`© 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
`
`Vol. 275, No. 33, Issue of August 18, pp. 25155- 25162, 2000
`Printed in U.S.A.
`
`Dual Function of the Propeptide of Prouroguanylin in the Folding
`of the Mature Peptide
`DISULFIDE-COUPLED FOLDING AND DIMERIZATION*
`
`Received for publication, January 18, 2000, and in revised form, May 15, 2000
`Published, JBC Papers in Press, May 25, 2000, DOI 10.1074/jbc.M000543200
`
`Yuji Hidaka:j:§, Chisei Shimono:j:, Megumu Ohno:j:, Nobuaki Okumura11, Knut Adermannll,
`Wolf-Georg Forssmannll, and Yasutsugu Shimonishi:j:
`From the :j:Division of Organic Chemistry and 11Division of Protein Metabolism, Institute for Protein Research, Osaka
`University, Yamadaoka 3-2, Suita, Osaka 565-0871, Japan and the IILower Saxony Institute for Peptide Research, Feodor(cid:173)
`Lynen-Strasse 31, D-30625 Hannover, Germany
`
`Guanylyl cyclase activating peptide II (GCAP-11), an
`endogenous ligand of guanylyl cyclase C, is produced
`via the processing of the precursor protein (prepro(cid:173)
`GCAP-11). We have previously shown that the propep(cid:173)
`tide in pro-GCAP-11 functions as an intramolecular
`chaperone in the proper folding of the mature peptide,
`GCAP-11 (Hidaka, Y., Ohno, M., Hemmasi, B., Hill, 0.,
`Forssmann, W.-G., and Shimonishi, Y. (1998) Biochemis(cid:173)
`try 37, 8498-8507). Here, we report an essential region in
`pro-GCAP-11 for the correct disulfide pairing of the ma(cid:173)
`ture peptide, GCAP-11. Five mutant proteins, in which
`amino acid residues were sequentially deleted from the
`N terminus, and three mutant proteins of pro-GCAP-11,
`in which N-terminal 6, 11, or 17 amino acid residues
`were deleted, were overproduced using Escherichia coli
`or human kidney 293T cells, respectively. Detailed anal(cid:173)
`ysis of in vivo or in vitro folding of these mutant proteins
`revealed that one or two amino acid residues at the N
`terminus of pro-GCAP-11 are critical, not only for the
`chaperone function in the folding but also for the net
`stabilization of pro-GCAP-11. In addition, size exclusion
`chromatography revealed that pro-GCAP-11 exists as a
`dimer in solution. These data indicate that the propep(cid:173)
`tide has two roles in proper folding: the disulfide-cou(cid:173)
`pled folding of the mature region and the dimerization
`of pro-GCAP-11.
`
`Endogenous peptide hormones are often synthesized in vivo
`in the form of precursor proteins with pre- (or signal) and
`prepro-leader sequences, which are subsequently processed
`into biologically active mature peptides after their release from
`the ribosome (1). Little is known, however, concerning the role
`of the propeptide in the pro-leader sequence in the processing of
`precursor proteins to the mature peptide hormones or their
`function in the folding process, which results in the mature
`hormones. Guanylin and uroguanylin (2-4), endogenous li(cid:173)
`gands of particulate guanylyl cyclase C (GC-C)1 (5), are thought
`
`to function in regulating the level of cGMP as a second mes(cid:173)
`senger in intestinal and kidney cells, i.e. the regulation of
`chloride and water secretion from the inside of these cells to the
`outside (6, 7). Guanylin and uroguanylin are generated as
`precursor proteins (preproguanylin (prepro-GCAP-I) or pre(cid:173)
`prouroguanylin (prepro-GCAP-II), respectively), which contain
`the prepro-leader sequences which precede the mature portion.
`After cleavage of the pre-sequence, pro-GCAP-I and/or pro(cid:173)
`GCAP-II are further processed to give the mature peptides,
`guanylin or uroguanylin (Fig. 1). GCAP-II, a plasma form of
`uroguanylin, is one of the mature forms ofpro-GCAP-II in vivo
`(4, 8, 12, 14-16). Recent studies in this laboratory have shown
`that spontaneous refolding to the native conformation is at(cid:173)
`tained in pro-GCAP-II but not in GCAP-II (17), i.e. GCAP-II
`requires the propeptide, in order to efficiently fold into the
`bioactive form .
