Vol. 16 Nos. 9-10, October 2006
`
`N•mromuscular disorders : NMD.(IM)
`v. '16. no. 9-10 {Oct. 20%)
`· GP.n ;:! r:il Collf:c!ion
`1.r..t 1 NE.'!:37C8
`2006-10-1 i -~
`
`16 (9-10) 541-736
`ISSN 0960-8966
`
`Editor-in-Chief
`V Dubowitz UK
`Associate Editors
`AG Engel USA
`L Merlini Italy
`F M S Tome France
`T Voit Germany
`
`This issue includes abstracts for the
`11th INTERNATIONAL CONGRESS OF
`THE WORLD MUSCLE SOCIETY
`Bruges, Belgium,
`4-7 October 2006
`
`0
`
`PROPERlY OF THE
`NATIONALl>~/
`LIBRARY OF / ~ I
`MEDICINE
`.J
`
`.
`
`.
`
`.
`
`PERGAMON
`
`Official Journal of the World Muscle Society
`
`

`

`© 2006 Elsevier 13.V. All rights reserved.
`This journal and the individual contributions contained in it arc protected under copyright by Elsevier IJ.V., and the following terms and
`conditions apply to their use:
`Photocopying
`Single photocopies of single articles may be made for personal use as allowed by national copyright laws. Permission of the Publisher and
`payment of a fee is required for all other photocopying, including multiple or systematic copying, copying for advertising or promotional
`purposes, resale, and all forms of document delivery. Special rates are available for educational institutions that wish to make photocopies
`for non-profit educational classroom use.
`Permissions may be sought directly from Elsevier's Rights Department: phone (+I) 215 239 3804; fax (+I) 215 239 3805, c-111::·1:
`healthpcrmissions@elscvier.com. Requests may also be completed on-line via the Elsevier homepage (http://www.elsevier.com/loc,.tc/
`permissions).
`In the USA, users may clear permissions and make payment through the Copyright Clearance Center, Inc., 222 Rosewood Drive, Danvers,
`MA 01923, USA; phone: (+I) (978) 7508400, fax: (+I) (978) 7504744, and in the UK through the Copyright Licensing Agency Rapid
`Clearance Service (CLARCS), 90 Tottenham Court Road, London WIP OLP, UK; phone: (+44) 20 7631 5555; fax: (+44) 20 7631 5500.
`Other countries may have a local reprographic rights agency for payments.
`Derivative Works
`Subscribers may reproduce tables of contents or prepare lists of articles including abstracts for internal circulation within their institutions.
`Permission of the Publisher is required for resale or distribution outside the institution.
`Permission of the Publisher is required for all other derivative works, including compilations and translations.
`Electronic Storage or Usage
`Permission of the Publisher is required to store or use electronically any material contained in this journal, including any article or part of an
`article.
`Except as outlined above, no part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any
`means, electronic, mechanical, photocopying, recording or otherwise, without prior written permission of the Publisher.
`Address permissions requests to: Elsevier Rights Department, at the fax and e-mail addresses noted above.
`Notice
`No responsibility is assumed by the Publisher for any injury and/or damage to persons or property as a matter of products liability,
`negligence or otherwise, or from any use or operation of any methods, products, instructions or ideas contained in the material herein.
`Because of rapid advances in the medical sciences, in particular, independent verification of diagnoses and drug dosages should be made.
`Although all advertising material is expected to conform to ethical (medical) standards, inclusion in this publication docs not constitute a
`guarantee or endorsement of the quality or value of such product or of the claims made of it by its manufacturer.
`@) The paper used in this publication meets the requirements of ANSI/NI SO Z39.48-l992 (Permanence of Paper).
`
`Author enquiries
`For enquiries relating lo the submission of artick:s (including ckctronic submission where available) please visit the Author Gateway frc:11
`Elsevier at http://authors.clsevier.com. The Author (iatcway also provides the facility to track accepted articles and set up e-mail alerts to
`inform you of when an article's status has changcd. as well as detailed artwork guidelines, copyright information, frequently asked questions
`and more.
`
`Contact details for questions arising after ,IL·ceplance of an article. especially those relating to proofs, arc provided after registration of an
`article for publication.
`
`

