`
`
`
`DNA AND
`CHROMOSOMES
`
`THE STRUCTURE AND FUNCTION
`OF DNA
`
`CHROMOSOMAL DNA AND ITS
`PACKAGING IN THE CHROMATIN
`FIBER
`
`THE GLOBAL STRUCTURE OF
`CHROMOSOMES
`
`_
`
`
`
`
`
`Life depends on the ability of cells to store, retrieve, and translate the genetic
`instructions required to make and maintaina living organism. This hereditary
`_ information is passed on fromacell to its daughtercells at cell division, and
`from one generation of an organism to the next through the organism's repro-
`ductive cells. These instructions are stored within every living cell as its genes,
`the information-containing elements that determine the characteristics of a
`__ species as a whole and ofthe individuals within it.
`As soon as genetics emergedasa scienceat the beginningof the twentieth
`century, scientists became intrigued by the chemical structure of genes. The
`informationin genes is copied and transmitted from cell to daughter cell millions
`of times during the life of a multicellular organism, and it survives the process
`essentially unchanged. What form of molecule could be capable of such accu-
`rate and almost unlimited replication andalso beableto direct the development
`of an organism and thedaily life of a cell? What kind of instructions does the
`genetic information contain? How are these instructions physically organized so
`that the enormous amountof information required for the development and
`_ maintenance of even the simplest organism can be contained within the tiny
`space ofa cell?
`The answers to someof these questions began to emerge in the 1940s, when
`researchers discovered, from studies in simple fungi, that genetic information
`consists primarily of instructions for makingproteins. Proteins are the macro-
`_ molecules that perform mostcellular functions:they serve as building blocks for
`cellular structures and form the enzymesthatcatalyzeall of thecell's chemical
`reactions (Chapter 3), they regulate gene expression (Chapter 7), and they
`- enable cells to move (Chapter 16) and to communicate with each other (Chap-
`ter 15). The properties and functionsofa cell are determined almost entirely by
`the proteinsit is able to make. With hindsight, it is hard to imagine what other
`type of instructions the genetic information could have contained.
`
`
`
`
`
`00001
`
`191
`
`00001
`
`EX1010 - pt. 1
`
`

`

`
`
`
`fractionation of cell-free
`extractinto classes of
`purified molecules
`
`
`lipid carbohydrate
`DNA
`protein
`RNA
`|
`|
`|
`|
`|
`ipa
`rain cells
`molecules tested fortransformationof R st
`
`@ @
`R
`strain
`
`) oO
`R
`strain
`
`eo % O ®
`S
`R
`strain
`strain
`strain
`
`
`
`(A)
`
`(B)
`
`ided one of the major clues that led to the Watson-Crick structure.of DNA.
`
`Only when this model was proposed did DNA’s potential for replication and
`
`information encoding becomeapparent. In this section we examinethe struc-
`ure of the DNA molecule and explain in general terms howit is able to store
`
`hereditary information.
`
`
`-ADNA molecule consists of two long polynucleotide chains composed of four
`pes of nucleotide subunits. Eachof these chains is knownas a DNA chain, or a
`DNA strand. Hydrogen bonds betweenthebase portionsof the nucleotides hold
`
`the two chains together(Figure 4-3). As we saw in Chapter 2 (Panel 2-6, pp. 120-
`
`121), nucleotides are composedofa five-carbon sugarto which are attached one
`or more phosphate groups and a nitrogen-containing base. In the case of the
`
`nucleotides in DNA, the sugar is deoxyribose attached to a single phosphate
`
`group (hence the namedeoxyribonucleic acid), and the base maybeeither ade-
`Nine(A), cytosine (C), guanine (G), or thymine (T). The nucleotides are covalent-
`ly linked together in a chain through the sugars and phosphates, which thus
`form a “backbone”of alternating sugar-phosphate-sugar—phosphate (see Fig-
`
`‘ure 4-3). Becauseonly the basediffers in each of the four types of subunits, each
`polynucleotide chain in DNAis analogousto a necklace (the backbone) strung
`
`With four types of beads(the four bases A, C, G, and T). These same symbols (A,
`-C, G, and T) are also commonly used to denotethe four different nucleotides—
`
`that is, the bases with their attached sugar and phosphate groups.
`.
