Downloaded from https://academic.oup.com/mend/article/14/5/733/2747718 by Finnegan, Henderson, Farabow, Garrett & Dunner, LLP user on 05 November 2022
`
`Alteration of a Single Amino Acid in
`Peroxisome Proliferator-Activated
`Receptor-a (PPARa) Generates a
`PPARd Phenotype
`
`Ichiro Takada, Ruth T. Yu, H. Eric Xu, Millard H. Lambert,
`Valerie G. Montana, Steven A. Kliewer, Ronald M. Evans, and
`Kazuhiko Umesono*
`
`Graduate School for Biostudies
`Kyoto University (I.T., R.T.Y., K.U.)
`Kyoto 606-8507, Japan
`Glaxo Wellcome Inc. Research and Development (H.E.X., M.H.L.,
`V.G.M., S.A.K.)
`Research Triangle Park, North Carolina 27709
`Howard Hughes Medical Institute (R.M.E.)
`The Salk Institute for Biological Studies
`La Jolla, California 92037
`
`Three pharmacologically important nuclear recep-
`tors, the peroxisome proliferator-activated receptors
`(PPARs a, g, and d), mediate key transcriptional re-
`sponses involved in lipid homeostasis. The PPARa
`and gsubtypes are well conserved from Xenopus to
`man, but the b/d subtypes display substantial spe-
`cies variations in both structure and ligand activation
`profiles. Characterization of the avian cognates re-
`vealed a close relationship between chick (c) aand g
`subtypes to their mammalian counterparts, whereas
`the third chicken subtype was intermediate to Xeno-
`pus (x) band mammalian d, establishing that band d
`are orthologs. Like xPPARb, cPPARb responded ef-
`ficiently to hypolipidemic compounds that fail to ac-
`tivate the human counterpart. This provided the op-
`portunity to address the pharmacological problem as
`to how drug selectivity is achieved and the more
`global evolutionary question as to the minimal
`changes needed to generate a new class of receptor.
`X-ray crystallography and chimeric analyses com-
`bined with site-directed mutagenesis of avian and
`mammalian cognates revealed that a Met to Val
`change at residue 417 was sufficient to switch the
`human and chick phenotype. These results establish
`that the genetic drive to evolve a novel and function-
`ally selectable receptor can be modulated by a single
`amino acid change and suggest how nuclear recep-
`tors can accommodate natural variation in species
`physiology. (Molecular Endocrinology 14: 733–740,
`2000)
`
`0888-8809/00/$3.00/0
`Molecular Endocrinology 14(5): 733–740
`Copyright © 2000 by The Endocrine Society
`Printed in U.S.A.
`
`INTRODUCTION
`
`Lipid and glucose homeostasis involves the coordina-
`tion of signaling pathways mediated by transcription
`factors, among which the peroxisome proliferator-
`activated receptors (PPARs) have been shown to play
`a major role. The PPARs are members of the nuclear
`receptor superfamily of ligand-activated transcription
`factors. Several PPAR subtypes have been described
`and named PPARa, PPARb, PPARg, and PPARd. The
`different forms are expressed in tissue-specific pat-
`terns: PPARa is abundantly found in liver, kidney,
`heart, and muscle; PPARg is localized in fat, large
`intestine, and macrophages; and PPARs b and d are
`widely expressed. The PPARs form a subclass of fatty
`acid and eicosanoid sensors that are characterized by
`their distinct pharmacological profiles, a property that
`has allowed the identification of subtype-selective li-
`gands including the widely used fibrate and thiazo-
`lidinedione classes of drugs (for review, see Refs. 1–4
`and references therein).
`The PPARb and -d forms posed a dilemma as to
`whether they constituted a single group or repre-
`sented distinct subtypes. Since Xenopus PPARb (xP-
`PARb) shares only approximately 75% amino acid
`identity in the ligand-binding domain with mouse and
`human (h) PPARd, it was not clear whether these re-
`ceptors are orthologs or paralogs. This lack of clarity
`was further exacerbated by the finding that human and
`mouse PPARds are functionally distinct from xPPARb
`in their response to ligands (5, 6). To better understand
`the evolutionary relationship between the PPARs, we
`have isolated the chick counterparts as a means for
`providing insight into the ancestral
`form of these
`
`733
`
`Bausch Health Ireland Exhibit 2038, Page 1 of 8
`Mylan v. Bausch Health Ireland - IPR2022-00722
`
`

`

`Downloaded from https://academic.oup.com/mend/article/14/5/733/2747718 by Finnegan, Henderson, Farabow, Garrett & Dunner, LLP user on 05 November 2022
`
`MOL ENDO · 2000
`734
`
`Vol 14 No. 5
`
`genes after divergence from amphibians. Our results
`demonstrate that chick and Xenopus PPARb and
`mammalian PPARd are orthologs. Moreover, we have
`exploited cross-species differences in the PPARb/d
`subtype to understand the molecular basis for impor-
`tant pharmacological differences in the ligand binding
`properties of the PPARs.
