1111111111111111 IIIIII IIIII 1111111111 11111 1111111111 11111 lllll lllll 111111111111111 11111111
`US 20100130591Al
`
`c19) United States
`c12) Patent Application Publication
`Sazani et al.
`
`c10) Pub. No.: US 2010/0130591 Al
`May 27, 2010
`(43) Pub. Date:
`
`(54) MULTIPLE EXON SKIPPING
`COMPOSITIONS FOR DMD
`
`(76)
`
`Inventors:
`
`Peter Sazani, Bothell, WA (US);
`Ryszard Kole, Bellevue, WA (US)
`
`Correspondence Address:
`SEED
`INTELLECTUAL PROPERTY LAW
`GROUPPLLC
`701 FIFTH AVE, SUITE 5400
`SEATTLE, WA 98104 (US)
`
`(21) Appl. No.:
`
`12/605,276
`
`(22) Filed:
`
`Oct. 23, 2009
`
`Related U.S. Application Data
`
`(60) Provisional application No. 61/108,416, filed on Oct.
`24, 2008.
`
`Publication Classification
`
`(51)
`
`Int. Cl.
`A61K 3117088
`C07H 21102
`C07K 9/00
`A61P 21100
`
`(2006.01)
`(2006.01)
`(2006.01)
`(2006.01)
`
`(52) U.S. Cl. ....................... 514/44 A; 536/24.5; 530/322
`
`(57)
`
`ABSTRACT
`
`Provided are antisense molecules capable of binding to a
`selected target site in the human dystrophin gene to induce
`exon skipping, and methods of use thereof to treat muscular
`dystrophy.
`
`

`

`Patent Application Publication May 27, 2010 Sheet 1 of 39
`
`US 2010/0130591 Al
`
`I
`
`O=P-N(CH3)2
`t
`0
`
`OrB
`
`1...... """""" """"""
`
`""""" ~ """""" """""" """""" """"""
`""""" . ...J 11
`"""""
`O=~-N(CH3}2
`
`O O B Nr
`oA
`
`FIG. JA
`
`

`

`Patent Application Publication
`
`May 27, 2010 Sheet 2 of 39
`
`US 2010/0130591 Al
`
`:z: ::c
`
`\
`\-------o
`/~
`(
`
`(
`)
`
`~~
`:CZ
`N
`::C
`I
`o--1
`:z:
`(±):]!
`- \~
`I ~ \ ,
`:z
`::c
`:Z:
`
`I
`
`'\
`
`•
`
`'\
`
`\__
`
`::CN
`
`:z: ::c
`
`(1.)
`
`:-2 -a.
`
`(I)
`~
`1=
`0 a.
`fl)
`C
`e!
`I-
`
`ro
`\
`\
`/
`\
`:CZ:
`/
`o-==I
`\ / \
`1 \/\A
`
`N
`
`::c
`:z:
`(±),;
`
`::c
`:Z:
`
`:z:
`::c
`
`N
`
`

`

`Patent Application Publication
`
`May 27, 2010 Sheet 3 of 39
`
`US 2010/0130591 Al
`
`Q)
`-0
`.....
`0..
`(I)
`0.
`1:
`0 a.
`
`fJ)
`C
`~
`I-
`
`\
`/
`/
`l
`\
`\
`\
`/
`(
`
`\
`\
`:::I:Z:
`/
`____/
`0-------'.
`\ / "
`\ / \
`!
`
`

`

`Patent Application Publication May 27, 2010 Sheet 4 of 39
`
`US 2010/0130591 Al
`
`FIG. 1/J
`
`FIG. JE
`
`FIG. JF
`
`FIG. JG
`
`

`

`1,0
`Ul
`0
`~
`
`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`FIG. 2A
`
`1,0
`~
`
`('D
`('D
`
`0
`
`N
`~-....J
`N
`~
`~
`
`0 ....
`Ul
`.....
`rJJ =(cid:173)
`0 ....
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`Oligo SEQ ID NOs shown -SEQ ID NOs 324,326 and 327 were most effective
`
`1565600
`
`1565500
`
`1565400
`
`34-5
`
`M4
`
`3:38
`
`3-39
`
`341
`
`MO
`
`342
`
`343-
`
`335
`
`-331
`
`-
`
`327
`
`323
`
`317
`
`Exon51
`
`336
`
`333:
`
`329
`
`330
`
`324
`
`316
`
`319-
`
`32:1
`
`309
`
`310
`
`311
`
`314
`
`316
`
`DMD Gene 1756
`
`Dystrophin Exon 51 Scan Oligos
`
`

`

`('D
`('D
`
`0
`
`N
`~-....J
`N
`~
`~
`
`0 ....
`O'I
`.....
`rJJ =(cid:173)
`0 ....
`
`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`1,0
`Ul
`0
`(,H
`
`1,0
`(,H
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`FIG. 2B
`
`~~·~~••fit ~iamw ~ rnwr ._. ,_ _,..
`
`5.26% ±0.66
`
`9.89%±1.37
`
`7,40%±0,75
`
`4,65%±1.,89
`
`{SEQ ID N0:326) {SEQ iD N0:327} (SEQ ID N0:588)
`
`{SEQ ID N0:324)
`
`NG-09-0053 I NG-09-0054 I NG-09-0055 I NG-07-1160
`
`09JNJ12-R(E4)
`
`09JNJ12-R(B4)
`
`09JNJ12-R(A4)
`
`09MY11-R{E4)
`
`055; 327
`
`054; 326
`
`053; 324
`
`AVI-5658; 588
`
`Lot
`
`Name; SEQ ID NO
`
`NG-09-0055
`
`NG-09-0054
`
`NG-09-0053
`
`NG-07-1160
`
`Oligo
`
`High-Purity Synthesis, 3.0uM, RD Cells
`
`Exon 51S.3 (RD)
`
`

`

`1,0
`Ul
`0
`~
`
`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`1,0
`~
`
`--.J
`
`('D
`
`0
`
`N
`~--.J
`N
`~
`~
`
`.... 0 =
`.... 0 = ""O = O" -....
`t "e -....
`
`~ ....
`
`(')
`
`('D = ....
`~ ....
`""O
`
`~ ....
`
`(')
`
`0 ....
`('D ....
`rJJ =(cid:173)
`0 ....
`
`FIG. 2C
`
`.. ;,_~:.-,;,;-_,•
`
`!••---~·········~
`
`L10'¼ ±OB ! 0.14% .t0.07
`
`0%
`
`l..30'% .t0.40
`
`! 1.12% t0JJ8
`
`1.0;1·% .HUO
`
`.•..-,:::.-.:.~;-;.._,
`
`~:.-... .-,Gt~;,;,,:
`
`tx SEQ ID NO:S:88 SEU ID N0:594
`
`No NG-07-1160 I Ni:3-08-0835
`
`sm ID N0:324 SEQ ID N0:326 SEQ ID N0:327
`NG-09-0053 I NG-09-0054
`NG-09-0055
`
`09JL07-R(Al)
`
`09JNJ 12-R(E4)
`
`09JNJ1.2-R(B4)
`
`09JNJ12-R(A4)
`
`09MY11-R(E4)
`
`h51AON1: 594
`
`055; 327
`
`054; 326
`
`053; 324
`
`AVI-5658; 588
`
`Lot
`
`Name; SEQ ID NO
`
`NG-08-0835
`
`NG-09-0055
`
`NG-09-0054
`
`NG-09-0053
`
`NG-07-1160
`
`Oligo
`
`High-Purity Synthesis, 3.0uM, Human Primary Skeletal Muscle Cells
`SlMCS (Muscle Cell Competitor Screen)
`
`