`The way in which the nucleotide subunits are lined together gives a DNA
`
`_ Strand a chemicalpolarity. If we think of each sugaras a block with a protruding
`knob (the 5’ phosphate) on one side and a hole(the 3’ hydroxyl) on the other(see
`
`_ Figure 4-3), each completed chain, formedbyinterlocking knobswith holes,will
`
`haveall of its subunits lined up in the sameorientation. Moreover, the two ends
`ofthe chain will beeasily distinguishable, as one has a hole (the 3’ hydroxyl) and
`the other a knob(the 5’ phosphate)atits terminus. This polarity ina DNA chain
`
`is indicated by referring to one end as the 3’ end andtheother asthe 5’ end.
`The three-dimensional structure of DNA—the double helix—arises from
`
`the chemical andstructural features of its two polynucleotide chains. Because
`
`ADNAMolecule Consists of Wo Complementary
`Chains of Nucleotides
`
`
`
`
`
`. THE STRUCTURE AND FUNCTION OF DNA
`
`
`EX1010 - pt. 1
`
`193
`
`
`
`R|S
`
`
`smooth pathogenic bacterium|Sstrain causes pneumonia
`The other crucial advance made in the 1940s was the identification of
`Figure 4-2 Experimental
`demonstration that DNAis the
`
`deoxyribonucleic acid (DNA)as the likely carrier of genetic information. But the
`
`genetic material. These experiments,
`mechanism wherebythe hereditary information is copied for transmission from
`carried out in the 1940s, showed that
`cell to cell, and how proteins are specified by the instructions in the DNA,
`adding purified DNAto a bacterium
`remained completely mysterious. Suddenly, in 1953, the mystery was solved
`changed its properties and that this
`whenthe structure of DNA was determined by James Watson and Francis Crick.
`change wasfaithfully passed on to
`As mentioned in Chapter1, the structure of DNA immediately solved the prob-
`subsequentgenerations. Two closely
`lem of how the information in this molecule might be copied, or replicated. It
`related strains of the bacterium
`also provided thefirst clues as to how a molecule of DNA might encode the
`Streptococcus pneumoniae differ from each
`instructions for making proteins. Today, the fact that DNAis the genetic material
`otherin both their appearance under the
`is so fundamentalto biological thoughtthatit is difficult to realize what an enor-
`microscope and their pathogenicity. One
`mousintellectual gap this discovery filled.
`strain appears smooth (S) and causes
`death when injected into mice, and the
`Well before biologists understood the structure of DNA,they had recognized
`other appears rough (R) and is nonlethal.
`that genes are carried on chromosomes, which were discovered in the nineteenth
`(A) This experiment shows that a
`century as threadlike structures in the nucleus of a eucaryotic cell that become
`substance presentin the § strain can
`visible as the cell begins to divide (Figure 4-1). Later, as biochemical analysis
`change (or transform) the R strain into
`becamepossible, chromosomeswere foundto consist of both DNA andprotein.
`the S strain and that this changeis
`We now knowthat the DNAcarries the hereditary information ofthe cell (Figure
`inherited by subsequent generations of
`4-2). In contrast, the protein components of chromosomesfunctionlargely to
`bacteria. (B) This experiment, in which the
`package and control the enormously long DNA moleculesso thattheyfit inside
`R strain has been incubated with various
`cells and can easily be accessed by them.
`classes of biological molecules obtained
`from the§strain, identifies the substance
`In this chapter we begin by describing the structure of DNA. We see how,
`as DNA.
`despite its chemical simplicity, the structure and chemical properties of DNA
`makeit ideally suited as the raw material of genes. The genes of every cell on
`Earth are made of DNA, andinsights into the relationship between DNA and
`genes have comefrom experiments in a wide variety of organisms. We then con-
`sider how genes and other important segments of DNAare arranged on the long
`molecules of DNA that are present in chromosomes. Finally, we discuss how
`eucaryotic cells fold these long DNA molecules into compact chromosomes.
`This packing hasto be donein an orderly fashion so that the chromosomescan
`be replicated and apportioned correctly between the two daughtercells at each
`cell division. It must also allow access of chromosomal DNA to enzymesthat
`repair it when it is damaged andto the specialized proteins that direct the
`expression of its many genes.
`This is the first of four chapters that deal with basic genetic mechanisms—
`the ways in which the cell maintains, replicates, expresses, and occasionally
`improves the genetic information carried in its DNA.In the following chapter
`(Chapter 5) we discuss the mechanisms by whichthecell accurately replicates
`and repairs DNA; we also describe how DNA sequences can be rearranged
`through the process of genetic recombination. Gene expression—the process
`through which the information encoded in DNAis interpreted by the cell to
`guide the synthesis of proteins—is the main topic of Chapter 6. In Chapter 7, we
`describe how gene expression is controlled by the cell to ensure that each of the
`many thousandsof proteins encrypted in its DNA is manufactured only at the
`proper time andplacein thelife of the cell. Following these four chapters on
`basic genetic mechanisms, we present an account of the experimental tech-
`niques used to study these and otherprocesses that are fundamentaltoall cells
`(Chapter8).