`
`RESULTS AND DISCUSSION
`
`Chick PPAR (cPPAR)-related gene products were ob-
`tained from cDNA libraries prepared from 2.5-day-old
`embryos and adult adipose tissue (see Materials and
`Methods). Isolation and characterization of multiple
`overlapping clones allowed the compilation of full-
`length cDNA sequences for all three cPPARs1 (Fig. 1A,
`GenBank accession nos. AF163809, AF163810, and
`AF163811), and an evolutionary tree comparing the
`ligand-binding domains (LBDs) was constructed using
`the ClustalW program (Ref. 7 and Fig. 1B). The phy-
`logenetic relationships reveal that PPARa and -g are
`highly conserved from Xenopus to human but greater
`divergence exists among the b/d subtypes, with the
`chick counterpart forming an intermediary link be-
`tween Xenopus PPARb and mouse/human PPARd.
`This alignment indicates clearly that the b and d forms
`constitute a single subtype as the conservation within
`individual subtypes is much higher than the similarity
`between that of a given species.
`To characterize the ligand response profiles of the
`cPPARs, we used GAL4 fusions of the LBDs to avoid
`background activation from endogenous PPARs. Se-
`rum-free conditions were chosen as some nuclear re-
`ceptors are modulated by the addition of FBS. The
`chick subtypes were found to exhibit distinct ligand
`response profiles (Fig. 2A; structures of compounds
`are shown in Table 1). Wy-14,643 and eicosatetro-
`enoic acid (ETYA) are selective PPARa activators; in
`chick, ETYA activates PPARa to a greater extent than
`Wy-14,643, as is the case in humans and Xenopus, but
`not in mouse (8, 9). Carbaprostacyclin is active on both
`PPARa and -b (but a .. b) and thiazolidinediones
`(BRL 49653, Glaxo Wellcome, Inc., Research Triangle
`Park, NC) are selective for PPARg as previously re-
`ported (5, 10). Among the fibrate derivatives, bezafi-
`brate and GW2331 (11) were capable of activating
`PPARb; other fibrates (fenofibrate and gemfibrozil)
`were active only on PPARa.
`the fibrates to activate
`This ability of some of
`cPPARb prompted us to compare the effect of beza-
`fibrate, GW2331, and carbaprostacyclin in the mam-
`malian and chick PPARb/ds. As shown in Fig. 2B, the
`responses elicited by bezafibrate and GW2331 were
`distinct between chick (c) and human (h). The potency
`of bezafibrate on cPPARbwas similar to that seen with
`
`1 The sequences reported in this paper have been depos-
`ited in the GenBank database [accession nos. AF163809
`(cPPARa), AF163810 (cPPARb/d), and AF163811 (cPPARg)].
`
`Fig. 1. Comparison of Chick PPARs with Human, Mouse,
`and Xenopus Counterparts
`A, Schematic of the DBDs and LBDs of cPPARs compared
`with the corresponding regions of the human, mouse, and
`Xenopus receptors. Numbers indicate percent identity to the
`corresponding cPPAR. B, Tree plot comparison of human (H),
`mouse (M), chick (C), and Xenopus (X) PPAR LBDs. Human
`RXRa was used as the root for this tree. 0.05 indicates the
`frequency of amino acid change (maximum is 1). The Clustal
`W program (7) was used for alignment.
`
`xPPARb(6). Carbaprostacyclin activated hPPARdand
`cPPARb with equal efficiency.