`

`1,0
`Ul
`0
`~
`
`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`1,0
`~
`
`QO
`
`('D
`('D
`
`0 ....
`.....
`rJJ =(cid:173)
`0 ....
`
`0
`
`N
`~-....J
`N
`~
`~
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`MON#24{SEQ 10:599:}
`
`FIG. 2D
`
`MON#23{SEQ !D:595}
`
`h51AON1(SEQ I0:594}
`
`H51A(-t-66+00}{SEQ 10:592}
`
`AVM%57{SEQ 10:557}
`
`AVl465!{SEQ 10:535}
`1565500
`
`TAAGGAAACTGCCATCTCCAAACTAGAAATGCCATCTTCSTT8ATGTTQ8AGGTACCTGCTCTQ8CAGATTTCA
`
`Exon51
`
`SEQIDN0:326
`
`SEQ ID NO:i24
`
`$EQ!ON0:327
`
`DMD Gene 1 7 56
`
`Selected Dystrophin Exon 51 Oligos
`
`

`

`1,0
`Ul
`0
`~
`
`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`FIG. 3A
`
`1,0
`~
`
`1,0
`
`('D
`('D
`
`0 ....
`.....
`rJJ =(cid:173)
`0 ....
`
`0
`
`N
`~-....J
`N
`~
`~
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`585.(AVJ.,$9:15)
`
`291{0742)
`
`1519600
`
`MOAON2
`
`2S5
`
`286
`
`237(AVM>OS-8}
`
`284
`
`2:88
`
`28$
`
`290{0741)
`
`h50AON1
`
`586(HOOA{-Hl7 +3S)}
`
`584{AVl•56561
`
`ExonSO
`
`282
`
`231'.l
`
`275
`
`279'
`
`2:tl$
`
`271
`
`273
`
`277(0731)
`
`1519500
`
`I
`
`267
`
`DMD Gene 17.56
`
`Dystrophin Exon 50 Scan Oligos
`
`

`

`('D
`('D
`
`0
`
`N
`~--:i
`N
`~
`~
`
`0 ....
`0
`....
`.....
`rJJ =(cid:173)
`0 ....
`
`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`1,0
`Ul
`0
`(,H
`
`1,0
`(,H
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`FIG. 3B
`
`AV! #00453 -02FEB2009
`*Determined from dose-ranging studies in RD cells
`
`2.402
`
`1.836
`0.966
`
`1.741
`
`3.693
`0.921
`
`NG-08-0742 (SEQ ID NO:291)
`
`NG~08--0741 (SEQ ID NO:290}
`
`AVl-5038 (SEQ ID NO:287)
`
`NG-08~0731 (SEQ ID N0:277)
`
`AVl-5915 (SEQ ID NO:585)
`
`AVl~5656 (SEQ 10 N0:584)
`
`EC50 (micromolar)*
`
`Compound
`
`AVi,-$915
`
`h50AON2
`
`1519600
`
`1150.AON1
`
`H~OA(·Hl7+33}H
`
`AVl-$6~
`
`TMA(;l~(;'•l•<,TTl,t,N,C,i\TCT<>'-GCTC'T<M<lT¼AAOO¼!J,MACCGTTTf,(;Trt.A,\G,\C<CTtA(;C,GtAAA~CA<;CCTGACC"fMCTCC'fGG/>.CTt,'l.0.'.ACTATT~()f..()(;t;T(lT,\IIOTI\TACi'<';O,>"rtctATrcTCTf
`
`741
`
`742
`
`AVl,M:38
`
`ExonSO
`
`731
`
`DMD Gene 1756
`
`Selected Dystrophin Exon 50 Oligos
`
`

`

`1,0
`Ul
`0
`~
`
`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`FIG. 4A
`
`1,0
`~
`
`('D
`('D
`
`0
`
`N
`~-....J
`N
`~
`~
`
`0 ....
`....
`....
`.....
`rJJ =(cid:173)
`0 ....
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`1660200
`
`1660100
`
`1660000
`
`4$1
`
`-
`
`444
`
`ExonS3
`
`439
`
`443
`
`434
`
`429
`
`424
`
`436
`
`431
`
`-
`
`416
`
`418
`
`446
`
`445
`
`438
`
`433
`
`428
`
`447
`
`440
`
`448
`
`44-9
`
`45()
`
`420
`
`412
`
`426
`
`OMO Gene 1756
`
`Dystrophin Exon 53 Scan Oligos
`
`

`

`1,0
`Ul
`0
`~
`
`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`1,0
`~
`
`('D
`('D
`
`0
`
`N
`~-....J
`N
`~
`~
`
`0 ....
`N
`....
`.....
`rJJ =(cid:173)
`0 ....
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`FIG. 4B
`
`610(h5MON1)
`
`609{H53A{+2l+-47})
`
`1660100
`
`TTTCCTTTTATTCTAGTTGAAAGAATTCA6AATCA6TUGGATBAAGTACAAGAACACCTTCAGAACCGGAGGCAACAGTTGAATGAAATGTTAfAGGATTCAAC
`
`608{H53A{+39+69l)
`
`611 {H53A(,12+10})
`
`ExonS3
`
`428
`
`42:9
`
`431
`
`DMD Gene 1756
`
`Selected Dystrophin Exon 53 Oligos
`
`

`

`Patent Application Publication May 27, 2010 Sheet 13 of 39
`
`US 2010/0130591 Al
`
`0
`
`~
`::,
`0
`0
`rl
`
`~
`:l
`0
`l.f)
`
`N
`<:;j'
`
`N
`0)
`
`0 +I
`
`m
`
`I i:
`8 I
`I
`I
`I
`~ I
`; I
`ci I
`
`ci
`
`· ..
`
`<:::t
`
`-N
`0 z
`0 -Ci
`
`w
`
`ti') --Lf) w -a:::
`
`I
`
`r-i n
`=>
`<(
`0)
`0
`~
`tj"
`r-,..
`0
`I
`
`<..? z
`
`V)
`
`(U u
`C
`
`ex:: -~
`
`::J
`0 .
`0
`N ~
`....
`.
`• 0
`0::
`Lt") ...
`0 . m
`0
`...
`CV) 0 .
`LI) N ...
`0 .
`
`C: r1 -0
`
`QJ
`
`,+,..I
`C
`
`"' V') ·-
`X V,
`LU ..c:
`>-<.n
`>-+-'
`:.,_
`:,
`0..
`I ..c
`bO ·-:r:
`
`