`
`| RANDOM MUTATION
`rough nonpathogenic
`Restrain mutant bacterium
`
`
`
`4
`
`live R strain cells grown in
`presence ofeither heat-killed
`S strain cells or cell-free
`Butract ot Sistrain call
`
`“TRANSFORMATION
`'
`
`SomeR strain cells are
`transformedto S strain
`cells, whose daughters
`strain ee. am
`cause pneumonia
`
`
`
`THE STRUCTURE AND FUNCTION OF DNA
`
`Biologists in the 1940s had difficulty in accepting DNAasthe genetic material
`becauseof the apparentsimplicity of its chemistry. DNA was known to be a long
`polymer composed of only four types of subunits, which resemble one another
`chemically. Early in the 1950s, DNA wasfirst examined by x-ray diffraction
`analysis, a technique for determining the three-dimensional atomicstructure of
`a molecule (discussed in Chapter 8). The early x-ray diffraction results indicated
`that DNA was composedof twostrandsof the polymer wound into a helix. The
`observation that DNA was double-stranded was of crucial significance and
`
`192
`
`Chapter 4 : DNA AND CHROMOSOMES
`
`
`nondividing cell
`
`(A)
`
`dividing cell
`
`(B)
`
`10 um
`
`Figure 4-1 Chromosomesin cells.
`(A) Two adjacentplant cells photographed
`througha light microscope. The DNA has
`been stained with a fluorescent dye
`(DAPI) that binds to it. The DNAis
`present in chromosomes, which become
`visible as distinct structures in the light
`microscope only when they become
`compactstructures in preparation for cell
`division, as shown on theleft. The cell on
`the right, which is not dividing, contains
`identical chromosomes, but they cannot
`be clearly distinguished in the light
`microscopeat this phase in the cell's life
`cycle, because they are in a more
`extended conformation. (B) Schematic
`diagram of the outlines of the two cells
`along with their chromosomes.
`(A, courtesy of Peter Shaw.)
`
`00002
`
`EX1010 - pt. 1
`
`

`

`
`
`Figure 4-3 DNAandits building
`blocks. DNA is made of four types of
`nucleotides, which are linked covalently
`into a polynucleotide chain (a DNA
`strand) with a sugar-phosphate backbone
`from which the bases (A, C, G, and T)
`extend.A DNA molecule is composed of
`two DNAstrands held together by
`hydrogen bonds betweenthe paired bases,
`The arrowheads at the ends of the DNA
`strands indicate the polarities of the two
`strands, which run antiparallel to each
`other in the DNA molecule.In the
`
`diagram at the bottom left of thefigure,
`the DNA molecule is shown straightened
`out; in reality, it is twisted into a double
`helix, as shown on the right. For details,
`see Figure 4-5.
`
`
`
`
`
`
`=UO
`
`0.34nm
`
`minor
`
`groove
`
`rior
`groove
`
`0
`
`
`
`
`
`phosphodiester
`bond
`
`5’ end
`
`{B)
`
`Figure 4-5 The DNA doublehelix.
`(A) A space-filling model of |.5 turns of
`the DNA double helix. Each turn of DNA
`
`is made up of 10.4 nucleotide pairs and
`the center-to-center distance between
`
`adjacent nucleotide pairs is 3.4 nm. The
`coiling of the two strands around each
`other creates two groovesin the double
`helix.As indicated in the figure, the wider
`grooveis called the major groove, and the
`smaller the minor groove. (B) A short
`section of the double helix viewed from
`
`its side, showing four basepairs. The
`nucleotides are linked together covalently
`by phosphodiester bonds through the
`3’-hydroxyl (-OH) group of one sugar and
`the 5’-phosphate (P) of the next. Thus,
`each polynucleotide strand has a chemical
`polarity; thatis, its two ends are
`chemically different. The 3’ end carries an
`unlinked -OH group attached to the 3’
`position on the sugar ring; the 5’ end
`carries a free phosphate group attached to
`the 5’ position on the sugarring.