`To determine whether these compounds could di-
`rectly bind to PPARd/b, we used protease digestion
`assays. Addition of increasing concentrations of tryp-
`sin in the presence of 100 mM bezafibrate or 1 mM
`GW2331 to 35S-labeled cPPARb resulted in the ap-
`pearance of protease-resistant fragments of approxi-
`
`Bausch Health Ireland Exhibit 2038, Page 2 of 8
`Mylan v. Bausch Health Ireland - IPR2022-00722
`
`

`

`Generation of PPARd Phenotype
`
`735
`
`Downloaded from https://academic.oup.com/mend/article/14/5/733/2747718 by Finnegan, Henderson, Farabow, Garrett & Dunner, LLP user on 05 November 2022
`
`Fig. 2. Transcriptional Activity of GAL-cPPAR Fusion Receptors
`CV-1 cells were cotransfected with a reporter gene containing four copies of a GAL4 binding site (MH-100x4-tk-Luc) in the
`presence or absence of a chimeric receptor (GAL4-cPPARa,b,g). Activation of the luciferase reporter gene was measured in
`relative light units with b-galactosidase activity as a control for transfection efficiency and presented as fold activation. Ligand
`response data are derived from triplicate points from two independent experiments and represented as the mean 6 SE; n5 6.
`A, Comparison of the fold activities of cPPARa, -b, and -g by the indicated compounds. Numbers within brackets represent the
`ligand concentration in micromoles. cPGI, carbaprostacyclin, Wy; Wy-14,643, BF; bezafibrate, FF; fenofibrate, GF; gemfibrozil,
`GW; GW2331, BRL; BRL 49653. B, Chick and human GAL4-PPARb/ds were analyzed in cotransfection assays with bezafibrate,
`GW2331, and carbaprostacyclin. Bezafibrate and GW2331 appear specific for cPPARb. C, 35S-human and chick PPARd/b were
`preincubated for 30 min at 37 C with either 100 mM bezafibrate, 1 mM GW2331, or 100 mM carbaprostacyclin before addition of
`trypsin (final concentrations of 20 and 40 mg/ml, respectively). Proteolytic digestions were carried out at 37 C for 10 min, and then
`samples were denatured and electrophoresed on a 12.5% SDS-polyacrylamide gel. In the presence of bezafibrate and GW2331,
`only cPPARb shows protected fragments (arrows). Addition of carbaprostacyclin results in protected fragments for hPPARd and
`cPPARb (arrows).
`
`Bausch Health Ireland Exhibit 2038, Page 3 of 8
`Mylan v. Bausch Health Ireland - IPR2022-00722
`
`

`

`Downloaded from https://academic.oup.com/mend/article/14/5/733/2747718 by Finnegan, Henderson, Farabow, Garrett & Dunner, LLP user on 05 November 2022
`
`MOL ENDO · 2000
`736
`
`Vol 14 No. 5
`
`Table 1. Chemical Structures of the Compounds Used in This Study
`
`mately 32 kDa, 29 kDa, and 27 kDa (Fig. 2C, arrows),
`but no protected bands were observed with hPPARb.
`With carbaprostacyclin, protease-resistant fragments
`of similar sizes were observed with both human and
`chick PPARd/b. It is thus apparent that PPARb/d li-
`gands can be classified into those with species-selec-
`tive activity (bezafibrate, GW2331) and those without
`(carbaprostacyclin).
`To determine the region essential for ligand-selec-
`tive recognition by PPARb/d, we examined the struc-
`tures of the chick, Xenopus, mouse, and human ho-
`mologs (12–14). Although cPPARb LBD and xPPARb
`LBD share only 71% amino acid identity (216/303) vs.
`90% (272/303) between chick and human, the ligand
`activation properties of the cPPARbLBD more closely
`resemble those of Xenopus (6, 11). Detailed compar-
`ison of the LBD sequences of cPPARb with those of
`human, mouse, and Xenopus revealed that 200 amino
`acids (a.a.) are conserved with the remaining 103 a.a.
`varying between species.
`
`Taking into consideration the similarity in ligand
`response between chick and Xenopus, we focused
`on 9 a.a. that are conserved between chick and
`Xenopus, but not between chick and human/mouse.
