ll .. lllll/;�■lal11J■ IDUHIIIIIU
`Ja,■-- JIIU■DJI blJ. .111 . I ll'Dd!lllllll'.,JIIIII auu IJil• IUllll��IIIUDh Ja: Ill Jlll'IL.DIJfllllll Ill
`J�t�1\! ii.'-l!'N�·"'\\�
`1,..,......,_¥,i,__,-..,.;.a,,......,...,,.,.PI" VJfHr';� ,Wi
`,�_..:rlw,,,,�\�'-'l�>J.,.,.JJ� 'M\i,
`.,,-.,,.,J,
`.. !i11W���lll.!\'l\\..i►t�i1,�,�,,._,..""""'�',.,,.�
`
`•
`
`c::=:::-::::::::i -
`
`• •
`• • • • •
`
`•
`
`•
`
`•
`
`•
`
`

`

`M OLECULAR BIOLOGY OF
`
`f o u r t h e d t o n
`
`Bruce Alberts
`
`Alexander Johnson
`
`Julian Lewis
`
`Martin Raff
`
`Keith Roberts
`
`Peter Walter
`
`GS Garland
`Science
`
`
`Taylor & Francis Group
`
`

`

`Cell Biology Interactive
`
`
`
`Artistic and Scientific Direction: Peter Walter
`
`Narrated by: Julie Theriot
`
`
`
`
`Production, Design, and Development: Mike Morales
`
`Garland
`
`Vice President: Denise Schanck
`
`
`Managing Editor: Sarah Gibbs
`
`
`
`
`Senior Editorial Assistant: Kirsten Jenner
`
`
`
`Managing Production Editor: Emma Hunt
`
`
`Proofreader and Layout: Emma Hunt
`
`
`Production Assistant: Angela Bennett
`
`
`
`
`Text Editors: Marjorie Singer Anderson and Betsy Dilernia
`
`Copy Editor: Bruce Goatly
`
`
`
`Word Processors: Fran Dependahl, Misty Landers and Carol Winter
`
`
`Designer: Blink Studio, London
`
`Illustrator: Nigel Orme
`Indexer: Janine Ross and Sherry Granum
`
`
`Manufacturing:
`
`Nigel.Eyre and Marion Morrow
`
`Bruce Alberts received his Ph.D. from Harvard University and is
`
`
`
`President
`
`
`
`of the National Academy of Sciences and Professor of
`
`
`
`Biochemistry and Biophysics at the University of California, San
`
`
`
`
`Francisco. Alexander Johnson received his Ph.D. from Harvard
`
`
`
`University and is a Professor of Microbiology and Immunology
`
`
`and Co-Director of the Biochemistry and Molecular Biology
`
`
`
`Program at the University of California, San Francisco.
`
`
`
`
`Julian Lewis received his D.Phil. from the University of Oxford
`
`
`
`
`and is a Principal Scientist at the London Research Institute of
`
`
`Cancer Research UK. Martin Raff received his M.D. from McGill
`
`
`
`
`
`University and is at the Medical Research Council Laboratory for
`
`
`
`Molecular Cell Biology and Cell Biology Unit and in the Biology
`
`
`
`
`
`Department at University College London. Keith Roberts received
`
`
`his Ph.D. from the University of Cambridge and is Associate
`
`
`
`
`Research Director at the John Innes Centre, Norwich. Peter Walter
`
`
`
`received his Ph.D. from The Rockefeller University in New York and
`Front cover Human Genome: Reprinted by permission
`
`
`
`
`
`is Professor and Chairman of the Department of Biochemistry and
`
`
`Human Genome Sequencing from Nature, International
`
`
`
`
`Biophysics at the University of California, San Francisco, and an
`
`
`Magazines Consortium, 409:860-921, 2001 © Macmillan
`
`
`
`Investigator of the Howard Hughes Medical Institute.
`
`
`
`Ltd. Adapted from an image by Francis Collins, NHGRI;
`
`
`Jim Kent, UCSC; Ewan Birney, EBI; and Darryl Leja,
`
`
`
`NHGRI; showing a portion of Chromosome 1 from the
`
`
`initial sequencing of the human genome.
`
`© 2002 by Bruce Alberts, Alexander Johnson, Julian Lewis,
`
`
`
`
`Martin Raff, Keith Roberts, and Peter Walter.
`Lewis, Dennis Bray, Julian © 1983, 1989, 1994 by Bruce Alberts,
`
`
`
`
`Martin Raff, Keith Roberts, and James D. Watson.
`
`
`
`2001054471 CIP
`
`Chapter opener Portion of chromosome 2 from the
`
`
`
`
`genome of the fruit fly Drosophila melanogaster.
`
`
`(Reprinted with permission from M.D. Adams et al.,
`
`287:2185-2195, 2000. © MAS.)
`Science
`All rights reserved. No part of this book covered by the copyright
`
`
`
`
`hereon may be reproduced or used in any format in any form or
`Back cover In 1967, the British artist Peter Blake
`
`
`
`
`by any means-graphic, electronic, or mechanical, including
`
`
`created a design classic. Nearly 35 years later Nigel
`
`
`
`
`photocopying, recording, taping, or information storage and
`
`
`
`Orme (illustrator), Richard Denyer (photographer), and
`
`
`retrieval systems-without permission of the publisher.
`
`
`
`the authors have together produced an affectionate
`
`
`
`
`tribute to Mr Blake's image. With its gallery of icons and
`
`
`influences, its assembly created almost as much
`
`
`
`complexity, intrigue and mystery as the original.
`Library of Congress Cataloging-in-Publication Data
`
`
`Dolly and the assembled
`
`Drosophila, Arabidopsis,
`
`
`
`
`Molecular biology of the cell/ Bruce Alberts ... [et al.].--4th ed.
`
`company tempt you to dip inside where, as in the
`p.cm
`
`
`
`original, "a splendid time is guaranteed for all."
`Includes bibliographical references and index.
`
`
`
`
`
`
`
`
`(Gunter Blobel, courtesy of The Rockefeller University; Marie
`(hardbound) --ISBN 0-8153-4072-9 (pbk.)
`
`
`ISBN 0-8153-3218-1
`
`
`
`Curie, Keystone Press Agency Inc; Darwin bust, by permission
`
`
`
`1. Cytology. 2. Molecular biology. I. Alberts, Bruce.
`
`
`
`of the President and Council of the Royal Society; Rosalind
`
`[DNLM: 1. Cells. 2. Molecular Biology.]
`
`
`
`
`
`Franklin, courtesy of Cold Spring Harbor Laboratory Archives;
`QH581.2 .M64 2002
`
`Dorothy Hodgkin,© The Nobel Foundation, 1964; James Joyce,
`571.6--dc21
`
`
`
`etching by Peter Blake; Robert Johnson, photo booth
`
`
`
`self-portrait early 1930s, © 1986 Delta Haze Corporation all
`
`
`
`
`rights reserved, used by permission; Albert L. Lehninger,
`
`(unidentified photographer) courtesy of The Alan Mason
`
`
`
`
`
`Published by Garland Science, a member of the Taylor & Francis Group,
`
`
`
`Chesney Medical Archives of The Johns Hopkins Medical
`
`29West 35th Street, New York, NY 10001-2299
`
`
`Institutions; Linus Pauling, from Ava Helen and Linus Pauling
`
`
`
`
`
`
`Papers, Special Collections, Oregon State University; Nicholas
`
`
`
`
`Poussin, courtesy of ArtToday.com; Barbara McClintock,
`
`
`
`© David Micklos, 1983; Andrei Sakharov, courtesy of Elena
`
`
`
`Bonner; Frederick Sanger, © The Nobel Foundation, 1958.)
`
`15 14 13 12 11 10 9 8 7 6 5 4 3 2
`
`
`
`Printed in the United States of America
`
`
`
`