`
`
`energetically most favorable arrangementin the interior of the double helix. In
`is arrangement, each basepair is of similar width, thus holding the sugar-
`osphate backbonesan equal distance apart along the DNA molecule. To max-
`imize the efficiency of base-pair packing, the two sugar-phosphate backbones
`
`nd around each other to form a double helix, with one complete turn every
`
`base pairs (Figure 4-5).
`ten
`The membersofeachbasepaircanfit together within the doublehelix only
`_
`
`if the two strandsof the helix are antiparallel—thatis, only if the polarity of one
`and is oriented oppositeto that of the other strand (see Figures 4-3 and 4-4).
`
`A consequence of these base-pairing requirementsis that each strand of a DNA
`‘molecule contains a sequence of nucleotides that is exactly complementary to
`the nucleotide sequence ofits partnerstrand.
`
`| ,
`
`
`
`DNA strand
`
`phosphate
`
`sugarae >
`
`sugar
`RHOSpHate
`
`base
`
`nucleotide
`
`- double-stranc
`
`.
`5
`
`ll,
`
`DNA doublehelix
`
`o
`
`e
`
`sugar-phosphate
`backbone
`
`5
`
`—
`3
`hydrogen-bonded
`base pairs
`
`5°
`
`3
`
`these two chains are held together by hydrogen bonding between the bases on
`the different strands, all the bases are on the inside of the double helix, and the
`sugar-phosphate backbonesare onthe outside (see Figure 4-3). In each case, a
`bulkier two-ring base (a purine; see Panel 2-6, pp. 120-121) is paired with a sin-
`gle-ring base (a pyrimidine); A always pairs with T, and G with C (Figure 4-4).
`This complementary base-pairing enables the base pairs to be packed in the
`
`4
`
`;
`
`
`he Structure of DNA Provides a Mechanism for Heredity
`Genescarry biological information that mustbe copiedaccurately for transmis-
`
`sion to the next generation each timea cell divides to form two daughtercells.
`‘Two central biological questions arise from these requirements: how can the
`Figure 4-4 Complementary base
`
`information for specifying an organism becarried in chemical form, and how is
`pairs in the DNA double helix. The
`
`it accurately copied? The discovery ofthe structure of the DNA doublehelix was
`shapes and chemical structure of the
`i
`@landmark in twentieth-century biology because it immediately suggested
`bases allow hydrogen bonds to form
`
`AH;
`a
`CH
`efficiently only between A andTand
`answers to both questions, thereby resolving at the molecular level the problem
`ie
`N
`Cc
`N
`between G and C, where atoms that are
`of heredity. We discuss briefly the answers to these questionsin this section, and
`
`able to form hydrogen bonds (see Panel
`we shall examine them in moredetail in subsequent chapters.
`2-3, pp.
`| 14-115) can be brought close
`_
`DNAencodes information through the order, or sequence, of the
`
`i,
`together without distorting the double
`hucleotides along each strand. Each base—A,C, T, or G—can be considered as a
`helix. As indicated, two hydrogen bonds
`letter in a four-letter alphabetthat spells out biological messages in the chemi-
`
`form between A and T, while three form
`Cal structure of the DNA. As we saw in Chapter 1, organisms differ from one
`between G and C. Thebases canpair in
`another because their respective DNA molecules have different nucleotide
`
`this way only if the two polynucleotide
`Sequencesand, consequently, carry different biological messages. But how is the
`chains that contain them are antiparallel
`to each other.
`-hucleotide alphabet used to make messages, and whatdotheyspell out?
`As discussed above, it was known well before the structure of DNA was
`___
`
`determined that genes contain the instructions for producing proteins. The
`DNA messages must therefore somehow encodeproteins (Figure 4-6). This rela-
`tionship immediately makes the problem easier to understand, becauseof the
`Chemical character of proteins. As discussed in Chapter3, the properties of a
`Protein, which are responsible for its biological function, are determinedbyits
`_ three-dimensional structure, andits structure is determinedin turn bythelinear
`
`i
`'
`
`geneA
`———er
`
`gene B
`fa
`
`geneC
`eae)
`
`.
`
`DNA
`double
`helix
`
`Ea 8
`proteinA proteinB
`
`Eas
` proteinC
`
`Figure 4-6 The relationship between
`genetic information carried in DNA
`and proteins.