`A series of chimeric human and chick PPARd/b ex-
`pression constructs were made in an attempt to
`further localize the key residues involved in the li-
`gand specification (Fig. 3A). Examination of the re-
`sponse of these receptors to bezafibrate, GW2331
`and carbaprostacyclin indicated that the domain
`spanning from the hinge region to helix 9 is not
`critical
`for
`recognition of either bezafibrate or
`GW2331 by the cPPARb, but that helix 10, contain-
`ing a net change of 3 a.a., was essential for recog-
`nition of both compounds (Fig. 3B).
`During the course of this work, we solved the crystal
`structure of the fibrate GW2331 bound to hPPARd
`(Fig. 4). As in the case of other PPAR ligands, the
`carboxylic acid of GW2331 (see Table 1) was found to
`form an intricate series of hydrogen bonds with histi-
`
`Bausch Health Ireland Exhibit 2038, Page 4 of 8
`Mylan v. Bausch Health Ireland - IPR2022-00722
`
`

`

`Generation of PPARd Phenotype
`
`737
`
`Downloaded from https://academic.oup.com/mend/article/14/5/733/2747718 by Finnegan, Henderson, Farabow, Garrett & Dunner, LLP user on 05 November 2022
`
`Fig. 3. The C-Terminal Region of cPPAR Is Required for Fibrate-Dependent Activity
`A, Schematic representations of chimeric GAL4-hPPARd/cPPARb fusion proteins (numbers indicate the a.a. position from the
`first methionine). Chimera 1 (open triangle) is a fusion of hPPARd (137–261) and cPPARb (264–443), chimera 2 (open circle)
`encodes a fusion of hPPARd (137–261), cPPARb (264–383), and hPPARd (382–441), and chimera 3 (solid circle) is a fusion of
`hPPARd(137–381) and cPPARb(384–443). B, Cotransfection experiments were performed as described in Fig. 2 with the addition
`of bezafibrate, GW2331, and carbaprostacyclin as indicated. Chimeras 1 and 3 showed response to bezafibrate and GW2331,
`and all constructs were responsive to carbaprostacyclin. Vertical axis represents fold activation.
`
`dine residues in helices 5 and 10 and a tyrosine in the
`AF-2 helix (15, 16). We postulate that this network of
`interactions effectively locks the receptor into a con-
`formation permissive for coactivator interactions. No-
`tably, M417 in helix 10 is bent into an unfavorable
`conformation for accommodation of the gem-dialkyl
`constituent of the GW2331 fibrate headgroup. The
`steric interference between M417 and the fibrate may
`explain the relatively low-affinity binding of GW2331 to
`hPPARd.
`
`Sequence comparison revealed that both the
`chick and Xenopus PPARb subtypes have a valine
`residue at the position analogous to M417. The
`shorter side chain of valine would be expected to
`better accommodate the gem-dialkyl substituent of
`the fibrate headgroup. These data suggested that
`this single residue might be a key determinant in the
`binding of fibrates to PPARs. To test this hypothe-
`sis, we constructed the following mutants (depicted
`in Fig. 5A); one in which M417 of hPPARd was
`
`Bausch Health Ireland Exhibit 2038, Page 5 of 8
`Mylan v. Bausch Health Ireland - IPR2022-00722
`
`

`

`Downloaded from https://academic.oup.com/mend/article/14/5/733/2747718 by Finnegan, Henderson, Farabow, Garrett & Dunner, LLP user on 05 November 2022
`
`MOL ENDO · 2000
`738
`
`Vol 14 No. 5
`
`Fig. 4. The hPPARd-GW2331 Cocrystal Structure
`Left panel, The hPPARdpolypeptide backbone is shown as a yellow ribbon. The carbon atoms of GW2331 are shown in green.
`The oxygen and fluorine atoms of GW2331 are shown in red and orange, respectively. Right panel, Close-up view of the fibrate
`headgroup of GW2331 bound to the hPPARd LBD. The carbon and oxygen atoms of GW2331 are shown in green and red,
`respectively. The side chains of M416 and M417 are shown with the carbon and sulfur atoms depicted in blue and orange,
`respectively. The side chain of M417 is bent into a high-energy configuration by the gem-dialkyl of GW2331.
`
`changed to valine (hPPARd417V) and the reverse
`where the corresponding valines of cPPARb and
`hPPARa were altered to methionine (cPPARb419M,
`hPPARa444M). Reporter assays confirmed that the
`substitution of a valine confers the ability for a fi-
`brate response to hPPARd417V and, reciprocally,
`replacement of
`the more compact valine with
`methionine results in loss of response to the fibrates
`(Fig. 5B). This alteration in ligand responsiveness
`was found to correlate with changes in ligand
`binding as inferred from protease digestion assays
`using functionally equivalent constructs (data not
`shown).