`

`Contents
`
`Special Features
`
`List of Topics
`Acknowledgments
`A Note to the Reader
`
`PART I INTRODUCTION TO THE CELL
`l.Cells and Genomes
`2.Cell Chemistry and Biosynthesis
`
`3.Proteins
`
`PART II BASIC GENETIC MECHANISMS
`4.DNA and Chromosomes
`
`5.DNA Replication, Repair, and Recombination
`
`6.How Cells Read the Genome: From DNA to Protein
`
`7.Control
`of Gene Expression
`
`PART Ill METHODS
`
`8.Manipulating Proteins, DNA, and RNA
`
`
`9.Visualizing Cells
`
`PART IV INTERNAL ORGANIZATION OF THE CELL
`
`10.Membrane Structure
`
`
`
`and the Electrical11.Membrane Transport of Small Molecules
`
`Properties of Membranes
`
`
`
`12. Intracellular Compartments and Protein Sorting
`
`
`13.Intracellular Vesicular Traffic
`
`
`
`14.Energy Conversion: Mitochondria and E::hloroplasts
`15.Cell Communication
`16.The Cytoskeleton
`1 7. The Cell Cycle and Programmed
`Cell Death
`
`18.The Mechanics of Cell Division
`
`PART V CELLS IN THEIR SOCIAL CONTEXT
`
`
`
`19.Cell Junctions, Cell Adhesion, and the Extracellular Matrix
`20.Germ Cells and Fertilization
`
`
`21.Development of Multicellular Organisms
`
`
`of Cells in Tissues22.Histology: The Lives and Deaths
`23.Cancer
`
`24.The Adaptive Immune System
`
`
`
`25.Pathogens, Infection, and Innate Immunity
`
`Glossary
`Index
`
`
`
`Tables: The Genetic Code, Amino Acids
`
`ix
`xi
`xxix
`xxxiii
`
`3
`47
`
`129
`
`191
`235
`299
`375
`
`469
`547
`
`583
`
`615
`659
`711
`
`767
`
`831
`907
`983
`1027
`
`1065
`
`1127
`1157
`1259
`1313
`
`1363
`
`1423
`
`G-1
`
`1 -1
`
`T -1
`
`vii
`
`