`EX1010 - pt. 1
`
`ce
`
`07
`
`<n~
`|
`2
`A N
`
`=
`
`c
`
`N
`
`Cc
`
`Cc
`
`C
`
`thymine
`
`No
`=
`|
`a =
`
`N
`
`H
`
`H
`
`oF
`NN
`=
`=
`Hk
`ad *N
`N
`
`Cc
`
`Cc
`
`|
`
`cytosine
`
`
`
`—H
`
`Ms
`
`hydrogen
`bond
`
`N
`
`a
`
`G
`
`N
`
`“guanine
`adenine
`C
`=
`
`
` H
`
`aN
`sugar-phosphate backbone
`
`be
`
`194
`
`Chapter 4 : DNA AND CHROMOSOMES
`
`0000
`
`THE STRUCTURE AND FUNCTION OF DNA
`
`
`
`195
`
`
`
`00003
`
`EX1010 - pt. 1
`
`

`

`CCCTGTGGAGCCACACCCTAGGGTTGGCCA
`ATCTACTCCCAGGAGCAGGGAGGGCAGGAG
`CCAGGGCTGGGCATAAAAGTCAGGGCAGAG
`CCATCTATTGCTTACATTTGCTTCTGACAC
`AACTGTGTTCACTAGCAACTCAAACAGACA
`
` iTTGGTATCAAGGTTACAAGACAGGT
`
`TTAAGGAGACCAATAGAAACTGGGCATGTG
`GAGACAGAGAAGACTCTTGGGTTTCTGATA
`GGCACTGACTCICTCTGCCTATIGGICTAT
`
`TTTCCCACCCTTA!
`
` CTCGCTTTCTTGC
`
`TGTCCAATTTCTATTAAAGGTTCCTTTGTT
`CCCTAAGTCCAACTACTAAACTGGGGGATA
`TTATGAAGGGCCTTGAGCATCTGGATTCTG
`CCTAATAAAAAACATTTATTTTCATTGCAA
`TGATGTATTTAAATTATTTCTGAATATTTT
`ACTAAAAAGGGAATGTGGGAGGTCAGTGCA
`TTTAAAACATAAAGAAATGATGAGCTGTTC
`AAACCTTGGGAAAATACACTATATCTTAAA
`CTCCATGAAAGAAGGTGAGGCTGCAACCAG
`CTAATGCACATTGGCAACAGCCCCTGATGC
`CTATGCCTTATTCATCCCTCAGAAAAGGAT
`TCTTGTAGAGGCTTGATTTGCAGGTTAAAG
`TTTTGCTATGCTGTATTTTACATTACTTAT
`TGTTTTAGCTGTCCTCATGAATGTCTTTTC
`
`tA Figure 4-7 The nucleotide sequence of the human f-globin gene.
`
`5’
`
`z
`
`Sstrand
`parentDNAdoublehelix
`
`S’ strand
`
`les S strand
`
`new S’ strand
`
`new § strand
`
`/;
`iy
`
`ae S’ strand
`
`Figure 4-8 DNAas a template for its own duplication. As the
`nucleotide A successfully pairs only with T, and G with C, each strand of
`DNAcan specify the sequence of nucleotides in its complementary strand.
`In this way, double-helical DNA can be copied precisely.
`
`196
`
`Chapter 4 : DNA AND CHROMOSOMES
`
`3
`
`=
`
`3
`
`5
`
`-e
`
`e
`
`This gene carries the information for the amino acid sequence of one of the
`two types of subunits of the hemoglobin molecule, which carries oxygen in
`the blood. A different gene, the o-globin gene, carries the information for
`the other type of hemoglobin subunit (a hemoglobin molecule has four
`subunits, two of each type). Only one of the two strands of the DNA double
`helix containing the B-globin gene is shown; the other strand has the exact
`complementary sequence. By convention, a nucleotide sequence is written
`from its 5’ end to its 3’ end, and it should be read from left to right in
`successive lines down the page as though it were normal English text. The
`DNAsequenceshighlighted in yellow show the three regions of the gene that
`specify the amino sequencefor the [i-globin protein. We see in Chapter 6
`how the cell connects these three sequences together to synthesize a
`full-length B-globin protein.