`There are a few examples, such as subtilisin, a-lytic prote(cid:173)
`ase, etc., in which the peptides of the pro-leader sequences in
`the precursor proteins aid the mature proteins in the proper
`assembly of the three dimensional structures in vitro and are
`referred to as "intramolecular chaperones" (18-20). The ma(cid:173)
`ture proteins are produced by enzymatic cleavage of the pep(cid:173)
`tides in the pro-leader sequences from the folded precursor
`proteins . In these examples, the peptides in the pro-leader
`sequences function not only to diminish the activation energy
`but also to stabilize the rate-determining transition state(s) in
`the folding pathway (20, 21). Moreover, the N-terminal peptide
`in the pro-leader sequence of prosubtilisin, the precursor pro(cid:173)
`tein of subtilisin, mediates the folding of the protein intermo(cid:173)
`lecularly. Prosubtilisin exists as homodimer that is assembled
`during the folding of the protein (21, 22). However, the mech(cid:173)
`anism, at the molecular level, of the folding of these proteins
`via the peptides in the pro-leader sequence remains unclear.
`In a recent study, it was demonstrated that guanylin, which
`is homologous to GCAP-II, requires the assistance of the
`propeptide of the precursor protein, pro-GCAP-I, not only to
`achieve correct folding but also for the formation of the native
`disulfide linkages (23). These findings, and our previous stud(cid:173)
`ies, led us to conclude that the propeptide in the pro-leader
`sequence of pro-GCAP-I and pro-GCAP-II plays a functional
`role as an intramolecular chaperone in the correct folding of the
`mature peptide and is also crucial for the disulfide-coupled
`folding of the reduced precursor (17, 23). Furthermore, these
`studies have led us to propose that the mature form of pro(cid:173)
`GCAP-II, GCAP-II, is not at the thermodynamic ground state
`
`* The costs of publication of this article were defrayed in part by the
`payment of page charges. This article must therefore be hereby marked
`"advertisement" in accordance with 18 U.S.C. Section 1734 solely to
`indicate this fact.
`§To whom correspondence should be addressed. Fax: 81-6-6879-8603;
`E-mail: yuji@protein.osaka-u.ac.jp.
`1 The abbreviations used are: GC-C, guanylyl cyclase C; GCAP-11,
`guanylyl cyclase-activating peptide II (the plasma form ofuroguanylin);
`pro-GCAP-1, proguanylin; pro-GCAP-11, prouroguanylin; prepro(cid:173)
`GCAP-1, preproguanylin; prepro-GCAP-11, preprouroguanylin; Arg-C,
`performance liquid chromatography; DTT, dithiothreitol; IGD, insulin(cid:173)
`arginylendopeptidase C; DMEM, Dulbecco's modified Eagle's medium;
`like growth factor.
`FBS, fetal bovine serum; PCR, polymerase chain reaction; HPLC, high
`25155
`
`This paper is available on line at http:/ /www.jbc.org
`
`This is an Open Access article under the CC BY license.
`
`Bausch Health Ireland Exhibit 2009, Page 1 of 8
`Mylan v. Bausch Health Ireland - IPR2022-00722
`
`
`
`25156
`
`Folding and Dimerization of Prouroguanylin
`
`but, rather, is kinetically trapped in the precursor protein (17).
`Consequently, these studies raised questions as to which re(cid:173)
`gion(s) of the protein, or the manner in which the pro-leader
`sequence of pro-GCAP-11, contributes to the correct folding of
`the mature peptide.
`In this report, we provide evidence that the amino acid
`residues at the N terminus of the pro-leader sequence are
`heavily involved in the correct assembly of the three dimen(cid:173)
`sional structure ofpro-GCAP-11 and, in turn, ofGCAP-11. These
`residues function to stabilize the bioactive form of the mature
`portion during the folding of the entire protein. Moreover, we
`provide evidence that supports the existence of a homodimer,
`which is stabilized by intermolecular and non-covalent inter(cid:173)
`actions between the region in the pro-leader sequence and,
`possibly, in the intermediate as well as the final steps of the
`folding process. The data obtained provide basic information,
`which is critical for our understanding of the role of the pro(cid:173)
`leader sequence of the precursor proteins during the matura(cid:173)
`tion of peptide hormones, such as GCAP-11 and guanylin.
`
`EXPERIMENTAL PROCEDURES
`Materials -Restriction enzymes were purchased from Toyobo
`(Osaka, Japan) and New England Biolabs (Beverly, MA). Taq polym(cid:173)
`erase, T4 DNA ligase, and endoproteinase Arg-C were obtained from
`Takara Shuzo Co. (Kyoto, Japan). Dulbecco's modified Eagle's medium
`(DMEM) and fetal bovine serum (FBS) were purchased from Nissui
`Pharmaceutical, Co. (Tokyo, Japan) and Dainippon Pharmaceutical,
`Co. (Osaka, Japan), respectively. Thr-Ile-Ala-uroguanylin and its disul(cid:173)
`fide isomers were synthesized according to a previously described pro(cid:173)
`cedure (17). All other chemicals and solvents were reagent grade. PCR
`was carried out using a Sanyo DNA amplifier MIR-D30 (Osaka, Japan).