`

`1,0
`Ul
`0
`~
`
`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`1,0
`~
`
`.i;...
`
`('D
`('D
`
`0
`
`N
`~-....J
`N
`~
`~
`
`0 ....
`....
`.....
`rJJ =(cid:173)
`0 ....
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`FIG. 4JJ
`
`•, ..... : .. :::.
`
`.~#/)")")")')")::
`
`-(/,,,,,,,,,,.,.,
`
`11i•-+;n:::. ; w;
`:;;;;;;;; . ., t :1::::rn
`2.62% ±0.15 4.63% ±0.73 0%
`
`::::::::::
`
`0
`
`10.0uM
`
`5.0uM
`
`❖:(;,,(;i/)~:•
`,;;.,.,;w;.
`
`·11m•v
`jJrn
`1.72% ±0.24 2.40% ±0.70
`
`1nwwr wr:tc :uw1r
`
`,1,tm
`
`ia -,:::::::: 11h11if
`1.05% ±0.43
`
`3.0uM
`
`2.0uM
`
`1.0uM
`
`NG-0749 09AU11-R(A7) (SEQ ID NO: 428)
`
`High-Purity Synthesis, (1.0, 2.0, 3.0, 5.0, 10.0uM) RD Cells
`
`Exon 53 DR.2
`
`

`

`Patent Application Publication May 27, 2010 Sheet 15 of 39
`
`US 2010/0130591 Al
`
`V)
`
`(U u
`0
`
`er.: -~
`
`-m
`N
`~ ..
`0 z
`Cl -
`Ci
`LU
`
`V') -· -,......
`u -ex:
`
`I
`\'"-1
`ri
`::::,
`<!
`0)
`0
`0
`Lf')
`r-,...
`0
`I
`
`l9 z
`
`00
`~
`"-1'
`+!
`
`0
`
`:'.2
`:,
`0 .
`
`0
`rl
`
`L()
`lO
`0
`+l
`'t<.
`M
`~
`"1'
`
`~
`:J
`0
`rl
`
`:J
`0 .
`0
`N ~ ...
`• 0 .
`ex: I.I')
`.._
`0
`0 .
`m
`.... m 0 •
`L() N ...
`C: 'l""'I -0
`0 .
`...
`V'l ·-
`X
`LU ..c:
`C: >
`>
`,.....i ·-t.,_ = 0..
`00 ·-:c
`
`V,
`(l)
`
`,,1,,,,1
`
`[,/')
`
`I
`,.c
`
`

`

`1,0
`Ul
`0
`~
`
`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`1,0
`~
`
`('D
`('D
`
`0
`
`N
`~-....J
`N
`~
`~
`
`0 ....
`O'I
`....
`.....
`rJJ =(cid:173)
`0 ....
`
`.::~~~::::.:.:.:•
`
`·•::!w.Mi·
`
`•:~~~~i8?-=
`
`·::~:-?-~~-:'-:-?-~:
`
`,::?::'.:'.::~~:::
`
`4.18% ±0.39 13.89% ±0.54 0%
`
`-------
`
`0
`
`10.0uM
`
`5.0uM
`
`FIG. 4F
`
`.~~=i)H
`
`·-=~~~;:,
`
`})////;;.:
`
`1r.1W@Y::;:fi g u111y11J111 II ;1;,;j:f
`
`1.98% ±0.43 2.74% ±0.38
`
`0.79% ±0.12
`
`3.0uM
`
`2.0uM
`
`1.0uM
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`NG-0751O9AU11-J{E7) (SEQ ID NO: 431)
`
`High-Purity Synthesis, (1.0, 2.0, 3.0, 5.0, 10.0uM) RD Cells
`
`Exon 53 DR.2
`
`

`

`1,0
`Ul
`0
`~
`
`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`1,0
`~
`
`('D
`('D
`
`0
`
`N
`~-....J
`N
`~
`~
`
`0 ....
`-....J
`....
`.....
`rJJ =(cid:173)
`0 ....
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`FIG. 4G
`
`25.3
`
`13.89
`
`4.18
`
`2.74
`
`1.98
`
`0.79
`
`9.3
`
`57.67
`
`23.29
`
`17.28
`
`10.44
`
`4.83
`
`72.2
`
`4.63
`
`2.62
`
`2.40
`
`1.72
`
`1.05
`
`NA
`
`3.53
`
`0.54
`
`0.00
`
`0.00
`
`0.00
`
`EC50 (uM)
`
`10
`
`5.0
`
`3.0
`
`2.0
`
`1.0
`
`N0:431)
`
`N0:429)
`
`N0:428)
`
`N0:422)
`
`751 (SEQ ID
`
`750 (SEQ ID
`
`749 (SEQ ID
`
`746 (SEQ ID
`
`Treatment
`
`(uM)
`
`Percent Exon Skipped
`
`Exon53 RD Cell Dose-Range Summary
`
`

`

`1,0
`Ul
`0
`~
`
`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`FIG. 4H
`
`..: .. ~.:.:.:.:::
`
`:-~.(.'."~~~:::·
`
`:·:::::::·:::::·:
`
`1,0
`~
`
`QO
`
`('D
`('D
`
`0
`
`0 ....
`....
`.....
`rJJ =(cid:173)
`0 ....
`
`N
`~--..J
`N
`~
`~
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`:-:~==~~~~·-
`
`,'.~,!.• ii
`
`«W > -;;; ?t :. lw: i* 1i11Ji:i -.
`
`■-:~;ti•i1
`
`·~~~::.:~::.;::
`
`.. ,.;...:;:::::::.
`
`·•••••••
`
`·.-: <w : .··••·•·•·•·•·•·-·_. •
`
`•
`
`;•· tc
`
`•
`
`I 1.49% ±0.21 I 16.49% ±135 I D"!o ±o
`
`1.03% ±0.10
`
`5.21% ±139 I 20,09% ±:LOO I Not quantified
`
`SEQ ID NO:610 SEQ ID NO:611 SEQ ID NO:429 I 0
`
`750
`
`I
`
`I 560
`
`559
`
`0
`
`SEQ ID NO:608 SEQ ID NO:609 SEQ ID NO:429
`
`750
`
`I
`
`I 750 {W)
`
`490
`
`09AU11-R(C7)
`09AU18-J(D1)
`09AU18-J(C1)
`09-AU 18-J(Bl)
`09AU18-J(Al)
`
`Lot
`
`008; 429
`
`H53A(-12+10); 611
`
`h53AON1; 610
`
`H53A(+.23+47); 609
`H53A( +39+69); 608
`
`Name; SEQ ID
`
`NG-08-0750
`NG-09-0560
`NG-09-0559
`
`NG-08-0750 (W)
`
`NG-09-0490
`
`Oligo
`
`High-Purity Synthesis, 3.0uM, RD Cells
`
`Exon 53 CS (Competitor Screen)
`
`