`
`sequence of the amino acids of which it is composed. The linear sequence of
`nucleotides in a gene must therefore somehowspell out the linear sequenceof
`AGTCTATGGGACCCTTGATGTTTTCTTTCC
`amino acids in a protein. The exact correspondence between the four-letter
`CCTTCTTTTCTATGGTTAAGTTCATGTCAT
`nucleotide alphabet of DNA andthe twenty-letter amino acid alphabetof pro-
`AGGAAGGGGAGAAGTAACAGGGTACAGTTT
`teins—the genetic code—is not obvious from the DNAstructure, and it took over
`AGAATGGGAAACAGACGAATGATTGCATCA
`a decade after the discovery of the double helix before it was worked out. In
`GTGTGGAAGTCTCAGGATCGTTTTAGTTIC
`Chapter6 we describe this code in detail in the course of elaborating the pro-
`TTTTATTTGCTGTTCATAACAATTGTTITTC
`Thus,the genetic information in DNA can be accurately copied by the beautifully
`cess, known as gene expression, through whichacell translates the nucleotide
`TITTIGITTAATICTIGCITICTTTTTTTITT
`imple process in which strand S separates from strand S’, and each separated
`
`sequenceof a gene into the amino acid sequenceofa protein.
`CTTCTCCGCAATTTTTACTATTATACTTAA
`strand then serves as a template for the production of a new complementary
`The complete set of information in an organism's DNAis called its genome,
`TGCCTTAACATTGTGTATAACAAAAGGAAA
`partner strandthatis identical to its former partner.
`TATCTCTGAGATACATTAAGTAACTTAAAA
`andit carries the informationforall the proteins the organism will ever synthe-
`_
`Theability of each strand of a DNA molecule to act as a template for pro-
`AAAAACTTTACACAGTCTGCCTAGTACATT
`size. (The term genomeis also used to describe the DNAthatcarries this infor-
`
`ducing a complementary strand enables a cell to copy, or replicate, its genes
`ACTATTTGGAATATATGTGTGCTTATTTGC
`mation.) The amountof information contained in genomesis staggering: for
`ATATTCATAATCTCCCTACTTTATTTTCTT
`before passing them on to its descendants. In the next chapter we describe the
`example, a typical humancell contains 2 meters of DNA. Written outin the four-
`TTATTTTTAATTGATACATAATCATTATAC
`elegant machinery thecell uses to perform this enormoustask.
`
`letter nucleotide alphabet, the nucleotide sequence of a very small human gene
`ATATTTATGGGTTAAAGTGTAATGTTTTAA
`
`occupies a quarterof a pageof text (Figure 4-7), while the complete sequence of
`TATGTGTACACATATTGACCAAATCAGGGT
`nucleotides in the human genome would fill more than a thousand booksthe
`AATTTTGCATTTGTAATTTTAAAAAATGCT
`In Eucaryotes, DNAIs Enclosed in a Cell Nucleus
`size of this one. In addition to othercritical information, it carries the instruc-
`TICTTCTTTTAATATACTTTTTTGTTTATC
`TTATTTCTAATACTTTCCCTAATCTCTTTC
`tions for about 30,000 distinct proteins.
`TTTCAGGGCAATAATGATACAATGTATCAT
`At each cell division, the cell must copy its genometo passit to both daugh-
`GCCTCTTTGCACCATTCTAAAGAATAACAG
`ter cells. The discovery of the structure of DNAalso revealed the principle that
`TGATAATTTCTGGGTTAAGGCAATAGCAAT
`makes this copying possible: because each strand of DNA contains a sequence
`ATTTCTGCATATAAATATTTCTGCATATAA
`of nucleotides that is exactly complementary to the nucleotide sequenceofits
`ATTGTAACTGATGTAAGAGGTTTCATATTG
`partnerstrand, each strand can act as a template, or mold, for the synthesis of a
`CTAATAGCAGCTACAATCCAGCTACCATTC
`new complementary strand. In other words,
`if we designate the two DNA
`TGCTTTTATTTTATGGTTGGGATAAGGCTG
`strands as S and S’, strand S canserve as a template for making a new strand S’,
`GATTATTCTGAGTCCAAGCTAGGCCCTTTT
`while strand S’ can serve as a template for making a new strand § (Figure 4-8).
`GCTAATCATGTTCATACCTCTTATCTTCCT
`
`
`
`
`
`
`
`DNAand associated
`proteins (chromatin)
`
`nucleolus
`
`centrosome
`
`microtubule
`
`"
`
`nuclear lamina
`
`
`
`endoplasmic
`reticulum
`
`intermediate
`
`filaments \ e
`
`
`nuclear pore
`
`outer nuclear et nuclear envelope
`
`inner nuclear membrane
`
`|
`|
`
`Figure 4-9 A cross-sectional view of
`a typical cell nucleus. The nuclear
`envelope consists of two membranes, the
`outer one being continuous with the
`endoplasmic reticulum membrane (see
`also Figure 12-9). The spaceinside the
`endoplasmic reticulum (the ER lumen)is
`colored yellow; it is continuous with the
`space between the two nuclear
`membranes. Thelipid bilayers of the inner
`and outer nuclear membranesare
`connected at each nuclear pore. Two
`networks of intermediate filaments (green)
`provide mechanical support for the
`nuclear envelope; the intermediate
`filaments inside the nucleus form a special
`supporting structure called the nuclear
`lamina.