`

`This material may be protected by Copyright law (Title 17 U.S. Code)
`
`PERGAMON
`
`Neuromuscular Disorders 16 (2006) 583-590
`
`www.elsevicr.com/locatc/nmd
`
`Induced dystrophin exon skipping in human muscle explants
`
`G. McClorey a A.M. Fall '\ H.M. Moulton b' P.L. Iversen b' J.E. Rasko c
`M. Ryan <\ S. Fletcher '\ S.D. Wilton a,*
`" Erpcri111rntal Molcrnlar Afrdicinc Group. Cmtre /i1r Nc11ro11111sc11/ar and Neurological Disorders, U11irNsity (!/' Wes/em Australia,
`Nedla11,ls, IVA (,()(llJ, Australia
`b A VI 1Jiol'lwm1a Inc. 4575 SW Research Way, Suite 200, Corrnllis, OR 97333, U-S'A
`" Grne and S1e111 Cell Therapy Progra111, Ce11/1'11arr Institute of' Cm1cer Medicine and Cell !Jiology, Unil"crsity of' Syd11ey (//1// Sydney Cm1cer Centre.
`Ne1v1m,·n. NSIV 2042. Australia
`d The /11.l'litutcfi,r Neuro11111srnlar Research. The Childre11'.1· 1/ospital of' 1Ve.1·1111c1ul, Westn1c1ul. NSIV 2145, Australia
`
`Received 20 March 2006; received in revised form 15 May 2006; accepted 26 May 2006
`
`Abstract
`
`Antiscnsc oligonuclcotidc (AO) manipulation of prc-mRNA splicing of the dystrophin gene is showing promise in overcoming
`Duchcnnc muscular dystrophy (DM DJ-causing mutations. To date, this approach has been limited to studies using animal models
`or cultured human muscle cells, and evidence that AOs can induce cxon skipping in human muscle has yet to be shown . In this
`study, we used difTcrcnt AO analogues to induce cxon skipping in muscle explants derived from normal and DMD human tissue.
`We propose that inducing cxon skipping in human muscle explants is closer to in vim conditions than cells in monolaycr cultures,
`and may minimize the numbers of participants in Phase I clinical studies to demonstrate proof of principle of cxon skipping in
`human muscle.
`© 2006 Elsevier B.V. All rights reserved.
`
`Key1rnrds: Duchcnnc muscular dystrophy; Antiscnsc oligonucleotidcs; Exon skipping; Explant
`
`I. Introduction
`
`Duchenne muscular dystrophy (DMD) is a severe
`muscle wasting disease that is typically caused by non(cid:173)
`sense or frame-shifting mutations in the dystrophin gene
`that result in the loss of functional protein [I]. Antisense
`oligonucleotides (AOs) have been used to modulate dys(cid:173)
`trophin pre-mRNA splicing to reduce the consequences
`or nonsense or frame-shifting mutations that would
`translation.
`terminated
`otherwise have prematurely
`/\Os can redirect splicing patterns by masking motifs
`
`,lhhrt'1•iatio11.I': DMD, Duchcnnc muscular dystrophy; AO, anti(cid:173)
`sense oligonuclcotides; 2OMc, 2'-O-mcthyl phosphorothioatc; PMO,
`phosphorodiamidatc morpholino oligonuclcotidc.
`• Corresponding author.
`h"-111ail addrt'.1·s: swilton (Zi)cyllcnc.uwa.cdu.au (S.D. Wilton).
`
`0%0-89(,(,/$ - sec front matter © 2006 Elsevier B. V. All rights reserved.
`doi: I 0.1 OJ o/j.nmd .2006.05.017
`
`in the dystrophin pre-mRNA to block spliceosomc
`assembly, such that the target exon is not recognized
`by the splicing machinery [2,3]. In this manner, one or
`more targeted exons can be removed, with the flanking
`intronic regions, from the mature RNA. Selected remov(cid:173)
`al of a nonsense mutation or restoration of the reading(cid:173)
`frame around a genomic deletion or duplication should
`result in an mRNA transcript that can be translated into
`an internally shortened, yet still partially functional dys(cid:173)
`trophin. In many cases, it should be possible to predict
`the level of functionality of the induced dystrophin pro(cid:173)
`tein by comparing it with analogous rearrangements
`found in Becker muscular dystrophy, a less severe
`condition generally arising from in-frame dystrophin
`deletions [4].
`The use of AO-induced dystrophin exon skipping has
`rapidly progressed from i11 vitro mouse [3] and human [5]
`studies using cultured cells, to i11 vivo application in
`
`