`Construction of Expression Vectors of the Deletion Mutants for and
`Their Expression by E. coli Cells-The cDNAs encoding the deletion
`mutant proteins were subcloned into a pETl 7b expression vector (No(cid:173)
`vagen), following the introduction, by means of PCR, of an Ndel site at
`its 5' end and a Xhol site at its 3' end using pEX2 as a template. The
`cDNA sequences of the vectors were confirmed as described above. E.
`coli BL21(DE3) cells, which were transformed with the expression
`vector, was cultured at 37 °C in Luria broth medium supplemented
`with ampicillin (50 mg/liter). The production of the mutant proteins was
`induced by the addition of 1 mM isopropyl-l-thio-/3 -o-galactopyranoside
`at the mid-log phase of cell growth. After incubation at 37 °C for 3 h , the
`cells were harvested and washed with phosphate-buffered saline with(cid:173)
`out magnesium and calcium ions, containing 1 % Triton and 1 mM
`phenylmethylsulfonyl fluoride. The cells were resuspended in the same
`buffer, sonicated on ice, and centrifuged (15,000 x g , 20 min). The
`mutant proteins, isolated as an inclusion body, possessed the Met
`residue at the N terminus derived from the Ndel site during subcloning.
`The proteins thus prepared were characterized by mass spectrometry
`and amino acid analysis.
`Construction of Expression Vectors of Deletion Mutants for Human
`Embryonic Kidney 293T Cells-The pEX2 vector derived from the
`pcDNA3 vector (lnvitrogen), which contains a strong cytomegalovirus
`enhancer-promoter sequence for a high level of protein expression in
`mammalian cells (17), was used in this experiment. The construction of
`the expression vectors of the N-terminal deletion mutants of pro(cid:173)
`GCAP-II was carried out as follows. The pEX2 vector, which carries a
`cDNA encoding pre-pro-GCAP-II between a BamHl site at its 5' end
`and a Xbal site at its 3' end (8), was employed as a template for the
`construction of the expression vectors in carrying the cDNAs of the
`N-terminal deletion mutant proteins of pro-GCAP-II. To efficiently use
`the signal sequence (the pre-region of pre-pro-GCAP-II) for the expres(cid:173)
`sion of the mutant proteins, the cDNA fragment from a BamHl site to
`the end of the signal sequence was amplified by PCR using the pEX2
`vector as a template and a sense (ATATAGGATCCAGGGAGCGC(cid:173)
`GATG) as primer 1 and an antisense (TCTCTCTAGAGAATTCCTC(cid:173)
`GAGTGACTGTGTGCTCTG) as primer 2. The cDNA fragment encod(cid:173)
`ing the signal sequence was inserted between the BamHl and Xbal
`sites ofpEX2, resulting in the construction ofpcDNA3H, which contains
`a unique Xhol site after the signal sequence between the BamHl site
`and the Xbal site. The cDNAs encoding the deletion mutant proteins
`were prepared by PCR and subcloned into the site between the Xhol site
`and the Xbal site in pcDNA3H. The resulting expression vectors com(cid:173)
`prised the cDNA sequences, which encode the signal peptide ofpre-pro(cid:173)
`GCAP-II and each of the deletion mutant proteins, pro-GCAP-II-(7-86),
`
`pro-GCAP-Il-(12-86), and pro-GCAP-Il-(18-86). The mutant proteins
`(pro-GCAP-II-(7-86) and pro-GCAP-Il-(18-86)) contained two addi(cid:173)
`tional amino acid residues, which are derived from the Xhol site in the
`expression vector, at their N termini. The cDNA sequences of the
`vectors thus constructed were confirmed by analysis using an Applied
`Biosystems 373A sequencing system.
`Expression of Deletion Mutants in 293T Cells-Human embryonic
`kidney 293T cells (24) were maintained in 10% FBS/DMEM and trans(cid:173)
`ferred in a 10-cm diameter plate at 60-80% confluence with 20 µ,g of
`each of the expression vectors and the SuperFect reagent (Qiagen,
`Hilden, Germany) according to the manufacturer's specifications. After
`incubation for 16 h , the medium was replaced by DMEM (10 ml/plate)
`without FBS and the cells were incubated for an additional 2 days at
`37 °C in a CO2 incubator.