`

`1,0
`Ul
`0
`~
`
`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`FIG. 41
`
`1,0
`~
`
`1,0
`
`('D
`('D
`
`0
`
`0 ....
`....
`.....
`rJJ =(cid:173)
`0 ....
`
`N
`~-....J
`N
`~
`~
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`❖-: :,::::::::,::•:•·
`
`%
`
`,.,19,0
`(RD) I Marker
`750
`
`09AU11-R(C7)
`09AU18-J(Dl)
`09AU18-J(C1}
`09-AU18-J(Bl)
`09AU18-J(Al)
`
`Lot
`
`0%
`
`NoTx
`
`0
`
`j)j:::::r :1 • • • •
`
`0%
`
`• :• :• :;;iii~ • :jjjjjjjj
`
`0%
`
`0,64%±0.07
`
`SEQ ID NO:609 SEQ ID NO:610 SEQ !D NO:611
`
`560
`
`I
`
`559
`
`I
`
`750
`
`008; 429
`
`H53A(-12+ 10); 611
`
`h53AON1 ~ 610
`
`H53A(+23+47); 609
`H53A( +39+69); 608
`
`Name; SEQ ID
`
`NG-08-0750
`NG-09-0560
`NG-09-0559
`
`NG-08-0750 (W)
`
`NG-09-0490
`
`Oligo
`
`High-Purity Synthesis, 3.0uM, Human Primary Skeletal Muscle Cells
`
`Exon 53 MCS (Muscle Cell Competitor Screen)
`
`

`

`Patent Application Publication May 27, 2010 Sheet 20 of 39
`
`US 2010/0130591 Al
`
`,._ -
`
`U)
`0
`bQ
`0
`C
`C'O u
`V)
`8d"
`~
`C
`0
`X
`UJ
`C
`,.t:
`0..
`0
`fl) >
`0
`
`·-
`
`-.....,
`
`!.:O
`i,,n
`I""-
`,,...
`w
`C
`~
`0
`0
`~
`0
`
`~ ,;-
`
`-
`~.,
`
`....
`
`'t"'
`
`t\l
`'<"'
`
`0
`..-
`
`><q'
`V
`C
`0
`X
`UJ
`
`U'3
`
`~
`~
`~
`
`(::)
`~
`~
`
`-
`-
`
`

`

`1,0
`Ul
`0
`~
`
`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`FIG. 5B
`
`1,0
`~
`
`('D
`
`0
`
`N
`~-....J
`N
`~
`~
`~
`
`0 ....
`N ....
`.....
`rJJ =- ('D
`0 ....
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`1122700
`
`001 (H44A{+S5,i..104}}
`
`1122600 ffll-O{H44A(+61,t84))
`
`002(h44AON1)
`
`S03{H44AHl6+14})
`
`Exon44
`
`11
`
`12:
`
`DMD Gene 1 7 56
`
`3
`
`4
`
`Selected Dystrophin Exon 44 Oli'gos
`
`

`

`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`1,0
`Ul
`0
`(,H
`
`N
`~-....J
`N
`~
`~
`
`0 ....
`
`1,0
`(,H
`
`('D
`('D
`
`0
`
`N
`N
`.....
`rJJ =(cid:173)
`0 ....
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`W.#.&..:i::
`
`~
`
`:~.
`
`~·
`
`t\t1t
`
`J@.li.
`J,ffi:111
`
`.P/4#4
`
`:;:jti;j
`
`•:~;;;;;;;~-
`
`:<\Y :Th:
`;Miii +p · Vjj fa •@Hi
`
`~*f.(.?/4~:
`
`,•;==t?.1"j«;
`
`W4.f.(.(«~· ~k:)i.:
`
`FIG. 5C
`
`j,;fj#
`
`#;##
`
`~·
`.if/#i#
`
`•tiiittliiiifliwWiill
`
`2L64% ±3.03 64.94% ±2.02 0%
`
`4.66% ±0.85 7.56% ±0.54
`
`3.14% ±0.86
`
`0
`
`10.0uM
`
`3.0uM
`
`LOuM
`
`0.3uM
`
`O,luM
`
`NG-08-0792 09AU11-J(A2) (SEQ ID NO: 4)
`
`High-Purity Synthesis, (0.11 0.3, 1.0, 3.0, 10.0uM) RD Cells
`Exon 44 DR.2 (Dose-Range)
`
`

`

`Patent Application Publication May 27, 2010 Sheet 23 of 39
`
`US 2010/0130591 Al
`
`vi
`
`QJ u
`0
`
`0::: -~
`
`:::s
`0 .
`0
`N
`r-1 ...
`.
`• 0
`0:::
`M
`...
`0
`0 .
`t""l
`..,
`M .
`~
`~ 0
`..,
`r--1
`
`C: 0 -0
`...
`VI X ·-VI
`QJ
`LJ.J
`..c
`+-,I c::
`> V)
`> +-' ·-!,.,,.
`
`::,
`0..
`I
`..c.
`.OD
`:I:
`
`-00
`0 z
`
`0
`Cf
`w
`
`V) --N co -7
`
`rl
`rl
`:::,
`<(
`O')
`0
`1...0
`0)
`
`"'" 0
`
`I
`00
`0
`I
`
`l? z
`
`E>ill I
`· ml
`
`0
`0
`Lfi
`+I
`'#(cid:173)
`~
`I'
`0) m
`
`r-,,
`N
`0 +I
`* rl
`
`~
`r-,.
`rl
`
`I.I)
`01
`0
`+I
`'#,
`
`°"
`
`'-D
`'-D
`
`N
`f"-..
`0
`+I
`
`* "'1'
`
`rl
`«:::t
`
`0
`
`z ::}
`
`0
`0
`M
`
`~
`::}
`0
`M
`
`~
`:::,
`M .
`
`0
`
`~
`:::,
`.,...;
`0
`
`

`

`Patent Application Publication May 27, 2010 Sheet 24 of 39
`
`US 2010/0130591 Al
`
`M
`r,..
`N
`+I
`
`* I'-
`
`tHIII I I 11
`~ II
`r ,. .,.·
`I
`I I
`I I
`I I
`I I
`
`~
`co
`co
`r---,
`~
`rl
`+1
`
`* N
`
`0)
`
`N rn
`
`0
`
`V)
`
`t""I
`
`-M
`0 z
`a
`Cf
`UJ
`
`ti') --N u -~
`
`!
`-t
`-t
`
`=> <(
`
`0)
`0
`0)
`0)
`r-,..
`0
`!
`00
`0
`!
`
`t!J z
`
`(1) u
`Q
`
`0::: -~
`
`::l
`0 .
`0
`N
`\""'I
`....
`. m
`• 0
`ex::
`...
`0
`0 .
`~
`...
`m .
`~
`~ 0 ...
`.
`0 -0
`C:
`X ·-V')
`UJ ..c
`+-"
`C
`> V)
`> +-' ·-,_
`:J
`0..
`I .c
`.9P
`J:
`
`~
`
`....
`V)
`
`(l)
`
`~
`::J a
`
`rl
`
`rl
`N
`
`00
`~
`0
`+I
`
`* rl
`
`~
`00
`
`