`

`584
`
`G. McC/orey et al. I Ne11ro11111.1·m/ar Disorders /6 (2006) 583-590
`
`to preparation for
`·md finally
`dcls [6 7]
`I
`·
`.
`'
`amma mo
`,
`human clinical trials [8]. Parallel human tnals a~c c:tr-
`rently envisaged where two di~er~nt AO chcm1stncs,
`2'-O-methyl modified ribose m01et1es on a ph~spl~oro(cid:173)
`thioate backbone (2OMe AO) and phos_phoro~uumdate
`morpholino oligonucleotides (PMO), _will be dirccted at
`amenable domains in the dystrophm pre-mRNA to
`induce exon skipping.
`. .
`Phase J trials will involve intramuscular _adm1111stra-
`tion of limited amounts of the compounds mto dystro-
`It is generally acknowledged that
`1 · muscle [8].
`p11c
`.
`. bl
`1·
`.
`· tramuscular delivery regimens are not a via e c 1111-
`d
`111
`•
`•
`•
`cal option for AO induced exon sk1pp1~g, smce ystr_o-
`phin exon skipping will _only. be loc~1h_zcd and pe~s1st
`for the duration of the b1olog1cal actlVlty of the ohgo(cid:173)
`nucleotides. A comprehensive series of intramuscular
`injections across the body to _address all d~stroph_ic
`muscles, including the heart, will not be applicable m
`a clinical setting, particularly since periodic readminis(cid:173)
`tration would be needed. As 2OMe AOs have not pre(cid:173)
`viously been injected into humans, initial safety and
`toxicology studies will be mandatory. It is proposed
`that the initial 2OMc AO studies in DMD patients will
`commence with administration by intramuscular injec(cid:173)
`tion [8]. Although relatively small amounts of 2OMe
`AO will be injected into dystrophic muscle, compared
`to that necessary for systemic treatment, localized AO
`concentrations will be far higher than those which
`could be achieved after systemic delivery. Whilst suc(cid:173)
`cessful induction of localized dystrophin expression
`would demonstrate proof of concept in human muscle,
`only
`limited
`information could be obtained from
`around the injection site with respect to safety, AO dis(cid:173)
`tribution
`and
`duration of
`induced
`dystrophin
`expression.
`In contrast to the 2OMe AO chemistry, PMOs have
`already undergone several human clinical trials where
`PMOs with different targeted sequences have been sys(cid:173)
`temically administered to humans in treating restenosis,
`cancer [9] and viral infections, with no drug-related
`adverse effects observed to date (http://www.antivirals.
`com/devNcugcne.html). However, for PMOs conjugat(cid:173)
`ed to peptides for enhanced cellular delivery (PMO(cid:173)
`Peps), initial safety trials will be necessary as they have
`yet to be used in humans, although testing is ongoing
`in rodent and primate models. We have recently shown
`in vivo that PMOs induce more sustained cxon skipping
`in the mdx mouse model of muscular dystrophy than the
`equivalent 2OMc AO [IO]. Proof that any AO, of either
`the 2OMc AO or PMO chemistries, can induce dystro(cid:173)
`phin cxon skipping in vivo in humans has not yet been
`demonstrated.
`In an attempt to minimize the number of intramuscu(cid:173)
`lar studies needed to provide proof of concept, we
`describe an ex vivo system to evaluate induced exon
`skipping in muscle. Hasson ct al. 2005, described the
`
`potential of micro-organs; microscopic fragments that
`preserve the tissue structure of their organ of origin, as
`a method for monitoring viral transfection and gene
`replacement [II]. We show here that muscle fragments,
`obtained after informed consent during unrelated, elec(cid:173)
`tive surgical procedures, can be transfcctcd with AOs
`to induce specific cxon skipping for up to two weeks.
`To our knowledge, this is the first time that AO induced
`exon skipping in human muscle has been reported.
`
`2. Materials and methods
`
`2.1. Sources <d' tissue
`
`Mouse muscle was taken from the tibia/is anterior of
`6 week old mdx mice. Human muscle biopsies were
`obtained from normal individuals undergoing elective
`surgery at Royal Perth Hospital after informed consent.
`Dystrophic human muscle was obtained from a DMD
`patient undergoing spinal corrective surgery, following
`informed consent, at Childrens Hospital Westmcad,
`Sydney. The dystrophin mutation in this patient had
`been identified as an cxon 3-17 deletion, which was sub(cid:173)
`in
`the exon skipping studies.
`sequently confirmed
`Human muscle was stored in DMEM (lnvitrogen, Mel(cid:173)
`bourne) with 20'1/c, FBS (lnvitrogcn) and 50 U/ml peni(cid:173)
`cillin (lnvitrogcn), 50 ftg/ml streptomycin (lnvitrogen)
`and 1.25 ftg/ml amphotcricin 8 (Sigma, Castle Hill, Aus(cid:173)
`tralia) for approximately 2 h at 4"C prior to use, whilst
`the DMD muscle was shipped on ice overnight in the
`same media.
`
`2.2. A11tise11se oligo1111cleotides
`
`The 2OMc AO, M23D(+07-18), was obtained from
`Avccia (Grangcmouth, Scotland). AOs targeting human
`dystrophin gene transcripts were synthesized in-house
`on an Expedite 8909 nucleic acid synthesizer (Applied
`Biosystems, Melbourne) using the I ftmol thioate syn(cid:173)
`thesis protocol. PM Os were synthesized at A VI Bio(cid:173)
`l'harma, USA as described elsewhere [ 12]. The cell
`penetrating peptide conjugated
`to PMO has
`the
`sequence or (RXR) 4XB where X and B represent 6-
`aminohexanic acid and beta-alanine, respectively. The
`peptide was synthesized using standard FMOC chemis(cid:173)
`try and purified to >90'1/., purity by/\ VI BioPharma.
`
`2.3. Exposure of' tissue exp/ants to a11ti,1·c'11.1·e
`oligo1111cleoti<les
`
`Muscle was dissected into small fragments, approxi(cid:173)
`mately 2-3 mm 3 and infused in an OptiMEM (lnvitro(cid:173)
`gcn, Australia) -AO solution with 50 U/ml penicillin,
`50 ftg/ml streptomycin and 1.25 pg/ml amphotericin B.
`containing either uncomplcxed 2OMc AOs, PMOs or
`PMO-Pcp. AOs were directed to either dystrophin exon
`
`