`

` r
`
`.I
`
`I
`
`
` 4
`
`-
`
`I: 'm tsnmrmrratmm TIE-ill? wraniamfi'atmsu -
`
`Im l
`
` DNA AND
`
`CHROMOSOMES
`
`THE STRUCTURE AND FUNCTION
`OF DNA——_..—._—
`
`CHROMOSOMAL DNA AND ITS
`PACKAGING IN THE CHROMATIN
`FIBER
`
`THE GLOBAL STRUCTURE OF
`CHROMOSOMES
`
`are
`Iar‘t
`
`ur‘e
`
`Life depends on the ability of cells to store, retrieve, and translate the genetic
`instructions required to make and maintain a living organism. This hereditary
`information is passed on from a cell to its daughter cells at cell division, and
`from one generation of an organism to the next through the organism's repro-
`ductive cells. These instructions are stored within every living cell as its genes.
`the information—centaining elements that determine the characteristics of a
`species as a whole and of the individuals within it.
`As soon as genetics emerged as a science at the beginning of the twentieth
`century, scientists became intrigued by the chemical structure of genes. The
`information in genes is copied and transmitted from cell to daughter cell millions
`Df times during the life of a multicellular organism. and it survives the process
`essentially unchanged. What form of molecule could be capable of such accu-
`rate and almost unlimited replication and also be able to direct the development
`01c an organism and the daily life of a cell? What kind of instructions does the
`Semitic information contain? How are these instructions physically organized so
`that the enormous amount of information required for the development and
`maintenance of even the simplest organism can be contained within the tiny
`s'i’ace of a cell?
`
`The answers to some of these questions began to emerge in the 19405, when
`researchers discovered, from studies in simple fungi, that genetic information
`CORSists primarily of instructions for making proteins. Proteins are the macro-
`molecules that perform most cellular functions: they serve as building blocks for
`Cellular structures and form the enzymes that catalyze all of the cell’s chemical
`reflctions [Chapter 3}.
`they regulate gene expression [Chapter 7], and they
`Enable cells to move (Chapter 16) and to communicate with each other (Chap-
`ter 15). The properties and functions of a cell are determined almost entirely by
`the Proteins it is able to make. With hindsight, it is hard to imagine what other
`We of instructions the genetic information could have contained.
`
`I9l
`
`Sarepta Exhibit 1068, Page 5 of 124
`
`