`

`Patent Application Publication May 27, 2010 Sheet 25 of 39
`
`US 2010/0130591 Al
`
`C'l
`
`~
`
`V') --(1J u
`cc: -~
`0 .
`0 N M
`....
`• 0
`.
`0::
`m
`Cl
`"' 0 .
`r-1
`...
`¢
`n1 .
`¢
`0 ...
`.
`0 -0
`C
`...
`X ·-V')
`UJ ..c
`C: > V)
`> +,I ·-,_
`
`rl
`
`V')
`
`(U
`
`+J
`
`l
`
`:J
`a..
`..c:
`OJ)
`♦-:c
`
`t-l
`
`-N
`0 z
`0 -Cf
`V) --N
`0 ---,
`
`LLJ
`
`!
`-1
`M
`:::,
`<t:
`O')
`a
`0
`0 co
`0
`!
`00
`0
`!
`
`(.9 z
`
`00
`N
`ci
`+I
`'?:f_
`N
`Lt)
`
`"° Cl)
`
`0
`
`2
`::J
`0 . m
`
`m
`rl
`rl
`+I
`~
`.-f
`00
`00
`.-f
`r--..
`r--..
`
`2
`::J
`("()
`0
`
`~
`:le
`~ .
`
`0
`
`

`

`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`1,0
`Ul
`0
`(,H
`
`N
`~-....J
`N
`~
`~
`
`0 ....
`
`1,0
`(,H
`
`('D
`('D
`
`0
`
`O'I
`N
`.....
`rJJ =(cid:173)
`0 ....
`
`-·W<.Y-?-?-:'~-
`
`:-%%{-?.!:·
`
`··Jx;:
`
`·-:.({{-¥////4
`
`'ffl/A
`"';~JF
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`FIG. 5G
`
`-;?-:'?.ii.(-•
`
`.-:::i'.?;;;;-At=:
`
`,;,~
`
`4w:.if@
`
`~~: -~::::?-~?<.?-?-:::
`i@@; i~
`¾f
`22.50% ±1.94 69.38% ±5.85 0%
`
`·dfaH~:-
`
`-:•::~22.:-22.:--::-·
`
`~~-, LT
`
`<3'.::::::::::::.:
`
`::.::·:·:··:.·.:_.
`:-:~;,;,;;,;,;)z
`
`:i; ,\\i\ \ J 1. •·· .iii~!~ al
`
`4.06% ±0.81 9.01% ±0.56
`
`2.10% ±0.28
`
`/iii(;;;: -
`
`•: .; %(
`
`0
`
`10.0uM
`
`3.0uM
`
`1.0uM
`
`0.3uM
`
`O.luM
`
`NG-080109AU11-J(E2) {SEQ ID NO: 1.3)
`
`High-Purity Synthesis, (0.1, 0.3, 1.0, 3.0, 10.0uM) RD Cells
`
`Exon 44 DR.2
`
`

`

`1,0
`Ul
`0
`~
`
`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`1,0
`~
`
`0 ....
`
`('D
`('D
`
`0
`
`N
`~-....J
`N
`~
`~
`
`-....J
`N
`.....
`rJJ =(cid:173)
`0 ....
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`FIG. 5H
`
`6.277
`
`69.38
`
`22.50
`
`9.01
`
`4.06
`
`2.10
`
`2.795
`
`96.52
`
`46.71
`
`18.81
`
`16.01
`
`7.49
`
`3.594
`
`88.47
`
`32.92
`
`21.48
`
`8.41
`
`3.00
`
`N0:13)
`
`N0:12)
`
`NO: 11)
`
`3.024
`
`97.39
`
`39.74
`
`17.41
`
`6.69
`
`4.14
`
`N0:8)
`
`7.166
`
`64.94
`
`21.64
`
`7.56
`
`4.66
`
`3.14
`
`N0:4)
`
`(SEQ ID
`
`801
`
`800 (SEQ ID
`
`799 (SEQ ID
`
`796 (SEQ ID
`
`792 (SEQ ID
`
`Percent Exon Skipped
`
`EC50 (uM)
`
`10
`
`3
`
`1
`
`0.3
`
`0.1
`
`Treatment
`
`(uM)
`
`Exon44 RD Cell Dose-Range Summary
`
`

`

`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`1,0
`Ul
`0
`(,H
`
`FIG. 51
`
`-:-:-x:.::.::-:
`
`.;:::-:-:-~·.
`
`N
`~--.J
`N
`~
`~
`
`0 ....
`
`1,0
`(,H
`
`('D
`('D
`
`0
`
`QO
`N
`.....
`rJJ =(cid:173)
`0 ....
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`0% -
`
`•;,;@//,, -~ ~·
`
`-~ ~@".(,!':; ~
`
`~ ~ ~ ~ iii :,;,,;,,;,,;,;,p
`
`~
`
`0
`
`MW
`
`47.5% ±2,05
`
`±0.07
`97.1%
`NO:603 12
`SEQ!D SEQID NO:
`564
`
`800
`
`94.0% ±0,32
`
`602
`SEQ ID NO:
`563
`
`Not quantified
`
`44.4% ±422 20.4% ±0,84
`
`SEQ ID N0:12
`300
`
`600
`SEQ ID NO: SEQ ID NO:
`561
`
`562
`
`601
`
`09AU11-J(D2)
`
`012; 12
`
`09AU18-J(B2)
`
`H44A(-06+14); 603
`
`09AU18-J(A2)
`
`h44AON1; 602
`
`09AU18-J(F1)
`
`H44A( +85+ 104); 601
`
`09AU18-J(E1)
`
`H44A(+61+84)~600
`
`Lot
`
`Name; Seq lP
`
`NG-08-0800
`
`NG-09-0564
`
`NG-09-0563
`
`NG-09-0562
`
`NG-09-0561
`
`Oligo
`
`High-Purity Synthesis, 3.0uM, RD Cells
`
`Exon 44 CS (Competitor Screen)
`
`~:;:.;,;-».;-
`
`~-:~: ~ ~~~-:-A:
`~~~~~~~·~·~:r;-;-;-;w
`.~
`:::::::::::::::
`
`·¥H;,;,;::
`
`-:.:~~:-:-h
`
`.;;;;;;;.
`
`::::::::::::::
`
`::
`
`. ::,;,;,;,;,/..
`-:-;,;,;,,;,,;,,;:: ~ ...
`
`·-
`
`