`Purification of the Recombinant Proteins Expressed by E.coli Cells or
`Human Kidney 293T Cells-The recombinant proteins, which were
`expressed as inclusion bodies in E. coli cells, were treated with 20 eq of
`DTT in 50 mM Tris/HCl (pH 8.0) (200 µ,l ) containing 6 M guanidine HCl
`under an N2 atmosphere at 50 °C for 1 h . The supernatant of the
`reaction mixture or the culture medium (20 ml) of the 293T cells were
`applied to a column of Cosmosil 140C18-OPN (1 ml) (Nacarai Tesque
`Inc., Kyoto, Japan) pre-equilibrated with and washed with 20 ml of
`solvent A (20% CH3CN in 0.05% trifluoroacetic acid). The adsorbed
`proteins, which were eluted with solvent B (80% CH3CN in 0.05%
`trifluoroacetic acid), were collected and lyophilized. The protein was
`purified by HPLC and analyzed by mass spectrometry, as described
`previously (17). The yield of the purified protein was 0.5-1 nmol/10 ml
`of the culture medium of 293T cells, as estimated by amino acid
`analyses.
`Endoproteinase Arg-C Digestion of the Recombinant Proteins-The
`recombinant protein (1 nmol) was incubated with endoproteinase Arg-C
`(50 pmol) in 0.1 M Tris/HCl (pH 8.0) (200 µ,I) at 37 °C for 18 h . The digest
`was treated with anhydrotrypsin agarose as described previously (17),
`and the supernatant was subjected to HPLC. The eluates were analyzed
`by mass spectrometry and amino acid analysis.
`Gel Filtration Chromatography -The HPLC apparatus consisted of
`a Waters 600 multisolvent delivery system (Bedford, MA) equipped
`with a Hitachi L-3000 photodiode array detector and a D-2000 chro(cid:173)
`mato-integrator (Tokyo, Japan). The protein (1 nmol) was dissolved in
`50 mM Tris/HCl (pH 7.4) (50 µ,l ) containing 0.2 M NaCl and chromato(cid:173)
`graphed on a TSK-Gel G3000SW= column (7.8 x 300 mm; Tosoh,
`Tokyo, Japan). The protein was eluted with 50 mM Tris/HCl (pH 7.4)
`containing 0.2 M NaCl at a flow rate of0.8 ml/min, and the eluate was
`monitored at 220 nm. The molecular mass of the protein was calibrated
`using a gel filtration calibration kit (Amersham Pharmacia Biotech)
`containing bovine serum albumin (67 kDa), ovalbumin (43 kDa), RNase
`A (13.7 kDa), and thioredoxin (20 kDa). Thioredoxin was prepared from
`E. coli cells transformed with pET32b (Novagen), which possesses the
`cDNA encoding thioredoxin, purified on a nickel-nitrilotriacetic acid
`resin (Qiagen), and identified by mass spectrometric analysis.
`In Vitro Complementary Refolding of Pro-GCAP-II-(7-86) and Pro(cid:173)
`GCAP-Il-(12-86)-The fully reduced pro-GCAP-Il-(12-86) was pre(cid:173)
`pared as follows . The protein (2 nmol) was incubated with 20 eq ofDTT
`in 50 mM Tris/HCl (pH 8.0) (200 µ,l ) containing 6 M guanidine HCl under
`an N2 atmosphere at 50 °C for 1 h. The reduced pro-GCAP-Il-(12-86)
`was purified by HPLC, as described above, and lyophilized. The reduced
`pro-GCAP-Il-(12-86) (1 nmol) was dissolved in 0.05% trifluoroacetic
`acid (20 µ,I) and mixed with 9 volumes of 50 mM Tris/HCl (pH 8.0) in the
`presence of 2 mM GSH and 1 mM GSSG as described previously, and
`incubated at room temperature for 2 days. The oxidative refolding
`experiment was also carried out in the redox buffer in the presence of
`the synthetic complementary N-terminal peptides (VYIQYQ or
`VYIQYQGFRVQ). The reaction mixture was analyzed by HPLC. All
`solutions used for the refolding experiment were flushed with N2 , and
`the reaction was carried out in a sealed vial under an atmosphere ofN2 •
`
`RESULTS AND DISCUSSION
`Mutational Analysis of the N-terminal Amino Acids for a
`Role in the in Vitro Folding of Pro-GCAP-II-ln a previous
`report, we demonstrated that the mature form ofGCAP-11 does
`not possess sufficient information to permit for its correct fold(cid:173)
`ing and that the propeptide in pro-GCAP-11 aids in the folding
`process, yielding only the bioactive form of GCAP-11 (17). This
`result provided confirmation that the function of the propeptide
`in the pro-leader sequence of pro-GCAP-11 was to serve as an
`intramolecular chaperone in the folding of GCAP-11, and con-
`
`Bausch Health Ireland Exhibit 2009, Page 2 of 8
`Mylan v. Bausch Health Ireland - IPR2022-00722
`
`
`
`Folding and Dimerization of Prouroguanylin
`
`25157
`
`proGCAP-11
`
`GCAP-11
`
`Human
`Pig
`Rot
`Mouse
`Opossum
`Guinea
`
`Secondary
`structure
`
`SSSSSS--HHttiHHHHHHHHHHHHTT T-TTHHHHHHHHHH-
`
`TTTTTTTT --TTT T - - - - -TTTTTSSSSS-TTTT
`
`FIG. 1. Primary and predicted secondary structures of prouroguanylin for human (8), pig (EMBI/GenBank/DDBJ accession
`number 013009), rat (EMBI/GenBank/DDBJ accession number P70668), mouse (11), opossum (12), and guinea pig (EMBI/GenBank/
`DDBJ accession number P70107). Numbers on figure refer to the amino acid sequence of human prouroguanylin. Completely matched amino
`, Cys 74 and Cys8 2
`, and Cys77 and Cys8 5 (17). Single-letter codes
`acid residues are shaded. Disulfide linkages are between positions Cys 41 and Cys54
`for amino acid residues are used. The H , S, and Tin the secondary structure represent a -helix, /3-sheet, and /3-turn, respectively.