`

`
`
`The other crucial advance made in the 19405 was the identification of
`deoxyribonucleic acid (DNA) as the likely carrier of genetic information. But the
`mechanism whereby the hereditary information is copied for transmission from
`cell to cell. and how proteins are specified by the instructions in the DNA,
`remained completely mysterious. Suddenly, in 1953, the mystery was solved
`when the structure of DNA was determined by lames Watson and Francis Criclg.
`As mentioned in Chapter 1, the structure of DNA immediately solved the prob—
`lem of how the information in this molecule might be copied, or replicated. It
`also provided the first clues as to how a molecule of DNA might encode the
`instructions for making proteins. Today, the fact that DNA is the genetic material
`is so fundamental to biological thought that it is difficult to realize what an enor-
`mous intellectual gap this discovery filled.
`Well before biologists understood the structure of DNA. they had recognized
`that genes are carried on chromosomes, which were discovered in the nineteenth
`century as threadlike structures in the nucleus of a eucaryotic cell that become
`visible as the cell begins to divide (Figure 4—1}. Later, as biochemical analysis
`became possible, chromosomes were found to consist of both DNA and protein.
`We now know that the DNA carries the hereditary information of the cell (Figure
`4—2). In contrast, the protein components of Chromosomes function largely to
`package and control the enormously long DNA molecules so that they fit inside
`cells and can easily be accessed by them.
`In this chapter we begin by describing the structure of DNA. We see how,
`despite its chemical simplicity, the structure and chemical properties of DNA
`make it ideally suited as the raw material of genes. The genes of every cell on
`Earth are made of DNA, and insights into the relationship between DNA and
`genes have come from experiments in a wide variety of organisms. We then con—
`sider how genes and other important segments of DNA are arranged on the long
`molecules of DNA that are present in chromosomes. Finally, we discuss how
`eucaryotic cells fold these long DNA molecules into compact chromosomes.
`This packing has to be done in an orderly fashion so that the chromosomes can
`be replicated and apportioned correcfly between the two daughter cells at each
`cell division. It must also allow access of chromosomal DNA to enzymes that
`repair it when it is damaged and to the specialized proteins that direct the
`expression of its many genes.
`‘
`This is the first of four chapters that deal with basic genetic mechanisms—
`the ways in which the cell maintains, replicates, expresses, and occasionally
`improves the genetic information carried in its DNA. In the following chapter
`(Chapter 5) we discuss the mechanisms by which the cell accurately replicates
`and repairs DNA; we also describe how DNA sequences can be rearranged
`through the process of genetic recombination. Gene expression—the process
`through which the information encoded in DNA is interpreted by the cell to
`guide the synthesis of proteins—is the main topic of Chapter 6. In Chapter 7, we
`describe how gene expression is controlled by the cell to ensure that each of the
`many thousands of proteins encrypted in its DNA is manufactured only at the
`proper time and place in the life of the cell. Following these four chapters on
`basic genetic mechanisms, we present an account of the experimental tech—
`niques used to study these and other processes that are fundamental to all cells
`(Chapter 8).
`
`THE STRUCTURE AND FUNCTION OF DNA
`
`Biologists in the 19405 had difficulty in accepting DNA as the genetic material
`because of the apparent simplicity of its chemistry. DNA was known to be a long
`polymer composed of only four types of subunits, which resemble one another
`chemically. Early in the 19505, DNA was first examined by x-ray diffraction
`analysis, a technique for determining the three-dimensional atomic structure of
`a molecule (discussed in Chapter 8). The early x—ray diffraction results indicated
`that DNA was composed of two strands of the polymer wound into a helix. The
`observation that DNA was double—stranded was of crucial significance and
`
`I92
`
`Chapter 4 : DNA AND CHROMOSOMES
`
`dividing cell
`
`
`
`(B)
`
`l
`
`10 pm
`
`nondividing cell A\
`
`’T‘NUDHnl—JHNt—F‘Vs
`
`’2'?.
`
`Efls‘fl'}:
`
`OD‘H'JPT‘W.
`
`H.”m_.
`
`Tl
`
`Figure 4—l Chromosomes in cells.
`(A) Two adjacent plant cells photographed
`through a light microscope.The DNA has
`been stained with a fluorescent dye
`(DAPI) that binds to it.The DNA is
`present in chromosomes, which become
`visible as distinct structures in the light
`microscope only when they become
`compact structures in preparation for cell
`division, as shown on the left.The cell on
`the right, which is not dividing, contains
`identical chromosomes, but they cannot
`be clearly distinguished in the light
`microscope at this phase in the cell‘s life
`cycle, because they are in a more
`extended conformation. (B) Schematic
`diagram of the outlines of the two cells
`along with their chromosomes.
`(A, courtesy of Peter Shaw.)
`
`Sarepta Exhibit 1068, Page 6 of 124
`
`