`

`1,0
`Ul
`0
`~
`
`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`.~~~::,,:,,:,;;:.:
`
`~
`
`·~· ~#;r;,;,;-;· ·~
`
`~. ~ .~ ·iii Ji& :iM ~: ~.(¥.(k't ~
`
`1,0
`~
`
`0 ....
`
`('D
`('D
`
`0
`
`N
`~--.J
`N
`~
`~
`
`1,0
`N
`.....
`rJJ =(cid:173)
`0 ....
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`47.53% ±2.0S
`
`0%
`
`Quanti-fied
`
`800 (RD)
`
`No tx
`
`Not
`800
`
`FIG. 5J
`
`,~ .•• ~~ii·••-~-
`
`6.42% ±0.54
`
`0%
`
`s.86% ±0.57 I 2.13% ±0.75
`
`563
`
`562
`
`I 561
`
`800
`
`Inadequate NG-09-0564 to include in screen.
`
`09AU11-J(D2)
`
`012; 12
`
`09AU18-J(B2)
`
`H44A(-06+14)~ 603
`
`09AU18-J(A2)
`
`h44AON 1; 602
`
`09AU18-J(F1)
`
`H44A(+85+104); 601
`
`09AU18-J(E1)
`
`H44A(+61+84); 600
`
`Lot
`
`Name;SeqIO
`
`NG-08-0800
`
`NG-09-0564
`
`NG-09-0563
`
`NG-09-0562
`
`NG-09-0561
`
`Oligo
`
`High-Purity Synthesis, 3.0uM, Human Primary Skeletal Muscle Cells
`
`Exon 44 MCS {Muscle Cell Competitor Screen)
`
`

`

`Patent Application Publication May 27, 2010 Sheet 30 of 39
`
`US 2010/0130591 Al
`
`<:::)
`
`~ -~ -
`
`<:::)
`<:::)
`t'-1
`~
`
`-
`-
`
`.....
`ii'!
`
`g
`
`M:
`In
`
`N m
`
`i
`
`~
`
`~
`
`~
`
`~
`W'l
`r--...
`,--
`
`~
`&:
`IU
`~
`Q
`~
`0
`
`("i.
`~
`
`...,
`'>ll
`
`(ft
`M
`
`ll")
`~
`C
`0
`~
`W..l
`
`I-,.
`~
`
`~
`M
`
`~
`~
`~
`
`V)
`0
`
`bl.) ·--
`0
`C
`tO u
`V)
`Ln
`~
`C:
`0
`X
`w
`C
`..c
`0..
`0
`'-
`+,if
`V)< >
`C
`
`·-
`
`

`

`1,0
`Ul
`0
`~
`
`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`FIG. 6B
`
`0 ....
`~ ....
`.....
`rJJ =(cid:173)
`0 ....
`
`('D
`('D
`
`0
`
`N
`~-....J
`N
`~
`~
`
`1,0
`~
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`605(h45AON1}
`
`006(M5AONS}
`
`1371200
`
`004(H4.SA( ♦71♦90))
`
`007(H4.SA( -06♦2.0))
`1371'100
`
`Exon45
`
`39
`
`DMD Gene 1 756
`
`34
`
`21'
`
`29
`
`Selected Dystrophin Exon 45 Oligos
`
`

`

`Patent Application Publication May 27, 2010 Sheet 32 of 39
`
`US 2010/0130591 Al
`
`V)
`
`QJ u
`0
`
`0:: -~
`
`::,
`0 .
`0
`N
`'t""i
`.._
`• 0
`0::
`Cl 0 .
`("(')
`....
`LO
`0 .
`-=::I- N
`.
`"" 0
`ri -0
`C
`V) ·-X
`LJ.J
`
`~
`
`LI)
`....
`
`.._
`
`V)
`(1.)
`...c::
`+J
`C:
`> V')
`>
`...... ·-L.
`
`::l
`0...
`I ..c
`b.O ·-::r:::
`
`N
`
`-r-,-..
`0 z
`0 -cJ
`(/) --N
`u... ---,
`
`LU
`
`!
`t""i
`r-t
`::)
`<(
`O')
`0
`0 r-...
`r-...
`0
`!
`t.9 z
`
`0
`
`2
`:,
`0
`i.n
`
`~
`:,
`0
`m
`
`2
`:,
`0
`N
`
`Lt) q
`0
`+!
`~ a
`'° 0
`
`,;;:t
`0
`0 +!
`~
`M
`<:::I"
`0
`
`0
`+!
`~
`0
`
`

`

`1,0
`Ul
`0
`~
`
`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`~
`~
`
`0 ....
`
`1,0
`~
`
`N
`~-....J
`N
`~
`~
`
`.....
`rJJ =(cid:173)
`0 ....
`
`('D
`('D
`
`0
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`-;-:.~::·::-
`
`-"///#//#
`
`-=~?.;,_;,;::::::::·
`
`,~
`
`:.-;,-///?.-Xk·
`-'./~
`
`iiiiW
`
`:t:·::"::t:·
`
`-~,(/.(//;,,.#,
`
`=<i;i((;_
`
`~"~ :· .. ::: .. :: .. -.:
`
`FIG. 6JJ
`
`.-:-:-:·::.,:::···
`
`~////?/#
`
`-::,:..-,?,?'7.iJ.:.:
`
`.~•
`
`~;w....-/#.4
`«'~;•
`
`;'kw( @Ji#
`
`::
`
`I
`
`L /
`
`/
`
`¾it·• r / d@t
`
`14.25% ±0.93 84.37% ±6.13 0%
`
`0
`
`10.0ufVI
`
`5.0uM
`
`0.53% ±0,04 1.99% ±0.25 4.91% ±0,66
`
`3.0uM
`
`2.0uM
`
`1.0uM
`
`NG-077109AU11-J(A4) (SEQ ID NO: 29)
`
`High-Purity Synthesis, (1.0} 2.0, 3.0, 5.01 10.0uM) RD Cells
`
`Exon 45 DR~2
`
`

`

`Patent Application Publication May 27, 2010 Sheet 34 of 39
`
`US 2010/0130591 Al
`
`Vi
`
`<I) u
`Cl
`
`0::: -~
`
`::l
`0 .
`0
`N
`r-1 ...
`.
`• 0
`ex::
`LO
`...
`0
`0 .
`m
`...
`Lr)
`0 .
`~ N
`'r'I -0
`"' a
`.
`C
`...
`~ ·-X
`V')
`V
`UJ ..c
`.....
`C >
`> +-' ·-\.-
`
`(./'}
`
`:::,
`0..
`I
`...c
`
`tlO ·-:c
`
`111\1 I
`~ :!I
`N ("'!
`0
`+I
`
`* 00
`
`<..O
`,-....
`0)
`N
`("()
`N +I
`
`* 0
`
`N
`0)
`I'-
`
`I I
`I
`ti I
`
`M
`
`-'Q"
`0 z
`0 -
`0
`U1 --c:::,-
`LJJ
`co ----. I
`
`-r-1
`M
`:J
`<!
`O')
`0
`tj"
`r-....
`t---
`0
`I
`(!) z
`
`0
`
`2
`::,
`0
`d
`M
`
`2
`::l
`0
`I.I)
`
`.
`M
`
`,,.-,I
`
`