`
`ratio or isomers
`_______ p_ro_-r_e_gi_on _______ G_ C_A_P_-_11 _. naiive : isomer I : iJomcr 2
`
`FIG. 2. Schematic representation of
`the recombinant wild-type prouro(cid:173)
`guanylin and N-terminal deletion
`mutant proteins prepared in this
`study.
`
`wild-type proGCAP-11
`
`Q I M~YIQ~va§::===nr·:··:rr· ·m·-·:··rr···:rr··m···J··rr···:··:rr···m··J···:··:rr··m···J·:]·j,½~"~-~"~""~""~aj
`~I Mta~ v§:a====rl:J;!·J:::J:;J:::J;:J;:;J:;J:: J;:J::::J::J:;:J::J;::J::J:::J::]:i§~N{~~~~¾\.:~#
`
`Mc t'-proGCAP-11 (2-86)
`Met2-proGCAP-Il (3-86)
`Met1-pro0CAP-ll (4-86)
`!::::::::::::::::::::::::::::::::::::::::::)~
`Met1•2-proGCAP-11 (3-86) ! 1Nav0
`@
`m OFRVOlESMIO( I;:;:::::::::::::::::::::::: :::::;:; ;;;:; :;;IWQ @
`proGCAJ>-IJ (7-86)
`
`~QYQ
`
`1: ND : ND
`
`1 : 0.22 : 0.21
`
`1 : 1.14 : 0.82
`
`1 : 4.4 : 2.1
`
`1 : 0.27 : 0.18
`
`proGCAP-11 (12-86)
`
`proGCAP-11 (18-86)
`
`sequently raised a number of questions, such as (i) which
`region(s) in the pro-leader sequence ofpro-GCAP-11 contribute
`to the correct folding of the mature peptide, and (ii) how does
`the propeptide play a role in the folding ofGCAP-11 in vivo and
`in vitro?
`To address these problems, we first searched the sequence
`motif(s) in the pro-leader sequence of pro-GCAP-11 in the pri(cid:173)
`mary structures ofpro-GCAP-Ils, which have been determined
`thus far, and then deduced the secondary structure of pro(cid:173)
`GCAP-11 using the Chou-Fasman method (25), as shown in Fig.
`1. The amino acid sequences of the N-terminal region (amino
`acid residues 1-23) and the C-terminal region (amino acid
`residues 38-65) in the pro-leader sequence ofpro-GCAP-11 are
`highly homologous in all species, whereas that in the central
`region (amino acids 24-37) is diverse. This raises the possibil(cid:173)
`ity that the N-terminal region (amino acid residues 1-23),
`along with the C-terminal region (amino acid residues 38-65),
`acts as an intramolecular chaperone for the correct folding of
`pro-GCAP-11 to yield the bioactive conformation of the mature
`peptide, GCAP-11. Further, the secondary structure prediction
`implied that the N-terminal region (amino acids 1-6) and the
`C-terminal region (LCVNV, amino acid residues 76-80) in the
`mature region exist as /3-strands, not only in pro-GCAP-11, but
`also in pro-GCAP-1. Schulz et al. (23) recently demonstrated
`that the N-terminal region (amino acids 1-5) is in close prox(cid:173)
`imity to the C-terminal region (a portion of guanylin) in the
`solution structure ofpro-GCAP-1, as evidenced by NMR meas(cid:173)
`urement. This may be extended to the speculation that the
`N-terminal region shares a characteristic secondary structure
`of pro-GCAP-1 with the C-terminal mature region. A similar
`molecular conformation may be imagined in the structure of
`pro-GCAP-11, since it is likely that pro-GCAP-11 has a confor(cid:173)
`mation similar to that ofpro-GCAP-1, i.e. it is possible that the
`N-terminal region (amino acids 1-23) in the pro-leader se(cid:173)
`quence of pro-GCAP-11 interacts with the C-terminal mature
`region. This interaction may lead to the proper folding of pro-
`
`GCAP-11 and contribute to the stabilization of the three dimen(cid:173)
`sional structure of the mature portion ofpro-GCAP-11, GCAP-11.