`In summary, the isolation and characterization of the
`cPPAR homologs have provided an opportunity to
`study how this class of receptors may have evolved.
`The chimeric analyses together with x-ray crystallo-
`graphic studies of
`the fibrate GW2331 bound to
`hPPARd allowed us to localize a difference in ligand
`responsiveness to M417 in helix 10 of the human
`receptor. This work illustrates that a single amino acid
`change may be sufficient to acquire a new ligand
`binding specificity as well as to suppress recognition
`of a previous ligand. Our data agree with and extend
`the observations of others who showed that changes
`in one or several amino acids can result in marked
`alterations in the ligand selectivity of nuclear receptors
`(9, 17). Alteration of a single amino acid would be the
`minimum change necessary to generate a functionally
`distinct receptor. In combination with a preexisting
`gene duplication, this represents the simplest concep-
`tual mechanism for the formation of a new receptor
`gene family.
`
`MATERIALS AND METHODS
`
`Isolation of cPPAR cDNAs
`
`cDNA clones encoding the cPPARs were obtained from
`7-week-old male broiler adipose tissue (Stratagene) and
`stage 17–18 chick embryonic lZAP cDNA libraries (18) with
`mouse PPARg (13) and mouse retinoid X receptor-b (RXRb)
`(19) cDNAs as probes using standard low-stringency hybrid-
`ization procedures. Insert cDNA fragments were recovered
`from purified positive clones into pBluescript vectors for re-
`striction enzyme mapping and DNA sequencing. Full-length
`cDNA sequences for each of three PPAR subtypes were
`assembled and analyzed by DNA sequencing using ALFex-
`press (Pharmacia Biotech, Piscataway, NJ).
`
`Plasmid Construction
`
`Full length coding sequences for cPPARa, PPARb, and PPARg
`were inserted into a pCMX expression vector (20), giving rise to
`pCMX-cPPARa, pCMX-cPPARb/d, and pCMX-cPPARg, re-
`spectively. GAL4 fusions of the PPAR LBDs were prepared by
`PCR amplification of the DNA fragments encoding the respec-
`tive LBDs from corresponding pCMX plasmid templates. Se-
`quences of primers used are TTGGGTTTGTCGACGGAATGT
`CACATAATGCAATACGT (forward) and TTTGGGTTTGGA-
`TCCAAAAATCCTTAATACATG TCCCT (reverse) for PPARa,
`TTGGTTGAATTCGGCATGTCACATAACGCAAT (forward) and
`TTTGGGTTTGTCGACAAGAGGTCCTTAGTACATGTCCTTGTA
`(reverse) for PPARb/d, and TTTGGGTTTGAATTCGGAATGT-
`CACATAATGCCATC (forward) and TGGGGTTTGGATC CGA-
`ACTACTATCGCCATTAATATAAGTC (reverse) for PPARg. The
`amplified DNA fragments were digested with SalI and BamHI for
`PPARa, EcoRI and SalI for PPARband PPARg, and inserted at
`the respective sites in the pCMX-GAL4 derivatives to prepare
`pCMX-GAL4-cPPARa, pCMX-GAL4-cPPARb, and pCMX-
`GAL4-cPPARg. GAL4 fusion constructs for the hPPARs were
`previously described (11).
`
`Bausch Health Ireland Exhibit 2038, Page 6 of 8
`Mylan v. Bausch Health Ireland - IPR2022-00722
`
`

`

`Generation of PPARd Phenotype
`
`739
`
`Downloaded from https://academic.oup.com/mend/article/14/5/733/2747718 by Finnegan, Henderson, Farabow, Garrett & Dunner, LLP user on 05 November 2022
`
`Fig. 5. A Single Amino Acid Residue Confers Subtype-Specific Ligand Recognition
`Data are represented as the mean 6 SE; n5 6. A, A schematic representation of GAL4-fusion point mutants; hPPARd417V (Met to
`Val change at position 417) and cPPARb419M, hPPARa444M (Val to Met change at positions 419 and 444, respectively). B The above
`constructs were analyzed in cotransfection experiments with 10 mM bezafibrate, 10 nM GW2331, and 10 mM carbaprostacyclin.