`

`Patent Application Publication May 27, 2010 Sheet 35 of 39
`
`US 2010/0130591 Al
`
`0
`
`V')
`
`OJ u
`0
`
`a::: -~
`
`l.f')
`
`::::s
`0 .
`0
`N ~
`..,
`• 0 a: .
`.. 0 .
`0
`("(')
`...
`Lt) 0 .
`~ N
`"' 0
`.
`C
`..,
`V')
`
`~ -0
`
`X
`LJ.J
`
`V')
`Cl)
`..c
`.j,...i
`C:
`> V)
`>
`....... ·-~ ::,
`CL
`I ..c
`b.O ·-::r:
`
`N')
`
`-0)
`0 z
`0 -
`0
`
`LJ.I
`
`{/) --tj-u ---,
`
`I
`'t"'of
`'rf
`:::,
`<(
`en
`0
`I '
`
`I ' " 0
`I
`(D
`z
`
`z
`0 .
`
`::J
`
`M
`
`.
`
`M
`
`«:t .
`0
`0
`+I
`
`* t..f)
`' o••
`
`ti)
`
`>I
`1:
`ti
`JI
`o>I
`8 11
`ml
`0 r II'
`i jl
`
`+1
`
`

`

`1,0
`Ul
`0
`~
`
`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`1,0
`~
`
`0 ....
`
`O'I
`~
`.....
`rJJ =(cid:173)
`0 ....
`
`('D
`('D
`
`0
`
`N
`~-....J
`N
`~
`~
`
`-~~~~~/.(.(~:-·
`
`❖///////#.:•
`
`~
`
`~ ·~ ;;;;;«.?(,?(;
`. . . ::::: ::: . ?II~~~~:~~~
`:\ti~~i·i~i/
`0%
`
`n;n;; J;t;ititi;i
`0.78% ±0.21 2.11% ±0.10
`
`_·ww ..
`
`-~~~iiii>
`
`0
`
`10.0uM
`
`5.0uM
`
`FIG. 6G
`
`·1(.(///1/.;:;
`
`:···••.•:·.-:-:-;--•
`
`. ;;~g;,;
`
`·~,¥)."-(,(.¥)'~ .
`
`:/::d' liil,
`
`~(cid:173)
`
`iriitiii
`
`fahii: <::n:n
`
`. WW •
`
`' '''
`
`iii@M
`
`0%±0
`
`3.0uM
`
`0%±0
`
`2.0uM
`
`iii~ ''~iiiiiiC~ %ic:t
`0%±0
`
`1.0uM
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`NG-0782 09AU11-J(D4) (SEQ ID NO: 49)
`
`{Negative control)
`
`High-Purity Synthesis, (1.0, 2.0, 3.0, 5.01 10.0uM) RD Cells
`
`Exon 45 DR.2
`
`

`

`-....J
`~
`.....
`rJJ =(cid:173)
`0 ....
`
`('D
`('D
`
`0
`
`N
`~-....J
`N
`~
`~
`
`1,0
`Ul
`0
`~
`
`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`1,0
`~
`
`0 ....
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`NA
`
`2.11
`
`0.78
`
`0.00
`
`0.00
`
`0.00
`
`NA
`
`7.86
`
`1.63
`
`0.55
`
`0.00
`
`0.00
`
`FIG. 6H
`
`3.69
`
`97.68
`
`79.20
`
`31.12
`
`13.33
`
`3.05
`
`7.25
`
`84.37
`
`14.25
`
`4.91
`
`1.99
`
`0.53
`
`54.37
`
`EC50 {uM)
`
`4.17
`
`1.15
`
`0.60
`
`0.43
`
`0.00
`
`10
`
`5.0
`
`3.0
`
`2.0
`
`1.0
`
`N0:49)
`
`N0:39)
`
`N0:34)
`
`N0:29)
`
`N0:27)
`
`782 (SEQ ID
`
`777 (SEQ ID
`
`774 (SEQ ID
`
`(SEQ ID
`
`771
`
`770 (SEQ ID
`
`Treatment
`
`(uM)
`
`Percent Exon Skipped
`
`Exon45 RD Cell Dose-Range Summary
`
`

`

`1,0
`Ul
`0
`~
`
`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJ'1
`c
`
`FIG. 61
`
`QO
`~
`
`0 ....
`
`1,0
`~
`
`N
`~-....J
`N
`~
`~
`
`.....
`rJ'1 =(cid:173)
`0 ....
`
`('D
`('D
`
`0
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`:,-~
`
`:,'///////~ .,~ .. ;;,;,;,,:,;,;,;:.
`
`~·•··iiifiiii•·•••·~~·~
`
`38.59% ±3.38
`
`4.34% ±0.!38
`
`1.19% ±0.10
`
`SEQ !D N0:606 SEQ ID N0:607 SEQ ID N0:34
`567
`
`774
`
`568
`
`±0
`0%
`0
`
`•-.~~n~.-·
`
`~;,;,;,m/.
`
`.;.::::::::::·-·-·
`
`:◊mill·
`
`·'#1#%:
`
`~..-................... ~
`
`ii • -i • • :i/liJl -; -~ ~:
`
`0.00% ±0,00 Not quantified
`
`0.00%±0.00
`
`SE ID N0:604 SEQ !D N0:605 SEQ ID N0:34
`565
`
`774
`
`566
`
`09AU11-J(B4)
`09AU18-J(F2)
`09AU18-J(E2)
`09AU18-J{D2)
`09AU18-J(C2)
`
`Lot
`
`008; 34
`
`H45A(-06+20); 607
`
`h45AON5; 606
`h45AON1; 605
`
`H45A(+71+90); 604
`
`Name~ SEQ ID
`
`NG-08-0774
`NG-09-0568
`NG-09-0567
`NG-09-0566
`NG-09-0565
`
`Oligo
`
`High-Purity Synthesis, 3.0uM, RD Cells
`
`Exon 45 CS (Competitor Screen)
`
`