`

`G. AfrC/orey el al. I Ne11ro11111sm/ar Disorders 16 (2006) 583--590
`
`585
`
`Table I
`Sequences or antisense oligonucleotides used in this study
`
`Description
`
`Mouse exon 23 2OMe AO
`11 uman exon 6 AO
`lluman exon 8 AO
`Human exon 18 AO
`lluman exon 19 AO
`1 luman exon 20A AO
`lluman cxon 20B AO
`
`Nomenclature
`
`M23D(+07-18)
`I I06A{ +69+9 I)
`H0SA(-06+18)
`1118/\(+24+53)
`1119A(+35+65)
`ll20A{+44+71)
`1120A(l47+168)
`
`Sequence 5' -3'
`
`caaaccucggcuuacCUGAAA U
`UACGAGUUGAUUGUCGGACCCAG
`GA UAGGUGG UA UCAACA Ucuguaa
`CAGCUUCUGAGCGAGUAAUCCAGCUGUGAA
`GCCUGAGCUGAUCUGCUGGCAUCUUGCAGUU
`CUGGCAGAAUUCGAUCCACCGGCUGUUC
`CAGCAGUAGUUGUCAUCUGCUC
`
`Upper and lower case characters indicate cxonic and intronic nucleotides, respectively. PMO chemistries have uracil bases substituted with thymine.
`
`3. Results
`
`Muscle from 111dx mouse tibia/is anterior was used to
`optimize the technique for AO induced exon skipping in
`muscle explants which were either injected, infused, or
`injected and infused with 5 ttM of M23D(+07-18)
`2OMe AO, PMO or PMO-Pep in OptiMEM (data not
`shown). RNA was then extracted I or 7 days later for
`nested PCR analysis. Removal of exon 23 (~213 bp)
`or 22 and 23 (~359 bp) from the dystrophin transcript
`could be detected after 24 h (data not shown), however
`exon skipping was more sustained and pronounced fol(cid:173)
`lowing 7 days exposure to the AO (Fig. I). Infusion in
`
`23 for mouse studies, cxons 6 or 8 for normal human
`muscle studies or exon I 8, I 9 and 20 for DMD muscle
`studies (Table
`I). The nomenclature for A Os
`is
`described by Mann ct al. [I 3]. Muscle fragments were
`incubated in the OptiMEM-AO solution at 37 °C, 5'%
`CO2, and after 3 days were supplemented with an equal
`volume of DMEM containing 10'½, horse serum, to
`obtain a final concentration of 5% horse scrum.
`
`2.4. PCR analysis of exon skipping
`
`RNA was extracted from free-floating muscle ex plant
`fragments al specified times using Trizol {lnvitrogcn),
`according to the manufacturer's instructions. RT-PCR
`was performed on I 00 ng of total RNA for 35 cycles
`of amplification, using I U of Superscript III (lnvitro(cid:173)
`gcn) in a 12.5 ~ti reaction. Primers were used at 94 °C
`for 30 s, 55 °C annealing for I min, 68 °C extension for
`2 min and arc listed in Table 2. A I ttl sample from this
`reaction was then used as the template for 30 cycles of
`secondary PCR amplification using 0.5 U of AmpliTaq
`Gold (Applied Biosystems) under cycling conditions
`described above. Products were then electrophoresed
`on a 2'½, TAE agarose gel, with products of interest puri(cid:173)
`fied using MoBio UltraClean spin columns (Geneworks,
`Adelaide) and then sequenced on an Applied Biosystems
`377 automated sequencer using BigDye V3.1 terminator
`chemistry (Applied Biosystems).
`
`Table 2
`Primer sequences for nested PCR analysis
`
`"O
`.'!!
`"'
`~
`c
`:::>
`
`C.
`.0
`0
`0
`
`...
`
`:;;
`:,.
`0 ...
`.,
`:;;
`0
`N
`
`:;;
`...
`:,.
`0
`
`0
`:;;
`0..
`
`t.23 1073 bp - •
`
`1286 bp- :_·_~ -
`• - -
`t.22+23 927 bp --
`-
`
`C.
`
`:;;
`...
`:,.
`0
`.,
`0..
`0
`:;;
`0..
`
`.,
`?
`a::
`u
`a.
`
`C.
`.0
`0
`0
`
`...
`
`-
`
`Fig. I. RT-PCR analysis or nulx mouse muscle explants following 7
`days incubation with 10 11M of either 2OMc, PMO or PMO-Pep
`M23O(+7-18) AOs. The shorter PCR products of 1073 hp or 927 bp,
`indicates removal of cxon 23 or cxon 22 and 23 respectively, from the
`dystrophin transcript. (6 = cxon removal).
`
`Description
`
`Mouse exon 13- 27 outer
`
`Mouse exon 18-26 inner
`
`lluman cxon 1-10 outer
`
`lluman exon 1- 10 inner
`
`I luman exon I -27 outer
`
`I luman exon 1- 26 inner
`
`PCR primer
`
`MExonl3F
`MExon27R
`MExonl8F
`MExon26R
`IIExon0IF(a)
`IIExonl0R(a)
`IIExon0I F{b)
`IIExonlOR(b)
`IIExon0IF(a)
`I 1Exon27R
`IIExonOIF{b)
`11Exon2(,R
`
`Sequence 5'-3'
`
`get tea agaaga tctagaacaggagc
`ctat I taeagtctcagtaagg
`ga tataactgaacttcacag
`t tet tea get tgtgtca tee
`ctttccccctacaggactcag
`etctccateaa Lgaaetgcc
`ctgggaggcaa ttacel tcgg
`gaettgtet Lcaggagcttc
`ctttcccectacaggaeteag
`get a tgacaeta 11 taeagacte
`etgggaggeaattaccl Legg
`at tcglgca tetctga Laga tc
`
`" DMD exon J-17 deletion taken into account when calculating expected size.
`
`Expected size (hp)
`
`1286
`
`1147
`
`1611"
`
`