`
`
`
`
`
`Neatly all the DNA in a eucaryotic cell is sequestered in a nucleus, which occu-
`
`pies about 10% of the total cell volume. This compartmentis delimited by a
`“nuclear envelope formed by two concentric lipid bilayer membranesthat are
`
`‘punctured at
`intervals by large nuclear pores, which transport molecules
`tween the nucleus andthe cytosol. The nuclear envelopeis directly connected
`
`to the extensive membranesof the endoplasmic reticulum. It is mechanically
`‘supported by two networks of intermediate filaments: one, called the nuclear
`
`lamina, forms a thin sheetlike meshwork inside the nucleus, just beneath the
`
`‘inner nuclear membrane;the other surroundsthe outer nuclear membrane and
`
`is less regularly organized (Figure 4-9).
`The nuclear envelope allows the many proteins that act on DNAto be con-
`trated where they are neededin thecell, and, as we see in subsequent chap-
`
`, italso keeps nuclear and cytosolic enzymesseparate,a featurethatis crucial
`
`Tor the proper functioning of eucaryotic cells. Compartmentalization, of which
`the nucleus is an example, is an important principle of biology; it serves to
`
`@stablish an environmentin which biochemical reactions are facilitated by the
`high concentration of both substrates and the enzymesthat act on them.
`
`
`Summary
`
`_ Genetic information is carried in the linear sequence of nucleotides in DNA. Each
`
`Molecule of DNA is a double helix formed from two complementary strands of
`
`_hucleotides held together by hydrogen bonds between G-C and A-T base pairs.
`
`Duplication ofthe genetic information occursby the use ofone DNA strand as a tem-
`
`plate forformation ofa complementary strand. The genetic information stored in
`4N organism’s DNA contains the instructions for all the proteins the organism will
`
`_ ver synthesize. In eucaryotes, DNA is containedin thecell nucleus.
`
`
`
`E STRUCTURE AND FUNCTION OF DNA
`
`EX1010 - pt. 1
`
`197
`
`
`
`00004
`
`EX1010 - pt. 1
`
`

`

`IN THE CHROMATIN FIBER
`
`The most important function of DNA is to carry genes, the information that
`specifies all the proteins that make up an organism—including information
`about when, in whattypesofcells, and in what quantity each protein is to be
`made. The genomesof eucaryotes are divided up into chromosomes, and in this
`section we see howgenesare typically arranged on each chromosome.In addi-
`tion, we describe the specialized DNA sequences that allow a chromosometo be
`accurately duplicated and passed on from one generationto the next.
`Wealso confront the serious challenge of DNA packaging. Each humancell
`contains approximately2 meters of DNAif stretched end-to-end; yet the nucleus
`of ahumancell, which contains the DNA,is only about 6 umin diameter. Thisis
`geometrically equivalent to packing 40 km (24 miles) of extremelyfine thread
`into a tennis ball! The complex task of packaging DNA is accomplished byspe-
`cialized proteins that bind to and fold the DNA, generating a series of coils and
`loops that provide increasingly higher levels of organization, preventing the
`DNAfrom becoming an unmanageable tangle. Amazingly, although the DNAis
`very tightly folded, it is compacted in a waythatallowsit to easily become avail-
`able to the many enzymesin the cell that replicate it, repair it, and use its genes
`to produceproteins.
`
` CHROMOSOMAL DNA AND ITS PACKAGING
`
`Eucaryotic DNA Is Packaged into a Set of Chromosomes
`In eucaryotes, the DNA in the nucleus is divided betweena set of different
`chromosomes. For example,
`the human genome—approximately 3.2 x 10°
`nucleotides—is distributed over 24 different chromosomes. Each chromosome
`consists of a single, enormouslylong linear DNA molecule associated with pro-
`teins that fold and pack the fine DNA thread into a more compactstructure. The
`complex of DNA and protein is called chromatin (from the Greek chroma, “col-
`ored,” becauseof its staining properties). In addition to the proteins involved in
`packaging the DNA, chromosomes are also associated with manyproteins
`required for the processes of gene expression, DNA replication, and DNArepair.