`

`
`
`smooth pathogenic bacterium
`.
`5 straw): causes pneumonia
`
`15 strain cells
`
`8%:-
`fractionation of cell-free
`extract into classes of
`purified molecules
`
`0'8
`lHANDOM MUTATION
`rough nonpethogenic
`R strain mutant bacterium
`
`@O
`
`live R strain cells grown in
`presence of either heat-killed
`5 strain cells or cell—free
`extract of 5 strain cells
`
`TRANSFORMATION
`
`Some R strain cells are
`’ 8 transformed to 5 strain
`are atho enic and
`cells. whose daughters
`train
`.
`p
`9
`S 5
`cause pneumonia
`
`CONCLUSION: Molecules that can
`carry heritable information are
`present in S strain cells.
`
`@Q
`
`FINA
`
`protein
`
`DNA
`
`lipid carbohydrate
`
`I
`l
`I
`I
`I
`molecules tested for transformation of R strain cells
`
`Q Q
`.
`R
`strain
`
`Q Q n O.
`.
`.
`.
`R
`S
`R
`strain
`strain
`strain
`
`O O
`.
`R
`strain
`
`CONCLUSION: The molecule th;
`carries the heritable information
`is DNA.
`_
`
`Figure 4—2 Experimental
`demonstration that DNA is the
`genetic material. These experiments,
`carried out in the l9405, showed that
`adding purified DNA to a bacterium
`changed its properties and that this
`change was faithfully passed on to
`subsequent generations.Two closely
`related strains of the bacterium
`Streptococcus pneumoniae differ from each
`other in both their appearance under the
`microscope and their pathogenicity. One
`strain appears smooth (S) and causes
`death when injected into mice, and the
`other appears rough (R) and is nonlethal.
`(A) This experiment shows that a
`substance present in the 5 strain can
`change (or transform) the R strain into
`the 5 strain and that this change is
`inherited by subsequent generations of
`bacteria. (B) This experiment, in which the
`R strain has been incubated with various
`classes of biological molecules obtained
`from the S strain, identifies the substance
`as DNA.
`
`I93
`
`(A)
`
`(B)
`
`provided one of the major clues that led to the Watson—Crick structure of DNA.
`Only when this model was proposed did DNA's potential for replication and
`information encoding become apparent. In this section we examine the struc
`ture of the DNA molecule and explain in general terms how it is able to store
`hereditary information.
`
`A DNA Molecule Consists ofTwo Complementary
`Chains of Nucleotides
`
`A DNA molecule consists of two long polynucleotide chains composed of four
`types of nucleotide subunits. Each of these chains is known as a DNA chain, or a
`DNA strand. Hydrogen bonds between the base portions of the nucleotides hold
`the two chains together (Figure 4—3). As we saw in Chapter 2 (Panel 2—6, pp. 120-
`121), nucleotides are composed of a five—carbon sugar to which are attached one
`or more phosphate groups and a nitrogen—containing base. In the case of the
`nucleotides in DNA, the sugar is deoxyribose attached to a single phosphate
`group (hence the name deoxyribonucleic acid), and the base may be either ade—
`nine (A), cytosine (C), guanine (G), or thymine (T). The nucleotides are covalent—
`1y linked together in a chain through the sugars and phosphates, which thus
`form a "backbone” of alternating sugar—phosphate—sugar—phosphate (see Fig—
`Ufe 4—3). Because only the base differs in each of the four types of subunits, each
`Diflynucleotide chain in DNA is analogous to a necklace (the backbone) strung
`Wlth four types of beads (the four bases A, C, G. and T}. These same symbols (A,
`C. G, and T) are also commonly used to denote the four different nucleotides—
`that 13, the bases with their attached sugar and phosphate groups.
`The way in which the nucleotide subunits are lined together gives a DNA
`strand 3 chemical polarity. If we think of each sugar as a block with a protruding
`kiwi) (the 5' phosphate] on one side and a hole [the 3’ hydroxyl} on the other (see
`F131m: 4-3]. each completed chain, formed by interlocking knobs with holes. will
`We all of its subunits lined up iii the same orientation. Moreover, the-two ends
`tot: the chain will be easily distinguishable. as one has a hole (the 3’ hydroxyl) and
`. will)“ aknob (the 5’ phosphate) at its terminus. This polarity in a DNA chain
`is lnlealed by referring to one end as the 3’ end and the other as the 5’ and.
`th The three-dimensional structure of DNA—the double helix—arises from
`c Chemical and structural features of its two polynucleotide chains. Because
`,
`HE STRUcrURE AND FUNCTION or DNA
`
`r
`
`Sarepta Exhibit 1068, Page 7 of 124
`
`

`

`
`
`building blocks of DNA
`phosphatesugar
`
`+ I —-
`base
`
`sugar
`phosphate
`double~stranded DNA
`
`3’
`A 5'
`
`nucleotide
`
`DNA strand
`
`
`
`DNA double helix
`
`3,
`A
`
`sugar-phosphate
`
`backbone
`
`5.
`
`V
`l_!_l 3'
`hydrogen-bonded
`base pairs
`
`
`
`
`5/
`
`V
`3,
`
`these two chains are held together by hydrogen bonding between the bases on
`the different strands, all the bases are on the inside of the double helix, and the
`sugar-phosphate backbones are on the outside (see Figure 473). In each case, a
`bulkier two-ring base (a purine; see Pane12—6, pp. 120—121) is paired with a sin—
`gle-ring base (a pyrimidine); A always pairs with T, and G with C (Figure 4—4).
`This complementary base—pairing enables the base pairs to be packed in the
`
`3"
`
`H
`|
`
`5,
`
`H
`|
`
`cytosine
`
`T_H
`
`
`s
`2
`
`il
`i
`E
`/N\ /N\ ¢O\
`C '
`C
`hydrogen
`|
`.
`‘
`I
`bond
`
`
`N
`. / C
`.
`\c‘ \N
`N
`
`guanine
`N -\-'//
`C
`
`
`\H
`
`i
`N\
`
`H
`
`H
`
`5:
`
`
`
`
`
`sugar-phosphate backbone
`
`’3,
`
`Figure 4—3 DNA and its building
`blocks. DNA is made of four types of
`nucleotides, which are linked covalently
`into a polynucleotide chain (a DNA
`strand) with a sugar-phosphate backbone
`from which the bases (A. C. G. and T)
`extend.A DNA molecule is composed of
`two DNA strands held together by
`hydrogen bonds between the paired bases,
`The arrowheads at the ends of the DNA
`strands indicate the polarities of the two
`strands. which run antiparallel to each
`other in the DNA molecule. In the
`diagram at the bottom left of the figure.
`the DNA molecule is shown straightened
`out; in reality, it is twisted into a double
`helix. as shown on the right. For details,
`
`see Figure 4—5.
`
`Figure 4—4 Complementary base
`pairs in the DNA double helix. The
`shapes and chemical structure of the
`bases allow hydrogen bonds to form
`efficiently only between A and T and
`between G and C, where atoms that are
`able to form hydrogen bonds (see Panel
`2—3, pp.
`| l4—l l5) can be brought close
`together without distorting the double
`helix. As indicated.two hydrogen bonds
`form between A and T, while three form
`between G and C.The bases can pair in
`this way only if the two polynucleotide
`chains that contain them are antiparallel
`to each other.
`
`I94
`
`Chapter 4 : DNA AND CHROMOSOMES
`
`Sarepta Exhibit 1068, Page 8 of 124
`
`