`

`586
`
`G. McC/orey el al. I Ne11ro11111srnlar Disorders /6 ( 2006) 583--590
`
`<
`
`the AO-OptiMEM solution was prcferabl_c, as_ tl~is ~cch(cid:173)
`niquc was more easily control~cd, unlike 111JCcll_ons,
`where leakage of the AO solution could occur from
`some small muscle explant~. ~s ~o ad~ant_age :"as con(cid:173)
`d by combining AO mJect1on with mfus1on, AO
`r
`d" ·
`•
`1erre
`· n •tlonc w·1s selected as the optimum con 1t1on
`· f
`111 USIO
`c
`·nduce exon skipping in muscle explants.
`d .
`t
`01
`111 nor-
`AO induced exon skipping was demonstrate
`mal human muscle explants, comparing the etlkacy of
`the three AO chemistries. A biopsy fragment from the
`vastus 111edialis muscle was dissected into 2-3 mm 3 seg(cid:173)
`ments and infused with 10 ~tM of either H6A(+69+91)
`or H8A(-06+ 18) 2OMe AO, PMO or PMO-Pep for 7
`to RNA extraction. H6A(+69+91) or
`days prior
`H8A(-06+ 18) A Os had been optimized in our laborato-
`
`ry and were the only human dystrophin AOs available
`that had been synthesized using all three chemistries.
`Removal of exon 6 (ti 173 bp) from the dystrophin tran(cid:173)
`script was detected for each AO chemistry with an
`observed ellicacy: PMO-Pep > PMO > 2OMe
`the
`in
`ability to induce exon removal (Fig. 2) . Removal of
`cxons 6 and 9 (L'i305 bp) from the dystrophin transcript
`was sporadically observed ( Fig. 2). In contrast, exon 8
`skipping (L'il85 bp) was always accompanied by exon 9
`removal and could be detected in PMO and PMO-Pcp
`treated tissue, but not after treatment of the ex plant with
`the 2OMc AO (Fig. 2).
`Dystrophic muscle was obtained from a DMD
`patient with the deletion of dystrophin exons 3-17,
`that
`transcript
`which produces an out-of-frame
`
`..
`"C
`!!l
`a. ~
`.0
`0
`C
`0
`~ ::,
`Cd w WH-~
`
`::;;
`:,.
`:;;
`0
`:;; ~
`:,.
`a.
`:,.
`0
`Q)
`~ 0
`~ 0..
`Q)
`0 6
`:;;
`::;;
`:;;
`0
`0..
`0..
`N
`
`- .. ·--
`
`1147 bp -
`A6974bp- -
`A6+9 842 bp - • -
`
`Q)
`
`'l'
`a::
`u
`0..
`
`Q)
`
`a.
`.0
`0
`0
`
`::;;
`:,.
`0
`:;;
`:;;
`..
`:,.
`a.
`"C
`:,.
`0
`!!l
`Q)
`~ 0
`'l'
`0..
`0 6
`~ Q)
`a::
`:;;
`::;;
`:;; u
`0
`C
`::,
`0..
`0..
`0..
`N
`,.._ c• kl:.~ -,~ ...
`- -1015 bp M
`, ...
`
`- 1147 bp
`
`- 830 bp A8+9
`
`rig. 2. Control human muscle cxplants were incubated with 10 r1M of either 116A(+69+91) or IISA(-06+ 18) 2OMe, l'MO or PMO-Pcp AOs for 7
`days. Shorter PCR products indicate removal of cxon 6 alone (974 hp) , cxon (,and') (842 hp), cxon 8 and 9 (830 bp) or cxon 9 alone ( 1015 bp) from
`the dystrophin transcript.
`
`H6A(+69+91)
`
`HBA(-06+18)
`
`h
`
`a.
`.c
`0
`0 ....
`
`"O
`2
`ra
`~ :!:
`:::i.
`-
`C:
`0
`....
`::>
`
`C.
`.c
`0
`0 ....
`
`a.
`.c
`0
`0
`
`-1611bp-
`-M81487 bp-
`
`Day 3
`
`Day 7
`
`"O
`a,
`io
`~ :!:
`:::i.
`-
`C:
`0
`....
`::>
`
`a,
`:!: ~
`=:(cid:173)
`.....
`(.J
`C..
`
`:::i.
`O
`'<!"
`
`a.
`.c
`0
`0 ....
`
`:!:
`:::i.
`0
`N
`
`II
`
`E,on 2 I Exoo 19
`
`, T T T T C T ;, ;, G G C C ., T ;, G ;, G C
`
`- 1611 bp
`-MS 1487 bp
`
`Day 14
`
`a
`
`- C
`
`
`
`C.
`.c
`0
`0 ....
`
`/
`
`Fig. 3. ln<lucti'.m ofexon 18 skipping in dystrophin transcripts from DMD musdc ex plants missing cxon 3-17, to restme the mRNi\ reading fra111c.
`Explants were mcubated with II 18A(+24+ 53) 2OMc AO for (a) 3 days, (h) ?days and (c) 14 days at IO, 20 and 40 pM. A shorter !'CR product of
`1487_ hp correspond~ to removal of cxon 18 from the dystrophin transcript. A sporadic PCR product of ~ 1350 hp rnuld not he identified and is
`poss1hly a PCR artifact. !'CR products larger than 1611 bp arc products of the outer primer set from the nested arnplilication. (d) Conlirlllation ot'
`the precise splicing of exon 2- 19 was confirmed hy sequencing.
`
`

