotocols.org
`
`8
`
`Cold Spring Harbor Protocols
`
`00008
`
`

`

`Downloaded from
`
`http://cshprotocols.cshlp.org/
` on March 10, 2022 - Published by
`
` Cold Spring Harbor Laboratory Press
`
`The optimal number of PCR cycles, that is, the number of cycles required to reach PCR plateau, will depend on
`the amount and concentration of template DNA and can be directly inferred from the amplification plots of the
`qPCR (Step 21). The cycle number can also be adjusted by rule of thumb according to the lowest amount of
`sample DNA that was used for library preparation: >100 ng  12 cycles; >10 ng  16 cycles, >1 ng  20
`cycles, >100 pg  24 cycles.
`
`24. Perform reaction purification exactly as described in Steps 6-13. Elute the indexed libraries in 25
`µL of EBT.
`
`25. Load 3 µL of some of the PCR products on a 2% agarose gel to verify amplification success.
`Indexed libraries prepared from sheared DNA should produce a smear. Due to the formation of heteroduplexes
`in the plateau phase of PCR (Ruano and Kidd 1992), the fragment size distribution inferred from the agarose
`gel may deviate slightly from the true distribution. However, no low-molecular-weight artifacts, such as primer
`dimers or adapter dimers, should be visible in the indexed sample libraries.
`See Troubleshooting.
`
`26. Determine the DNA concentration, and pool the indexed libraries in equimolar ratios.
`The pool of indexed libraries is now ready for target capture or direct sequencing on one of Illumina’s sequencing
`platforms.
`Due to the presence of heteroduplexes, qPCR is the only means of exactly determining the DNA concentrations
`in indexed libraries. However, concentration estimates derived from measurements with a spectrophotometer are
`sufficient in this step and more convenient. End product yield of indexing PCR is usually similar for all samples,
`particularly if there are no major differences in fragment size distribution. If this is the case, as can be confirmed
`by measuring DNA concentrations in a subset of indexed libraries, pooling equal volumes of all libraries will
`be sufficient.
`
`Target Capture and/or Sequencing on the Illumina Platform
`
`27. For target capture on microarrays, follow, for example, the exact procedure given in the protocol
`of Hodges et al. (2009) with the following modifications:
`
`i. Use a different set of blocking oligos (BO1-BO6).
`
`ii. Use primers IS5 and IS6 at an annealing temperature of 60°C for amplifying the library pool
`after capture.
`28. For sequencing and data analysis, use the recipes, kits, and analysis tools for multiplex sequencing
`provided by Illumina.
`A tool for splitting up the qseq sequence files according to indexes is available in CASAVA 1.6 and later versions
`(demultiplex.pl). However, when using the 7-nt index sequences given in this protocol, the —qseq-mask
`parameter must be set to seven (the default is six). No modifications to the recipes provided by the Illumina
`machine control software (SCS) are required, because seven cycles of index sequencing are carried out by default.
`Additional software for data analysis on FastQ files (SplitFastQIndex.py), a file format created for example by the
`alternative base caller Ibis (Kircher et al. 2009), is provided on http://bioinf.eva.mpg.de. If single mismatches
`are allowed during index identification, the fraction of unidentified index sequences typically reduces to ~5%, as
`compared to ~15% when a perfect match is required. Using alternative base callers like Alta-Cyclic (Erlich et al.
`2008), BayesCall (Kao et al. 2009), or IBIS (Kircher et al. 2009) may also increase the fraction of correctly
`identified indexes.
`Indexed sequencing libraries are compatible with all capture methods requiring sequencing libraries. It is
`recommended to carry the blank library all the way through target capture and/or sequencing. To avoid cross-
`contamination of samples through jumping PCR (Meyerhans et al. 1990), pools of indexed libraries should be
`amplified with a minimum number of PCR cycles or sequenced without amplification if possible.
`See Troubleshooting.
`
`TROUBLESHOOTING
`
`Problem: No size shift of the positive control library is visible on the agarose gel, or the size shift
`is incomplete.
`[Step 20]
`Solution: Consider the following:
`
`1. Make sure the positive control PCR was generated using primers with unmodified 5-ends.
`
`2. One of the enzymes may have degraded. Replace all the enzymes and repeat.
`
`www.cshprotocols.org
`
`9
`
`Cold Spring Harbor Protocols
`
`00009
`
`

`

`Downloaded from
`
`http://cshprotocols.cshlp.org/
` on March 10, 2022 - Published by
`
` Cold Spring Harbor Laboratory Press
`
`Problem: The positive control library shows no band on the agarose gel.
`[Step 20]
`Solution: Verify that the SPRI bead suspension is functional and the size cutoff is appropriate, for
`example, by purifying a DNA ladder as described in Steps 6-13.
`
`Problem: Artifact bands are visible on the agarose gel after indexing PCR.
`[Step 25]
`Solution: If enough sample DNA was used for library preparation, artifact bands are only expected
`from the blank control. Repeat library preparation using more sample DNA or reduce the amount
`of adapters to 0.2 µL per reaction. Make sure a hot start polymerase was used for the indexing PCR.
`
`Problem: Sequencing results in a low percentage of reads with correct index sequences.
`[Step 28]
`Solution: On the Genome Analyzer II, up to 5% of the raw sequences can generally be expected to be
`artifacts and up to 25% of low quality. If “N” base calls are more frequent in the index read than
`the other sequencing read(s), image analysis and downstream base calling partially or completely
`failed due to unbalanced usage of nucleotides or laser channels. Prepare a new pool of libraries with
`a more balanced composition of indexes (see Step 22) and repeat sequencing.
`
`ACKNOWLEDGMENTS
`
`We thank Michael Hofreiter, Svante Pääbo, Hernán Burbano, and Adrian Briggs for helpful discussions;
`Mark Whitten, David López Herráez, and Tomislav Maricic for comments on the manuscript; and the
`Max-Planck-Society for financial support.
`
`REFERENCES
`Craig DW, Pearson JV, Szelinger S, Sekar A, Redman M, Corneveaux
`JJ, Pawlowski TL, Laub T, Nunn G, Stephan DA, et al. 2008.
`Identification of genetic variants using bar-coded multiplexed
`sequencing. Nat Methods 5: 887–893.
`Erlich Y, Mitra PP, delaBastide M, McCombie WR, Hannon GJ. 2008.
`Alta-Cyclic: A self-optimizing base caller for next-generation
`sequencing. Nat Methods 5: 679–682.
`Hodges E, Rooks M, Xuan Z, Bhattacharjee A, Benjamin Gordon D,
`Brizuela L, Richard McCombie W, Hannon GJ. 2009. Hybrid
`selection of discrete genomic intervals on custom-designed
`microarrays for massively parallel sequencing. Nat Protoc 4:
`960–974.
`Kao WC, Stevens K, Song YS. 2009. BayesCall: A model-based base-
`calling algorithm for high-throughput short-read sequencing.
`Genome Res 19: 1884–1895.
`Kircher M, Stenzel U, Kelso J. 2009. Improved base calling for the
`Illumina Genome Analyzer using machine learning strategies.
`
`Genome Biol 10: R83.