`
`Transactivation Assays
`
`Monkey kidney CV-1 cells were used for transfection assays
`in 24-well cluster tissue culture plates by calcium phosphate
`precipitation (21). Transfection mixtures contained 50 ng of
`receptor expression plasmid, 150 ng of MH100x4-tk-luc re-
`porter plasmid, 350 ng of pCMX-bGAL as control for trans-
`fection efficiency, and 200 ng of pGEM4 carrier plasmid.
`Cells were transfected for 7 h, washed, and incubated for
`approximately 36 h in serum-free media containing 5 mg/ml
`insulin, 5 mg/ml transferrin, 0.01% fatty acid free BSA, plus
`ligand compounds where indicated, before harvesting and
`luciferase and b-galactosidase activity. All
`assaying for
`points were performed in triplicate and repeated at least
`twice in independent experiments with variations of less than
`10%.
`
`Mutagenesis
`
`GAL4 fusions of chimeric constructs encoding hPPARd and
`cPPARb LBDs were prepared as follows. Chimera 1 was
`prepared by digestion of cPPARb/d with SacI/BglII and liga-
`tion into respective sites of pCMX-GAL4 hPPARd. Chimera 2
`was prepared by PCR amplification of chimera 1 and ligation
`to the C-terminal region of hPPARd. Sequences of primers
`used are TTTGTCGACGGCATGTCACACAACGCTATCCG
`(forward) and GGACTGCAGGTGGAATTCCAGTG (reverse).
`Amplified DNA fragments were digested with SalI/EcoRI and
`ligation into respective sites of pCMX-GAL4-hPPARd. Chi-
`mera 3 was prepared by PCR amplification from pCMX-
`cPPARb and ligation to pCMX-hPPARd. Primer sequences
`used are CACTGGAATTCCACCTGCAGTCC (forward) and
`TTTGGGTTTGTCGACAAGAGG TCCTTAGTACATGTCCTT-
`
`GTA (reverse). The amplified DNA fragments were digested
`with EcoRI and BglII and inserted at the respective sites in
`pCMX-GAL4-hPPARd.
`GAL4 fusions of the mutant hPPARa and -d and cPPARb
`LBD were prepared by PCR amplification first on N-terminal and
`mutated sites and subsequently on mutated sites and C termini.
`N-terminal and C-terminal primers were used to obtain the
`full-length construct. Primer sequences used for hPPARd417V,
`TTTGTCGACGGCATGTCACACAACGCTATCCG (forward) and
`CCGCTGAACCATCTGGGCGTGCTCG (reverse), were for N-
`terminal fragment; CGAGCACGCCCAGATGGTTCAGCGG (for-
`ward) and TTTGGATCCTTAGTACATGTCCT TGTAGATCTC-
`CTGGAGC (reverse) were for C-terminal fragment. In cPPAR-
`b419M, TGGGTTTGAATTCGGCATGTCACATAACGCAATCC
`(forward) and CTGCATCAGCTGGG CGTGC (reverse) were for
`N-terminal fragment; GCACGCCCAGCTGATGCAG (forward)
`and TTTGGGTTTGTCGACAAGAGGTCCTTAGTACATGTCCT-
`TGTA (reverse) were for C-terminal fragment. In hPPARa444M,
`TTTGGGGGTCGACTCACACAACGCGATTCGTTT TGG (for-
`ward) and CTGCATCAGCTGCGCATGCT (reverse) are for N-
`terminal
`fragment; AGCATGCGCAGCTGATGCAG (forward)
`and TTTGGGGATCCTCAGTACATGTCCCTG TAGATCT (re-
`verse) are for C-terminal fragment. All constructs were con-
`firmed by DNA sequencing using ALFexpress (Pharmacia
`Biotech).