`

`Ci. McC/orcy <'I al. I Ne11ro11111.1·c11/ar Disorders /6 ( 2006) 583-590
`
`587
`
`precludes the synthesis of a full length dystrophin pro(cid:173)
`tein, Removal or exon 18 restores the dystrophin
`mRNA reading frame and would potentially allow the
`synthesis of an internally deleted dystrophin protein.
`Hl8A(+24+53) and Hl8A(+31+61) had been designed
`to induce exon 18 removal based on in vitro exon skip(cid:173)
`ping studies using normal human myoblast cultures
`(data not shown). These AOs were only available as
`2OMe compounds, so PMO and PMO-Pep chemistries
`could not be evaluated. DMD muscle explants were
`infused with Hl8A(+24+ 53) or Hl8A(+31+61) 2OMe
`AO at 10 ~tM, 20 ~tM and 40 ~tM and RNA extracted
`for nested PCR analysis, after incubation for up to 14
`days. Both AOs induced a similar pattern of exon 18
`removal, but only the results for the H18A(+24+53)
`AO arc shown (Figs. 3a-c). Strong and consistent levels
`or exon 18 skipping was observed by day 3 (Fig. 3a),
`induced at all concentrations, and was still evident at
`day 14 (Pig. 3c). Sequencing of the shorter PCR product
`confirmed precise splicing ofexon 2 to exon 19 (Fig. 3d).
`To ascertain if multiple exon skipping could be
`induced, a cocktail of three additional AOs designed
`to also remove exons 19 and 20, were tested. A IO ~tM
`cocktail of Hl9A(+35+65), H20A(+ 44+71) and
`H20A(+ 147+ 168) 2OMc AOs was combined with
`10 ~tM or Hl8A(+24+53) and DMD tissue fragments
`incubated with the AO mix for I, 3, 7 and 14 days.
`
`or 3 days
`No exon skipping was observed following
`or infusion, however by days 7 and 14, removal or exon
`20 alone (<'1242 bp), 18 and 19 (<'1212 bp) and 18,19 and
`20 (<'1454 bp) was observed (Fig. 4a). The appearance of
`the shorter transcript correlated with a reduction in the
`amount of full length transcript, with the in-frame tran(cid:173)
`script arising from splicing of exons 2-21 being the dom(cid:173)
`inant transcript at day 14 (Fig. 4a), as confirmed by
`sequence analysis (Fig. 4b) .
`
`4. Discussion
`
`Recent studies in the nulx mouse and in human mus(cid:173)
`cle cultures have clearly established the potential of an
`AO induced exon skipping approach to restore dystro(cid:173)
`phin synthesis, despite mutations in the dystrophin gene.
`To date however, these studies have been limited to ani(cid:173)
`mal models and in vitro human experiments, which
`although promising, are unable to provide conclusive
`evidence that exon skipping would be induced by AOs
`delivered to human muscle.
`A humanized mouse model has been constructed to
`facilitate direct testing of AOs to induce exon skipping
`within the human dystrophin gene transcript in muscle
`[14]. However, we urge some caution in interpreting data
`obtained during the processing of a human gene tran(cid:173)
`script using rodent splicing machinery. Whilst we have
`
`"O
`(1)
`<G
`~
`'E
`:::,
`~:..·:~:: .;·:~~- .
`:::.: - . . . . . . . ; .. . ,i
`~
`- - -
`
`-
`
`....
`
`>,
`<G
`0
`
`M
`>,
`<G
`0
`
`.....
`>,
`<G
`0
`
`'<t
`.....
`>,
`<G
`0
`
`(1) ::-
`0::
`(.)
`0..
`
`a.
`..c
`0
`0
`.....
`-
`-- . M8+19 1399bp
`-
`
`- ~20 1369bp
`
`a.
`..c
`0
`....
`0
`
`- h
`
`
`
`a
`
`1611 bp-
`
`M8+19+20 1157bp -
`
`H18A(+24+53)
`H19A(+35+65)
`H20A(+44+71)
`H20A(+147+168)
`
`Exon 2 I Exon 21
`
`,\ T T T T CT h /, G G A T G ,\ /. G T C ;\
`
`hg. 4. (a ) Multiple cxon skipping in DMD L'i3- 17 muscle cxplants incubated with 10 pM oflll8A(+24+53). 1119A( + 35+ 65), II20A(+44+7 1) and
`l 120A( ·I 147+ 168) 2OMc A Os. RT-PCR analysis was performed following I, 3, 7 and 14 days incubation . Removal or exon 18 and 19 ( 1399 bp),
`cxon 20 ( IJ(,9 bp) and cxon 18 and 19 and 20 ( 1157 bp) could be observed by day 7 and 14. (b) Sequencing confirmation or precise removal of exons
`:l --20 from the dystrophin transcript.
`
`