`To examine the nature of the participation of the N-terminal
`region in the pro-leader sequence ofpro-GCAP-11 in terms of its
`correct folding, we prepared a series of mutant proteins of
`pro-GCAP-11, in which the N-terminal amino acid residues
`were sequentially deleted from the N terminus ofpro-GCAP-11
`(Fig. 2) . The recombinant proteins were generated using E . coli
`BL21(DE3) cells. All mutant proteins were expressed with an
`additional Met residue at their N termini, which originated
`from the starting codon. For example, the deletion of a Val
`residue at the N terminus of pro-GCAP-11 resulted in the pro(cid:173)
`duction of the mutant protein, Met1-pro-GCAP-II-(2-86) (Fig.
`2). Since the mutant proteins were produced as inclusion bodies
`in the bacterial cells, as is the case for the expression of many
`eukaryotic proteins by E . coli cells, we were not able to define
`the conformational states of the mutant proteins immediately
`after expression in the cells. As a result, the recombinant
`proteins were purified by HPLC in the reduced form and then
`oxidatively refolded to the oxidized forms in the presence of 2
`mM GSH and 1 mM GSSG following previously reported proce(cid:173)
`dures (17) . The refolded proteins were subjected to HPLC,
`which indicated the presence of a few isomers, which comprised
`different disulfide linkages (data not shown) . It was not possi(cid:173)
`ble to completely separate these isomers from each other under
`the conditions used in this experiment. The refolded proteins
`were then directly digested by endoproteinase Arg-C and the
`resulting digests were separated by HPLC, as previously re(cid:173)
`ported (17) . The ratios of the disulfide isomers in the digests,
`which have different disulfide linkages and were clearly sepa(cid:173)
`rated on HPLC as is the case in our paper (17), were estimated
`by measurement of their peak areas on HPLC and shown in
`Fig. 2. The mutant protein, Met1-pro-GCAP-II-(2-86), con(cid:173)
`sisted predominantly of the native-type Thr-Ile-Ala-uroguany(cid:173)
`lin (the native-type Thr-Ile-Ala-uroguanylin contains two di(cid:173)
`sulfide linkages between Cys 74 and Cys8 2 and Cys 7 7 and Cys8 5
`
`Bausch Health Ireland Exhibit 2009, Page 3 of 8
`Mylan v. Bausch Health Ireland - IPR2022-00722
`
`
`
`25158
`
`Folding and Dimerization of Prouroguanylin
`
`A
`
`C
`
`B
`
`D
`
`E
`C
`0
`
`~ -ID
`5 C
`ID -e 0 i
`
`ID
`. .!:
`1ii
`iii a:
`I
`
`(Ref. 17)), along with small amounts of biologically inactive
`isomers 1 and 2 (the positions of the disulfide bonds of isomer
`1 are between Cys 74 and Cys85 and Cys 77 and Cys82
`, and isomer
`2 between Cys 74 and Cys 77 and Cys82 and Cys85 (Ref. 17)), as
`found in the folding of the wild-type pro-GCAP-11 (17) . This
`indicates that the mutation of the Val residue to Met at the N
`terminus had no significant effect on the folding of pro-GCAP-
`11. The mutant proteins, Met2-pro-GCAP-Il-(3-86) and Met3 -
`pro-GCAP-II-(4-86), were composed of the native-type Thr-Ile(cid:173)
`Ala-uroguanylin, isomer 1 and isomer 2 in ratios ofl: 1.14: 0.82
`and 1: 4.4: 2.10, respectively. These data suggest that the
`deletion of the amino acid residue at the N terminus greatly
`affects the construction of the native tertiary structure in the
`mature region of pro-GCAP-11, because the native-type disul(cid:173)
`fide pairing comprises only one-third of the mutant protein
`(Met2-pro-GCAP-Il-(3-86)). Further,
`the mutant protein,
`Met3-pro-GCAP-II-(4-86), in which two amino acid residues
`were deleted from the N terminus, nearly completely lacked the
`ability to form the correct disulfide pairing in the mature
`region and, thus, was devoid of the chaperone function in the
`pro-leader sequence of pro-GCAP-11, because the ratio of the
`native type to isomers was comparable with that in the folding
`of the mature hormone, GCAP-11 (17).