`

`bond
`
`minor
`
`
`
`—’
`groove
`major
`0.34 nm
`groove
`
`
` phosphodiester
`
`energetically most favorable arrangement in the interior of the double helix. In
`this arrangement, each base pair is of similar width, thus holding the sugar-
`phosphate backbones an equal distance apart along the DNA molecule. To max—
`imize the efficiency of base—pair packing, the two sugar—phosphate backbones
`Wind around each other to form a double helix, with one complete turn every
`ten base pairs (Figure 4—5).
`The members of each base pair can fit together within the double helix only
`if the two strands of the helix are antiparallel—that is, only if the polarity of one
`strand is oriented opposite to that of the other strand [see Figures 4—3 and 4—4).
`A consequence of these base-pairing requirements is that each strand of a DNA
`molecule contains a sequence of nucleotides that is exactly complementary to
`the nucleotide sequence of its partner strand.
`
`The Structure of DNA Provides a Mechanism for Heredity
`
`Genes carry biological information that must be copied accurately for transmis-
`sion to the next generation each time a cell divides to form two daughter cells.
`Two central biological questions arise from these requirements: how can the
`information for specifying an organism be carried in chemical form, and how is
`it accurately copied? The discovery of the structure of the DNA double helix was
`a landmark in twentieth-century biology because it immediately suggested
`answers to both questions, thereby resolving at the molecular level the problem
`of heredity. We discuss briefly the answers to these questions in this section, and
`We shall examine them in more detail in subsequent chapters.
`DNA encodes information through the order, or sequence, of the
`nucleotides along each strand. Each base—A, C, T, or G—can be considered as a
`letter in a four-letter alphabet that spells out biological messages in the chemi-
`cal structure of the DNA. As we saw in Chapter ], organisms differ from one
`another because their respective DNA molecules have different nucleotide
`secluences and, consequently. carry different biological messages. But how is the
`nucleotide alphabet used to make messages, and what do they spell out?
`As discussed above.
`it was known well before the structure of DNA was
`determ incd that genes contain the instructions for producing proteins. The
`DNA messages must therefore somehow encode proteins [Figure 4—6]. This rela—
`tKinship immediately makes the problem easier to understand, because of the
`Cl“Ethical character of proteins As discussed in Chapter 3, the properties of in
`Protein, which are responsible for its biological function, are determined by its
`EHIlll'nensional structure, and its structure is determined in turn by the linear
`
`THE STRUCTURE AND FUNCTION or DNA
`
`
`
`Figure 4—5 The DNA double helix.
`(A)A space-filling model of |.5 turns of
`the DNA double helix. Each turn of DNA
`is made up of l0.4 nucleotide pairs and
`the center-to-center distance between
`adjacent nucleotide pairs is 3.4 nm.The
`coiling of the two strands around each
`other creates two grooves in the double
`helix.As indicated in the figure, the wider
`groove is called the major groove, and the
`smaller the minor groove. (B) A short
`section of the double helix viewed from
`its side, showing four base pairs.The
`nucleotides are linked together covalently
`by phosphodiester bonds through the
`3’—hydroxy| (—OH) group of one sugar and
`the S’-phosphate (P) of the next.Thus,
`each polynucleotide strand has a chemical
`polarity; that is, its two ends are
`chemically different.The 3’ end carries an
`unlinked 43H group attached to the 3’
`position on the sugar ring; the 5’ end
`carries a free phosphate group attached to
`the 5’ position on the sugar ring.
`
` ‘
`’
`DNA
`1
`1 double
`helix
`
`I "
`
`Jail.
`
`protein A
`
`protein B
`
`protein C
`
`Figure 4—6 The relationship between
`genetic information carried in DNA
`and proteins.
`
`I95
`
`Sarepta Exhibit 1068, Page 9 of 124
`
`