`
`Protease Digestion Assay
`
`35S-radiolabeled proteins were synthesized from 1 mg of
`pCMX-PPARs by the reticulocyte lysate system (Promega
`Corp.). Of the total 40 ml of labeled in vitro translated PPAR
`proteins, 15 ml were preincubated for 30 min at 37 C in 40 ml
`of binding buffer [final 10 mM Tris-HCl, pH 8.0, 80 mM KCl,
`
`Bausch Health Ireland Exhibit 2038, Page 7 of 8
`Mylan v. Bausch Health Ireland - IPR2022-00722
`
`

`

`Downloaded from https://academic.oup.com/mend/article/14/5/733/2747718 by Finnegan, Henderson, Farabow, Garrett & Dunner, LLP user on 05 November 2022
`
`MOL ENDO · 2000
`740
`
`Vol 14 No. 5
`
`0.1% NP40, 7% glycerol, 1 mM dithiothreitol (DTT)] with ac-
`tivators (bezafibrate, carbaprostacyclin, GW2331) that were
`dissolved in 13 binding buffer. Protease digestion assays
`were initiated by the addition of 2 ml of 53 stock solution of
`trypsin to 8 ml of translation products and carried out for 10
`min at 37 C. Reactions were stopped by addition of 10 ml of
`23 loading buffer (62.5 mM Tris HCl, pH 6.8, 2% SDS, 10%
`glycerol, 50 mM DTT, 5 mg/ml bromophenol blue). Samples
`were loaded and electrophoresed on a 12% acrylamide-SDS
`gel, and the gel was dried under vacuum for 2 h and analyzed
`using BAS Imager (FUJIX, Tokyo, Japan).
`
`Crystallography
`
`The procedures for determining the cocrystal structure of
`GW2331 bound to the hPPARd LBD, including the protein
`purification, crystal growth, and structure refinement, were
`performed as previously described (16). The structure was
`determined at 2.5 A resolution and was refined with an R
`factor of 28.3% (31.4% for the free R), which revealed clear
`electron density for GW2331 and the LBD pocket residues
`surrounding the compound.
`
`Acknowledgments
`
`We thank K. Yasuda for his support during the early part of
`this project, T. Willson, H. Oizumi, and members of the Ume-
`sono laboratory for valuable advice and discussion, and E.
`Stevens for administrative assistance.
`
`Received December 10, 1999. Revision received January
`25, 2000. Accepted January 27, 2000.
`Institute
`Address requests for reprints to: Ruth T. Yu,
`for Virus Research, Kyoto University, 53 Kawaharacho,
`Shogoin, Sakyoku, Kyoto 606-8507, Japan. E-mail: rtyu@
`virus.kyoto-u.ac.jp.
`This work was supported in part by grants from Japan
`Society for Promotion of Science and Human Frontiers Sci-
`ence Program. This paper is dedicated to K. Umesono.
`* Deceased April 12, 1999.
`
`REFERENCES
`
`1. Sorensen HN, Treuter E, Gustafsson JA 1998 Regulation
`of peroxisome proliferator-activated receptors. Vitam
`Horm 54:121–166
`2. Kliewer SA, Lehmann JM, Willson TM 1999 Orphan nu-
`clear receptors: shifting endocrinology into reverse. Sci-
`ence 284:757–760
`3. Berger J, Leibowitz MD, Doebber TW, Elbrecht A, Zhang
`B, Zhou G, Biswas C, Cullinan CA, Hayes NS, Li Y, Tanen
`M, Ventre J, Wu MS, Berger GD, Mosley R, Marquis R,
`Santini C, Sahoo SP, Tolman RL, Smith RG, Moller DE
`1999 Novel peroxisome proliferator-activated receptor
`(PPAR)g and PPARd ligands produce distinct biological
`effects. J Biol Chem 274:6718–6725
`4. Brown PJ, Smith-Oliver TA, Charifson PS, Tomkinson
`NC, Fivush AM, Sternbach DD, Wade LE, Orband-Miller
`L, Parks DJ, Blanchard SG, Kliewer SA 1997 Identifica-
`tion of peroxisome proliferator-activated receptor ligands
`from a biased chemical library. Chem Biol 4:909–18
`5. Forman BM, Chen J, Evans RM 1997 Hypolipidemic
`drugs, polyunsaturated fatty acids, and eicosanoids are
`ligands for peroxisome proliferator-activated receptors a
`and d Proc Natl Acad Sci USA 94:4312–4317
`6. Krey G, Braissant O, L’Horset F, Kalkhoven E, Perroud M,