`

`588
`
`G. A-fcC/orcy ct al. / Nrnro11111.1T11lar Disorders 16 (2006) 51/3- 59/J
`
`shown that the same AOs can induce exon 19 skipping
`in human and murine cells in vitro [15], we have found
`that targeting the coordinates which resulted in strong
`and sustained exon 23 skipping in the mdx mouse, had
`no efTect on human exon 23 retention in vitro (unpub(cid:173)
`lished observations). Similarly, when the same coordi(cid:173)
`nates that excluded human dystrophin exons 52 and
`53, were targeted in the mdx mouse, there was no effect
`on murine dystrophin mRNA processing (unpublished
`observations).
`A splice mutation in the sodium channel Navl .6 gene
`(Scn8a) particularly highlights the importance of splic(cid:173)
`ing machinery. Two strains of mice with difTerent splic(cid:173)
`transcript
`the mutant
`ing backgrounds process
`differently and show dramatic variation in disease phe(cid:173)
`notype [ 16, 17]. Additionally, phenotypic variation can
`arise within families with the same dystrophin mutation.
`Disease severity in a family with a nonsense mutation in
`exon 29, appeared to correlate with the levels of exon 29
`skipping [ 18]. In the presence of such reports, we would
`suggest that it is generally preferable to monitor human
`dystrophin splicing on a human background.
`Currently proposed clinical trials will initially under(cid:173)
`take localized intramuscular injections to provide proof
`of concept in human muscle [8]. Obviously, systemic AO
`delivery would be preferable, but in the absence of
`proof-of-principle of this approach in human tissue,
`approval for systemic clinical trials is unlikely to be
`forthcoming, particularly for those AO chemistries that
`have not yet been used in humans. To address this issue,
`we sought to develop an ex villo system that would allow
`for the testing of /\0 analogues to induce exon skipping
`in human muscle.
`Due to the precious nature and limited availability or
`human tissue, optimization of this approach was initial(cid:173)
`ly performed using 111dx mouse muscle. Accurate injec(cid:173)
`tion or AOs into the muscle fragments was hampered
`by AO leakage from the explanl, relkcted in variable
`induction or exon skipping (data not shown). In con(cid:173)
`trast, tissue infusion in media containing the /\0 al a
`specified concentration allowed for more consistent
`AO delivery in multiple ex plants with typical results pre(cid:173)
`sented. Additionally, AO incubation allowed the use of
`smaller muscle fragments, which maximized the surface
`area of muscle fibres in contact with the AO.
`Previous in vitro [3] and in Pivo [6,7] studies demon(cid:173)
`strated that targeting the donor site of cxon 23 could
`cfTicicntly induce removal of that exon and by-pass the
`11ulx nonsense mutation. Incubation of 111dx tissue in
`~he 2OMe, PMO and PMO-Pep AOs preparations
`mduced the removal of exon 23 and cxons 22 and 23
`from the dystrophin transcript. The removal of exon
`22 and 23 has been reported previously [3] and is
`thought to reflect closely coordinated processing of these
`exons. The level of exon skipping was higher and more
`consistent following 7 days of infusion, indicating that
`
`cxplant viability was suflkient to allow the splicing pro(cid:173)
`cess and subsequent synthesis of dystrophin mRNA to
`continue ( data not shown). All AO chemistries induced
`strong cxon skipping where at least 50'% or the tran(cid:173)
`scripts were missing cxon 23, and under these conditions
`it is not possible to identify the preferred compound .
`in exon skipping cllicacy become more
`Differences
`apparent at lower AO concentrations and over extended