`

`Figure 4-7 The nucleotide sequence of the human B-globin gene.
`This gene carries the information for the amino acid sequence of one of the
`two types of subunits of the hemoglobin molecule, which carries oxygen in
`the blood. A different gene, the oc-globin gene, carries the information for
`the other type of hemoglobin subunit (a hemoglobin molecule has four
`subunits, two of each type). Only one of the two strands of the DNA double
`helix containing the B-globin gene is shown; the other strand has the exact
`complementary sequence. By convention, a nucleotide sequence is written
`from its 5’ end to its 3’ end, and it should be read from left to right in
`successive lines down the page as though it were normal English text.The
`DNA sequences highlighted in yellow show the three regions of the gene that
`specify the amino sequence for the B-globin protein.We see in Chapter 6
`how the cell connects these three sequences together to synthesize a
`full—length B»globin protein.
`
`sequence of the amino acids of which it is composed. The linear sequence of
`nucleotides in a gene must therefore somehow spell out the linear sequence of
`amino acids in a protein. The exact correspondence between the four-letter
`nucleotide alphabet of DNA and the twenty-letter amino acid alphabet of pro-
`teins—the genetic code—is not obvious from the DNA structure. and it took over
`a decade after the discovery of the double helix before it was worked out. In
`Chapter 6 we describe this code in detail in the course of elaborating the pro-
`cess, known as gene expression, through which a cell translates the nucleotide
`sequence of a gene into the amino acid sequence of a protein.
`The complete set of information in an organism's DNA is called its genome,
`and it carries the information for all the proteins the organism will ever synthe—
`size. (The term genome is also used to describe the DNA that carries this infor—
`mation.) The amount of information contained in genomes is staggering: for
`example. a typical human cell contains 2 meters of DNA. Written out in the four-
`letter nucleotide alphabet, the nucleotide sequence of a very small human gene
`occupies a quarter of a page of text (Figure 4—7}. while the complete sequence of
`nucleotides in the human genome would fill more than a thousand books the
`size of this one. In addition to other critical information, it carries the instruc—
`tions for about 30,000 distinct proteins.
`At each cell division, the cell must copy its genome to pass it to both daugh—
`ter cells. The discovery of the structure of DNA also revealed the principle that
`makes this copying possible: because each strand of DNA contains a sequence
`of nucleotides that is exactly complementary to the nucleotide sequence of its
`partner strand, each strand can act as a template, or mold, for the synthesis of a
`new complementaiy strand. In other words,
`if we designate the two DNA
`strands as S and S’, strand 8 can serve as a template for making a new strand 8’,
`while strand 8’ can serve as a template for making a new strand S (Figure 4—8).
`
`S strand
`
`9'
`
`template S strand
`
`5,
`
`/ 3,
`
`3,
`
`
`
`new 8’ strand
`
`3
`
`F
`
`
`
`
`
`3,
`
`
`IHIIIIII
`8’ Strand
`
`- 5/
`
`parent DNA double helix
`
`new 8 strand
`
`
`
`
`I 1111-1111
`
`template 5’ strand
`
`3,
`
`5,
`
`Figure 4—8 DNA as a template for its own duplication. As the
`nucleotide A successfully pairs only with T, and G with C, each strand of
`DNA can specify the sequence of nucleotides in its complementary strand.
`In this way, double—helical DNA can be copied precisely.
`
`I96
`
`Chapter 4 : DNA AND CHROMOSOMES
`
`CCCTGTGGAGCCACACCCTAGGGTTGGCCA
`ATCTACTCCCAGGAGCAGGGAGGGCAGGAG
`CCAGGGCTGGGCATAAAAGTCAGGGCAGAG
`CCATCTATTGCTTACATTTGCTTCTGACAC
`AACTGTGTTCACT
`
`CC
`
`
`
`‘3
`
`TGTTTTAGCTGTCCTCATGAATGTCTTTTC
`
`TTAAGGAGACCAATAGAAACTGGGCATGTG
`GAGACAGAGAAGACTCTTGGGTTTCTGATA
`GGCACTGACTCTCTCTGCCTATTGGTCTAT
`
`
`
`Li‘s; \; GTG
`r
`if!“ ’ in
`AGTCTATGGGACCCTTGATGTTTTCTTTCC
`CCTTCTTTTCTATGGTTAAGTTCATGTCAT
`AGGAAGGGGAGAAGTAACAGGGTACAGTTT
`AGAATGGGAAACAGACGAATGATTGCATCA
`GTGTGGAAGTCTCAGGATCGTTTTAGTTTC
`TTTTATTTGCTGTTCATAACAATTGTTTTC
`TTTTGTTTAATTCTTGCTTTCTTTTTTTTT
`CTTCTCCGCAATTTTTACTATTATACTTAA
`TGCCTTAACATTGTGTATAACAAAAGGAAA
`TATCTCTGAGATACATTAAGTAACTTAAAA
`AAAAACTTTACACAGTCTGCCTAGTACATT
`ACTATTTGGAATATATGTGTGCTTATTTGC
`ATATICATAATCTCCCTACTTTATTTTCTT
`TTATTTTTAATTGATACATAATCATTATAC
`ATATTTATGGGTTAAAGTGTAATGTTTTAA
`TATGTGTACACATATTGACCAAATCAGGGT
`AATTTTGCATTTGTAATTTTAAAAAATGCT
`TTCTTCTTTTAATATACTTTTTTGTTTATC
`TTATTTCTAATACTTTCCCTAATCTCTTTC
`TTTCAGGGCAATAATGATACAATGTATCAT
`GCCTCTTTGCACCATTCTAAAGAATAACAG
`TGATAATTTCTGGGTTAAGGCAATAGCAAT
`ATTTCTGCATATAAATATTTCTGCATATAA
`ATTGTAACTGATGTAAGAGGTTTCATATTG
`CTAATAGCAGCTACAATCCAGCTACCATTC
`TGCTTTTATTTTATGGTTGGGATAAGGCTG
`GATTATTCTGAGTCCAAGCTAGGCCCTTTT
`GCTAATCATGTTCATACCTCTTATCTTCCT
`
` 7.- , at”?
`
`a". .
`. ,
`TGTCCAATTTCTATTAAAGGTTCCTTTGTT
`CCCTAAGTCCAACTACTAAACTGGGGGATA
`TTATGAAGGGCCTTGAGCATCTGGATTCTG
`CCTAATAAAAAACATTTATTTTCATTGCAA
`TGATGTATTTAAATTATTTCTGAATATTTT
`ACTAAAAAGGGAATGTGGGAGGTCAGTGCA
`TTTAAAACATAAAGAAATGATGAGCTGTTC
`AAACCTTGGGAAAATACACTATATCTTAAA
`CTCCATGAAAGAAGGTGAGGCTGCAACCAG
`CTAATGCACATTGGCAACAGCCCCTGATGC
`CTATGCCTTATTCATCCCTCAGAAAAGGAT
`TCTTGTAGAGGCTTGATTTGCAGGTTAAAG
`TTTTGCTATGCTGTATTTTACATTACTTAT
`
`Sarepta Exhibit 1068, Page 10 of 124
`
`