`

`1,0
`Ul
`0
`~
`
`> ....
`....
`0 --- 0 ....
`0 ....
`N
`rJJ
`c
`
`FIG. 6J
`
`·~~.....,.,~·--iiiiiw, ~.~·---,,;,;;,'.~
`
`.:;,,,-;,;,/.,
`
`±3.38
`38.59%
`
`0%1
`
`0%
`
`0%
`
`0%
`
`~~·-·~~ .. ~~~~~
`
`0%
`
`605
`
`0%
`
`604
`
`0%
`
`34
`
`SEQ !D NO: SEQ ID NO: SEQ ID NO:
`
`I 566
`
`I 565
`
`774
`
`1,0
`~
`
`0 ....
`
`1,0
`~
`
`N
`~-....J
`N
`~
`~
`
`.....
`rJJ =(cid:173)
`0 ....
`
`('D
`('D
`
`0
`
`.... 0 =
`.... 0 = ""O = O" -....
`('D = ..... t "e -....
`
`~ .....
`
`(')
`
`~ .....
`
`(')
`
`~ .....
`""O
`
`N0:34
`SEQID SEQIDNO: SEQIDNO: No SEQIDNO:
`774 (RD)
`
`34
`
`tx
`
`607
`
`568
`
`606
`
`567
`
`774
`
`09AU11-J{B4)
`09AU18-J(F2)
`09AU18-J(E2)
`09AU18-J(D2)
`09AU 18-J( C2)
`
`Lot
`
`008; 34
`
`H45A(-06+ 20); 607
`
`h45AONS; 606
`h45AON 1; 605
`
`H45A(+71+90); 604
`
`Name; SEQ ID
`
`NG-08-0774
`NG-09-0568
`NG-09-0567
`NG-09-0566
`NG-09-0565
`
`Oligo
`
`High-Purity Synthesis, 3.0uM, Human Primary Skeletal Muscle Cells
`Exon 45 MCS (Muscle Cell Competitor Screen)
`
`

`

`US 2010/0130591 Al
`
`May 27, 2010
`
`1
`
`MULTIPLE EXON SKIPPING
`COMPOSITIONS FOR DMD
`
`CROSS-REFERENCE TO RELATED
`APPLICATION
`
`[0001] This application claims the benefit under 35 U.S.C.
`§119(e) of U.S. Provisional Patent Application No. 61/108,
`416 filed Oct. 24, 2008; wherein this provisional application
`is incorporated herein by reference in its entirety.
`
`STATEMENT REGARDING SEQUENCE
`LISTING
`
`[0002] The Sequence Listing associated with this applica(cid:173)
`tion is provided in text format in lieu of a paper copy, and is
`hereby incorporated by reference into the specification. The
`name of the text file containing the Sequence Listing is
`120178_ 410_SEQUENCE_LISTING.txt. The text file is
`157 KB, was created on Oct. 23, 2009 and is being submitted
`electronically via EFS-Web.
`
`FIELD OF THE INVENTION
`
`[0003] The present invention relates to novel antisense
`compounds and compositions suitable for facilitating exon
`skipping in the human dystrophin gene. It also provides meth(cid:173)
`ods for inducing exon skipping using the antisense composi(cid:173)
`tions adapted for use in the methods of the invention.
`
`BACKGROUND OF THE INVENTION
`
`[0004] Antisense technologies are being developed using a
`range of chemistries to affect gene expression at a variety of
`different levels (transcription, splicing, stability, translation).
`Much of that research has focused on the use of antisense
`compounds to correct or compensate for abnormal or disease(cid:173)
`associated genes in a wide range of indications. Antisense
`molecules are able to inhibit gene expression with specificity,
`and because of this, many research efforts concerning oligo(cid:173)
`nucleotides as modulators of gene expression have focused
`on inhibiting the expression of targeted genes or the function
`of cis-acting elements. The antisense oligonucleotides are
`typically directed against RNA, either the sense strand ( e.g.,
`mRNA) or minus-strand in the case of some viral RNA tar(cid:173)
`gets. To achieve a desired effect of specific gene down-regu(cid:173)
`lation, the oligonucleotides generally either promote the
`decay of the targeted mRNA, block translation of the mRNA
`or block the function of cis-acting RNA elements thereby
`effectively preventing either de nova synthesis of the target
`protein or replication of the viral RNA.
`[0005] However, such techniques are not useful where the
`object is to up-regulate production of the native protein or
`compensate for mutations that induce premature termination
`of translation such as nonsense or frame-shifting mutations.
`In these cases, the defective gene transcript should not be
`subjected to targeted degradation or steric inhibition, so the
`antisense oligonucleotide chemistry should not promote tar(cid:173)
`get mRNA decay or block translation.
`In a variety of genetic diseases, the effects of muta(cid:173)
`[0006]
`tions on the eventual expression of a gene can be modulated
`through a process of targeted exon skipping during the splic(cid:173)
`ing process. The splicing process is directed by complex
`multi-component machinery that brings adjacent exon-intron
`junctions in pre-mRNA into close proximity and performs
`cleavage of phosphodiester bonds at the ends of the intrans
`with their subsequent reformation between exons that are to
`
`be spliced together. This complex and highly precise process
`is mediated by sequence motifs in the pre-mRNA that are
`relatively short semi-conserved RNA segments to which bind
`the various nuclear splicing factors that are then involved in
`the splicing reactions. By changing the way the splicing
`machinery reads or recognizes the motifs involved in pre(cid:173)
`mRNA processing, it is possible to create differentially
`spliced mRNA molecules. It has now been recognized that the
`majority of human genes are alternatively spliced during nor(cid:173)
`mal gene expression, although the mechanisms involved have
`not been identified.
`In cases where a normally functional protein is pre(cid:173)
`[0007]
`maturely terminated because of mutations therein, a means
`for restoring some functional protein production through
`antisense technology has been shown to be possible through
`intervention during the splicing processes, and that if exons
`associated with disease-causing mutations can be specifically
`deleted from some genes, a shortened protein product can
`sometimes be produced that has similar biological properties
`of the native protein or has sufficient biological activity to
`ameliorate the disease caused by mutations associated with
`the exon (Sierakowska, Sambade et al. 1996; Wilton, Lloyd et
`al. 1999; van Deutekom, Bremmer-Bout et al. 2001; Lu,
`Mann et al. 2003; Aartsma-Rus, Janson et al. 2004). Kole et
`al. (U.S. Pat. Nos. 5,627,274; 5,916,808; 5,976,879; and
`5,665,593) disclose methods of combating aberrant splicing
`using modified antisense oligonucleotide analogs that do not
`promote decay of the targeted pre-mRNA. Bennett et al (U.S.
`Pat. No. 6,210,892) describe antisense modulation ofwild(cid:173)
`type cellular mRNA processing also using antisense oligo(cid:173)
`nucleotide analogs that do not induce RNAse H-mediated
`cleavage of the target RNA.
`[0008] The process of targeted exon skipping is likely to be
`particularly useful in long genes where there are many exons
`and intrans, where there is redundancy in the genetic consti(cid:173)
`tution of the exons or where a protein is able to function
`without one or more particular exons. Efforts to redirect gene
`processing for the treatment of genetic diseases associated
`with truncations caused by mutations in various genes have
`focused on the use of anti sense oligonucleotides that either:
`(1) fully or partially overlap with the elements involved in the
`splicing process; or (2) bind to the pre-mRNA at a position
`sufficiently close to the element to disrupt the binding and
`function of the splic