`To further investigate whether the Tyr residue at position 2
`from the N terminus is involved in the folding of pro-GCAP-11,
`the mutant protein, Met1
`2-pro-GCAP-Il-(3-86), was prepared
`•
`in which the Tyr residue was replaced by Met. The result
`indicates that the distribution of the native-type isomers 1 and
`2 in Met1
`2-pro-GCAP-Il-(3-86) were nearly the same as in the
`•
`case of Met1-pro-GCAP-II-(2-86) and, therefore, that the re(cid:173)
`placement of the Tyr residue with Met had no effect on the
`function of the propeptide in the pro-leader sequence. Collec(cid:173)
`tively, these results indicate that the two N-terminal amino
`acid residues in length, in particular the N-terminal residue,
`play an important role in the formation of the correct disulfide
`linkages of the mature portion of pro-GCAP-11 in vitro and,
`thus, in the function of the intramolecular chaperone of the
`propeptide in the pro-leader sequence of pro-GCAP-11.
`Expression of the N-terminal Deletion Mutants of Pro(cid:173)
`GCAP-II in 293T Cells-Since the mutant proteins were ex(cid:173)
`pressed as inclusion bodies in the E. coli cells, we were not able
`to estimate the effect of the deletion of the N-terminal residue
`on the in vivo folding of pro-GCAP-11. Therefore, we prepared
`the wild-type pro-GCAP-11 in human embryonic kidney 293T
`cells, as well as the N-terminal deletion mutants, in which the
`N-terminal amino acid residues were sequentially deleted from
`the N terminus, and three types of mutant proteins of pro(cid:173)
`GCAP-11, which are devoid of the N-terminal region, as shown
`in Fig. 2: 1) pro-GCAP-11-(7-86), which is deprived of the 6
`N-terminal amino acid residues; 2) pro-GCAP-11-(12-86),
`which lacks the 11 N-terminal residues; and 3) pro-GCAP-11-
`(18-86), which lacks the 17 N-terminal residues that comprise
`an invariant region (amino acid residue sequence 12-17) in
`both pro-GCAP-11 and pro-GCAP-1. The N-terminal deletion
`mutant proteins, which lack the N-terminal Val or Val-Tyr
`residues, could not be isolated from 293T cells, although the
`reason for this is not clear at present. The mutant proteins,
`which were deleted in a portion of the peptide in the pro-leader
`sequence of pro-GCAP-11, might be due to its failure to fold in
`the endoplasmic reticulum, resulting in a protein that is sus(cid:173)
`ceptible to degradation by proteases and is not secreted from
`the endoplasmic reticulum (26). The other deletion mutants
`and the wild-type pro-GCAP-11 were expressed in human kid(cid:173)
`ney 293T cells via the expression vector, secreted into the
`culture media, and then purified by HPLC (Fig. 3) and ana(cid:173)
`lyzed by matrix-assisted laser desorption/ionization time-of-
`
`0
`
`10
`
`20
`
`20
`10
`0
`40
`30
`Retention time {min)
`FIG. 3. HPLC profiles of the culture supernatants of293Tcells,
`which express the wild-type pro-GCAP-11 (A), pro-GCAP-11-(7-
`86) (B), pro-GCAP-11-(12-86) (C), and pro-GCAP-11-08-86) (D).
`The target proteins are indicated by arrows . HPLC was performed as
`described under "Experimental Procedures."
`
`so 40
`
`flight mass spectrometry (Fig. 4) . The wild-type pro-GCAP-11
`showed a signal at m I z = 9487 .0, which is consistent with the
`mass value (9487 .9) calculated from the amino acid sequence.
`In contrast, pro-GCAP-11-(7-86), pro-GCAP-11-(12-86), and
`pro-GCAP-11-(18-86) exhibited mass spectral signals at m lz =
`17859.5, 16203.0, and 15248.0, respectively, which are twice
`the theoretical values, calculated from their amino acid se(cid:173)
`quences . No monomeric forms of the N-terminal deletion mu(cid:173)
`tant proteins were detected on Fig. 3. These results indicate
`that the wild-type pro-GCAP-11 was prepared as a monomer
`and, conversely, that the mutant proteins, which lack the N(cid:173)
`terminal amino acid residues, were expressed as dimers . This
`dimer appears to be composed of two monomer units, which are
`connected via a covalent linkage(s), perhaps intermolecular
`disulfide linkage(s), because the dimer could be converted into
`a monomer by treatment with DTT, as described below.