`Bacteria carry their genes on a single DNA molecule, whichis usually cir-
`cular (see Figure 1-30). This DNA is associated with proteins that package and
`condense the DNA, but theyare different from the proteins that perform these
`functions in eucaryotes. Although often called the bacterial “chromosome,”it
`does not have the same structure as eucaryotic chromosomes, andless is known
`about howthebacterial DNAis packaged. Evenless is known about how DNAis
`compacted in archaea. Therefore, our discussion of chromosome structure will
`focus almost entirely on eucaryotic chromosomes.
`With the exceptionof the germcells, and a fewhighlyspecialized cell types
`that cannot multiply and lack DNAaltogether (for example, red blood cells),
`each humancell contains two copies of each chromosome, oneinherited from
`the mother and one fromthe father.The maternal and paternal chromosomes
`of a pair are called homologous chromosomes (homologs). The only nonho-
`mologous chromosome pairs are the sex chromosomesin males, where a Y¥ chro-
`mosome is inherited from the father and an X chromosome from the mother.
`Thus, each human cell contains a total of 46 chromosomes—22 pairs common
`to both males and females, plus two so-called sex chromosomes (X and Y in
`males, two Xs in females). DNA hybridization (described in detail in Chapter 8)
`can be usedto distinguish these human chromosomesby“painting” each one a
`different color (Figure 4-10). Chromosomepaintingis typically doneat the stage
`in the cell cycle when chromosomesareespecially compacted andeasyto visu-
`alize (mitosis, see below).
`Anothermoretraditional wayto distinguish one chromosome fromanother
`is to stain them with dyes that produceastriking andreliable pattern of bands
`along each mitotic chromosome (Figure 4-11). The structural bases for these
`banding patternsare not well understood, and wereturnto this issue at the end
`of the chapter. Nevertheless, the pattern of bands on each type of chromosome
`is unique, allowing each chromosometobe identified and numbered.
`
`198
`
`Chapter 4 : DNA AND CHROMOSOMES
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`The display of the 46 human chromosomesat mitosis is called the human
`karyotype. If parts of chromosomes are lost, or switched between chromo-
`somes, these changes can be detected by changes in the banding patterns or by
`changes in the pattern of chromosomepainting (Figure 4-12). Cytogeneticists
`use these alterations to detect chromosome abnormalities that are associated
`with inherited defects or with certain types of cancer that arise through the
`rearrangementof chromosomesin somatic cells,
`
`AR
`
`i
`
`aES
`
`
`50 million
`nucleotide pairs
`
`14
`
`15
`
`1 um
`
`GO0OSI
`CHROMOSOMAL DNA AND ITS PACKAGING INTHE CHROMATINFIBER
`Oo
`
`Figure 4-10 Human chromosomes.
`These chromosomes, from a male, were
`isolated from a cell undergoing nuclear
`division (mitosis) and are therefore highly
`compacted. Each chromosome has been
`“painted” a different color to permit its
`unambiguousidentification under the light
`microscope. Chromosomepaintingis
`performed by exposing the chromosomes
`to a collection of human DNA molecules
`
`that have been coupled to a combination
`of fluorescent dyes, For example, DNA
`molecules derived from chromosome|
`
`are labeled with one specific dye
`combination, those from chromosome 2
`with another, and so on. Because the
`labeled DNA can form basepairs, or
`hybridize, only to the chromosome from
`which it was derived (discussed in
`Chapter 8), each chromosomeis
`differently labeled. For such experiments,
`the chromosomesare subjected to
`treatments that separate the double-
`helical DNA into individual strands,
`
`designed to permit base-pairing with the
`single-stranded labeled DNA while
`keeping the chromosomestructure
`relatively intact. (A) The chromosomes
`visualized as they originally spilled from
`the lysed cell. (B) The same chromosomes
`artificially lined up in their numerical
`order. This arrangementof the full
`chromosome setis called a karyotype.
`(From E. Schréck et al., Science
`273:494-497, 1996. © AAAS.)
`
`Figure 4-1 | The banding patterns of
`human chromosomes. Chromosomes
`
`|-22 are numbered in approximate order
`of size. A typical human somatic (non-
`germ line) cell contains two of each of
`these chromosomes, plus two sex
`chromosomes—two X chromosomesin a
`female, one X and one Y chromosome
`in a male. The chromosomes used to make
`
`these maps were stained at an early stage
`in mitosis, when the chromosomesare
`
`incompletely compacted. The horizontal
`green line represents the position of the
`centromere (see Figure 4-22), which
`appears as a constriction on mitotic
`chromosomes; the kno