`time points. We have recently shown that PMOs were
`able to exert more persistent and sustained cxon 23 skip(cid:173)
`ping in the mdx mouse in vivo when compared to the
`equivalent 2OMcAO (19].
`Having induced consistent exon removal in 111d.t
`tissue, the approach was extended to normal human
`muscle. Surplus muscle from biopsies from individuals
`undergoing contracture testing for malignant hyperther(cid:173)
`mia was obtained for cxplant studies. Similarly, we only
`obtain dystrophic material when a patient undergoes
`elective surgery. These restrictions limit the availability
`of muscle for experimentation, however no patient
`would be required to undergo surgery only for these
`studies. We do not consider this ex vivo protocol to be
`practical for pre-screening patients for suitability for
`an cxon skipping strategy.
`We have developed a panel of AOs to address muta(cid:173)
`tions across the human dystrophin gene transcript [20].
`To dale, no universal splice motif has been identified
`as a reliable target for AOs to redirect dystrophin prc(cid:173)
`mR NA processing. AO design has been optimized using
`overlapping annealing sites, once an amenable target
`had been identified. Moving an annealing site by only
`two or three bases can dramatically influence exon skip(cid:173)
`ping cfTicacy of the AO (unpublished observations).
`However, a hierarchy of cxon skipping potential has
`been observed with overlapping /\Os targeting the 111dx
`mouse dystrophin exon 23 donor splice site, in vitro
`and in 1'ivo. /\ 25mcr was more clTcctivc at cxon 23
`removal than a 20mcr, which in turn was more c!licicnt
`than longer /\Os, regardless of whether the 2OMc or
`morpholino /\Os were used (I larding cl al, manuscript
`in preparation). From these studies, it appears that tar(cid:173)
`get site and /\0 length determined using 2OMc /\Os is
`directly applicable to the l'MO chemistry.
`Because or our interest in the minor deletion hotspot
`of the human dystrophin gene [21 ]. and also in address(cid:173)
`ing the golden retriever muscular dystrophy (GR.MD)
`mutation [22]. we had /\Os optimized for cxons 6 and
`8 that had been synthesized as all three /\0 prepara(cid:173)
`tions, 2OMe, PMO and PMO-pcp. All three /\0 com(cid:173)
`pounds induced cxon (1 removal, whereas only PMO
`and PMO-pcp induced cxon 8 (and 9) removal consis(cid:173)
`tently at 10 ~1M. The 2OMc AO was unable to excise
`exon 8 (and 9) in multiple cxplanls treated at 5, IO or
`20 pM, despite its cllicicncy in Pilro [20]. The inability
`of this compound to induce cxon skipping in cxplants
`may indicate the need for a higher dosage in order lo
`
`

`

`(i. i\fcC/orey et al. I Nc11rn11111.1·rnlar Di.wmlcr.,· /6 ( 2006) 583 -5()(1
`
`589
`
`induce a comparable response to that shown with the
`PMO and PMO-Pep. Alternately, the environment of
`the explant tissue may more closely resemble the i11 vivo
`model and as such may behave differently to typical
`i11 vitro results. Fletcher ct al. [ 19], demonstrated in the
`11ulx mouse that a 2OMe AO directed at the exon 23
`donor splice site was very inefficient at inducing exon
`skipping in vivo, when compared to the PMO under
`the same delivery conditions.
`Significantly, the removal of either exon 6 or exon 8
`from the normal dystrophin transcript produces an
`out-of-frame transcript, which would be expected to be
`subjected to nonsense mediated decay [23]. It is testa(cid:173)
`ment to the ellicacy of this approach that substantial lev(cid:173)
`els of these transcripts could be observed relative to the
`normal full length human dystrophin transcript. The
`removal