`To determine the location of the intermolecular disulfide
`linkage(s) found in the recombinant proteins, which are devoid
`of the N-terminal region, the wild-type pro-GCAP-11 (as a con(cid:173)
`trol) and pro-GCAP-11-(12-86) were each digested with endo(cid:173)
`proteinase Arg-C and the hydrolysates examined by HPLC
`(Fig. 5). A comparison of the HPLC profiles of the digests of the
`wild-type pro-GCAP-11 and pro-GCAP-11-(12-86) revealed that
`the wild-type pro-GCAP-11 comprises the native-type Thr-Ile(cid:173)
`Ala-uroguanylin covering the mature GCAP-11 (observed mass
`value, 1953.0; theoretical value, 1953.2), whereas pro-GCAP-
`11-(12-86) contains a dimer (observed mass value, 3906.9; the(cid:173)
`oretical value, 3906.5) of Thr-Ile-Ala-uroguanylin. Two Cys
`residues at positions 41 and 54 in the pro-leader sequence of
`pro-GCAP-11 were correctly bridged in both the wild-type pro(cid:173)
`GCAP-11 and pro-GCAP-11-(12-86). This clearly shows that the
`intermolecular disulfide linkage(s) in the recombinant pro(cid:173)
`GCAP-11-(12-86) were connected in its mature region. The
`disulfide pairing in the dimer of Thr-Ile-Ala-uroguanylin in
`pro-GCAP-11-(12-86) could not be further defined, because the
`peptide was not soluble after purification by HPLC . The other
`N-terminal deletion proteins also gave the same results as
`found in pro-GCAP-11-(12-86) (data not shown). Consequently,
`these data indicate that the deletion of the N-terminal region in
`the pro-leader sequence of pro-GCAP-11 greatly influenced the
`
`Bausch Health Ireland Exhibit 2009, Page 4 of 8
`Mylan v. Bausch Health Ireland - IPR2022-00722
`
`
`
`Folding and Dimerization of Prouroguanylin
`
`25159
`
`100 A
`
`Q487jJ
`
`IO
`
`FIG. 4. Matrix-assisted laser desorp(cid:173)
`tion/ionization
`time-of-flight mass
`spectra of the wild-type pro-GCAP-11
`(A) and the mutant protein, pro(cid:173)
`GCAP-11-(12-86) (B). Mass spectra were
`obtained using a Voyager Elite XL TOF
`mass spectrometer equipped with a de(cid:173)
`layed-extraction system (PerSeptive Bio(cid:173)
`systems, Framingham, MA).
`
`18964.7
`
`I
`f o+-----------------------•
`t
`I 100 B
`I
`I IO
`
`16203,0
`
`8103.6
`
`0
`
`IOOO
`
`10000
`
`1IDOO
`--(111/1)
`
`A
`
`B
`
`FIG. 5. Arg-C digestion of wild-type
`pro-GCAP-11 (A) and pro-GCAP-11-
`(12-86) (B). The position of Thr-Ile-Ala(cid:173)
`uroguanylin is indicated by arrows.
`
`E
`C
`0
`C\I
`C\I
`<ii
`
`Q)
`(.)
`C
`<ll
`..0
`0
`(/)
`..0
`<ll
`Q)
`
`> :;
`Qi
`a:
`I
`
`0
`
`10
`
`20
`
`30
`
`40
`
`0
`
`10
`
`20
`
`30
`
`40
`
`Retention time (min)
`
`linking of the disulfide bonds in the mature peptide of pro(cid:173)
`GCAP-11, GCAP-11. In other words, the N-terminal region (ami(cid:173)
`no acid residues 1 to 6) in the pro-leader sequence of pro(cid:173)
`GCAP-11 plays a critical role in the formation of the three
`dimensional structure of pro-GCAP-11 in vivo and in turn, the
`folding of the mature peptide, GCAP-11.
`In Vitro Disulfide-coupled Folding of the N-terminal Deletion
`Mutants Expressed in 293T Cells-The S-protein (amino acid
`sequence 22-124) of RNase A folds complementarily with the
`S-peptide (amino acid sequence 1-21) to a stable conformation
`similar to that of intact RNase A (27-29). This led us to deter(cid:173)
`mine ifpro-GCAP-11-(7-86) or pro-GCAP-11-(12-86) were able
`to adopt a tertiary structure similar to that of the intact protein
`by the aid of the complementary N-terminal peptides, which
`consist of 6 or 11 amino acid residues, respectively. The relative
`abundance of three disulfide isomers of the refolded proteins,
`pro-GCAP-11-(7-86) or pro-GCAP-11-(12-86), was nearly iden(cid:173)
`tical with those found in the refolding of the mature GCAP-11
`(17) and Met3-pro-GCAP-I