`Parker MG, Wahli W 1997 Fatty acids, eicosanoids, and
`
`hypolipidemic agents identified as ligands of peroxisome
`proliferator- activated receptors by coactivator-depen-
`dent receptor ligand assay. Mol Endocrinol 11:779–791
`7. Thompson JD, Higgins DG, Gibson TJ 1994 CLUSTAL
`W: improving the sensitivity of progressive multiple se-
`quence alignment through sequence weighting, position-
`specific gap penalties and weight matrix choice. Nucleic
`Acids Res 22:4673–4680
`8. Mukherjee R, Jow L, Noonan D, McDonnell DP 1994
`Human and rat peroxisome proliferator activated recep-
`tors (PPARs) demonstrate similar tissue distribution but
`different responsiveness to PPAR activators. J Steroid
`Biochem Mol Biol 51:157–166
`9. Keller H, Devchand PR, Perroud M, Wahli W 1997 PPARa
`structure-function relationships derived from species-
`specific differences in responsiveness to hypolipidemic
`agents. J Biol Chem 378:651–655
`10. Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO,
`Willson TM, Kliewer SA 1995 An antidiabetic thiazo-
`lidinedione is a high affinity ligand for peroxisome prolif-
`erator-activated receptor g ( PPAR g). J Biol Chem 270:
`12953–12956
`11. Kliewer SA, Sundseth SS, Jones SA, Brown PJ, Wisely
`GB, Koble CS, Devchand P, Wahli W, Willson TM, Len-
`hard JM, Lehmann JM 1997 Fatty acids and eicosanoids
`regulate gene expression through direct interactions with
`peroxisome proliferator-activated receptors a and g.
`Proc Natl Acad Sci USA 94:4318–4323
`12. Dreyer C, Krey G, Keller H, Givel F, Helftenbein G, Wahli
`W 1992 Control of the peroxisomal b-oxidation pathway
`by a novel family of nuclear hormone receptors. Cell
`68:879–887
`13. Kliewer SA, Forman BM, Blumberg B, Ong ES, Borg-
`meyer U, Mangelsdorf DJ, Umesono K, Evans RM 1994
`Differential expression and activation of a family of mu-
`rine peroxisome proliferator-activated receptors. Proc
`Natl Acad Sci USA 91:7355–7359
`14. Schmidt A, Endo N, Rutledge SJ, Vogel R, Shinar D,
`Rodan GA 1992 Identification of a new member of the
`steroid hormone receptor superfamily that is activated by
`a peroxisome proliferator and fatty acids. Mol Endocrinol
`6:1634–1641
`15. Nolte RT, Wisely GB, Westin S, Cobb JE, Lambert MH,
`Kurokawa R, Rosenfeld MG, Willson TM, Glass CK, Mil-
`burn MV 1998 Ligand binding and co-activator assembly
`of the peroxisome proliferator-activated receptor-g. Na-
`ture 395:137–43
`16. Xu HE, Lambert MH, Montana VG, Parks DJ, Blanchard
`SG, Brown PJ, Sternbach DD, Lehmann JM, Wisely GB,
`Willson TM, Kliewer SA, Milburn MV 1999 Molecular rec-
`ognition of fatty acids by peroxisome proliferator-acti-
`vated receptor. Mol Cell 3:397–403
`17. Peet DJ, Doyle DF, Corey DR, Mangelsdorf DJ 1998
`Engineering novel specificities for ligand-activated tran-
`scription in the nuclear hormone receptor RXR. Chem
`Biol 5:13–21
`18. Yu RT, McKeown M, Evans RM, Umesono K 1994 Re-
`lationship between Drosophila gap gene tailless and a
`vertebrate nuclear receptor Tlx. Nature 370:375–379
`19. Mangelsdorf DJ, Borgmeyer U, Heyman RA, Zhou JY,
`Ong ES, Oro AE, Kakizuka A, Evans RM 1992 Charac-
`terization of three RXR genes that mediate the action of
`9-cis retinoic acid. Genes Dev 6:329–344
`20. Umesono K, Murakami KK, Thompson CC, Evans RM
`1991 Direct repeats as selective response elements for
`the thyroid hormone, retinoic acid, and vitamin D3 recep-
`tors. Cell 65:1255–1266
`21. Umesono K, Evans RM 1989 Determinants of target gene
`specificity for steroid/thyroid hormone receptors. Cell
`57:1139–1146
`
`Bausch Health Ireland Exhibit 2038, Page 8 of 8
`Mylan v. Bausch Health Ireland - IPR2022-00722
`
`