`

`
`
`35v
`'
`Il \ l
`i“ k$vl§i
`1:
`-
`\\
`-
`'
`.1.
`..
`‘_'.
`"x.
`_
`”It-7k
`“a
`I I‘aé- centrosome
`
`-
`..
`_-'.té- W!“
`'
`microtubule
`_. '
`rm»? { r_/,‘,-l
`43‘
`.‘
`, ’3”; ,
`_J
`'
`a 1»-
`.
`.r/
`...~
`.
`-.-/<’:4“,-
`nuclearlamina
`,.
`:rgj. .41”
`_
`=
`'f ‘-.—- fiwfifitr',
`\ «gavel
`"K
`' ./
`
`DNA and associated
`proteins (chromatin)
`
`_
`,
`outer nuclear membrane nuclearenvelope
`inner nuclear membrane
`
`Figure 4—9 A cross-sectional view of
`a typical cell nucleus. The nuclear
`envelope consists of two membranes, the
`outer one being continuous with the
`endoplasmic reticulum membrane (see
`also Figure |2—9).The space inside the
`endoplasmic reticulum (the ER lumen) is
`colored yellow; it is continuous with the
`space between the two nuclear
`membranes.The lipid bilayers of the inner
`and outer nuclear membranes are
`connected at each nuclear pore.Two
`networks of intermediate filaments (green)
`provide mechanical support for the
`nuclear envelope; the intermediate
`filaments inside the nucleus form a special
`supporting structure called the nuclear
`lamina.
`
`endoplasmic
`reticulum
`
`.
`,
`Intermediate
`filaments
`
`
`
`nuclear pore
`7
`l__l
`1 ill“
`
`Thus, the genetic information in DNA can be accurately copied by the beautifully
`simple process in which strand S separates from strand 8’, and each separated
`
`strand then serves as a template for the production of a new complementary
`
`partner strand that is identical to its former partner.
`
`The ability of each strand of a DNA molecule to act as a template for pro-
`
`ducing a complementary strand enables a cell to copy, or replicate, its genes
`
`before passing them on to its descendants. In the next chapter we describe the
`
`elegant machinery the cell uses to perform this enormous task.
`
`
`
`in Eucaryotes, DNA Is Enclosed in a Cell Nucleus
`
`Nearly all the DNA in a eucaryotic cell is sequestered in a nucleus, which occu-
`
`pies about 10% of the total cell volume. This compartment is delimited by a
`
`nuclear envelope formed by two concentric lipid bilayer membranes that are
`
`punctured at
`intervals by large nuclear pores, which transport molecules
`
`between the nucleus and the cytosol. The nuclear envelope is directly connected
`
`to the extensive membranes of the endoplasmic reticulum. It is mechanically
`
`supported by two networks of intermediate filaments: one, called the nuclear
`
`lamina, forms a thin sheetlike me