Datum
`Date
`Date
`
`2 2 . 0 2 . 2 0 2 1
`
`Blatt
`Sheet
`Feuille
`
`1
`
`Anmelde-Nr:
`Application No:
`Demande n°:
`
`15 199 455.5
`
`Oppositions were filed against European patent EP3018211.
`
`Opponent 1 (Sarepta Therapeutics Inc.) opposed the patent as a whole on the grounds
`of Article 1 00(a) EPC in conjunction with Articles 54 and 56 EPC, under Article 1 00(b)
`EPC and under Article 1 00(c) EPC in conjunction with Articles 76(1) and 123(2) EPC.
`Opponent 1 requested revocation of the patent in its entirety and auxiliarily oral
`proceedings. The notice of opposition was accompanied by documents D1 to D13.
`
`Opponent 2 (James Poole Limited) opposed the patent as a whole on the grounds of
`Article 1 00(a) EPC in conjunction with Articles 54 and 56 EPC, under Article 1 00(b) EPC
`and under Article 1 00(c) EPC in conjunction with Articles 76(1) and 123(2) EPC.
`Opponent 2 requested revocation of the patent in its entirety and auxiliarily oral
`proceedings. The notice of opposition was accompanied by documents D3 to D5 and
`D14.
`
`In response to the notices of opposition, the proprietor requested rejection of the
`oppositions as main request and auxiliarily maintenance of the patent on the basis of
`the accompanying auxiliary requests AR1 to AR6. The proprietor also requested oral
`proceedings. The response of the proprietor was accompanied by documents D15 to
`D17.
`
`On 22-12-2020, opponent 2 filed further arguments in response to the reply of the
`proprietor to the notices of opposition.
`
`The consolidated list of cited documents is publicly available at the European Patent
`Register online. The parties should adhere to the numbering of this list.
`
`Oral proceedings are appointed herewith.
`
`Below follows the preliminary and non-binding opinion of the opposition division, which
`will form the basis for the discussion during the oral proceedings.
`
`1
`
`1.1
`
`Admissibility
`
`The oppositions are considered to be admissible.
`
`MAIN REQUEST - GRANTED CLAIMS
`
`2
`
`Article 123(2) EPC
`
`The A 1 publication of the application (EP3018211 A 1) is used as a reference for
`amendments in the sense of Article 123(2) EPC.
`
`EPO Form 2906 01 .91 TRI
`
`

`

`Datum
`Date
`Date
`
`2.1
`
`2.2
`
`2 2 . 0 2 . 2 0 2 1
`
`Blatt
`Sheet
`Feuille
`
`2
`
`Anmelde-Nr:
`Application No:
`Demande n°:
`
`15 199 455.5
`
`The granted claims find basis in originally filed claims 1 to 4 of EP3018211 A 1.
`
`The opposition division is therefore of the preliminary opinion that the
`requirements of Article 123(2) EPC are met.
`
`3
`
`Article 76(1) EPC
`
`The A 1 publication of the parent application (EP2612917 A 1, document D1) is used as a
`reference for amendments in the sense of Article 76(1) EPC.
`
`3.1
`
`3.2
`
`The only passage of D1 which relates to an antisense oligomer complementary
`to the 36th-60th nucleotides from the 5' end of the 53rd exon in the human
`dystrophin gene is TEST EXAMPLE 6 (par. [0185]-[194]). Experiments were
`performed using the antisense oligomers of 2'-O-methoxy-phosphorothioates
`(2'-OMe-S-RNA) shown by SEQ ID NO:49 to SEQ ID NO:123. The sequences
`of various antisense oligomers are given in Table 7, wherein H53_36-60 (SEQ
`ID NO:57, GUUGCCUCCGGUUCUGAAGGUGUUC) consists of a nucleotide
`sequence complementary to the 36th-60th nucleotides from the 5'end of the 53rd
`exon in the human dystrophin gene. H53_36-60 is shown to cause exon 53
`skipping.
`
`However, in the light of the description, granted claim 1 is broader than the
`antisense oligomer of 2'-O-methoxy-phosphorothioates (2'-OMe-S-RNA) of SEQ
`ID NO:57 and also broader than the unmodified antisense oligomer of SEQ ID
`NO:57. According to par. [0024], the term "complementary nucleotide
`sequence" is not limited only to nucleotide sequences that form Watson-Crick
`pairs with target nucleotide sequences, but is intended to also include
`nucleotide sequences which form Wobble base pairs; wherein the term Watson(cid:173)
`Crick pair refers to a pair of nucleobases in which hydrogen bonds are formed
`between adenine-thymine, adenine-uracil or guanine-cytosine, and the term
`Wobble base pair refers to a pair of nucleobases in which hydrogen bonds are
`formed between guanine-uracil, inosine-uracil, inosine-adenine or inosine(cid:173)
`cytosine. And the term "complementary nucleotide sequence" does not only
`refer to a nucleotide sequence 100% complementary to the target nucleotide
`sequence but also refers to a complementary nucleotide sequence that may
`contain, for example, 1 to 3, 1 or 2, or one nucleotide non-complementary to the
`target nucleotide sequence.
`
`3.3
`
`There is no basis for the generalisation from the H53_36-60 antisense oligomer
`to granted claim 1.
`
`EPO Form 2906 01 .91 TRI
`
`

`

`Datum
`Date
`Date
`
`2 2 . 0 2 . 2 0 2 1
`
`Blatt
`Sheet
`Feuille
`
`3
`
`Anmelde-Nr:
`Application No:
`Demande n°:
`
`15 199 455.5
`
`The general part of the description (par. [0001 ]-[0012] and par. [0016]-[0122])
`relates to the "oligomer of the present invention" which is defined in par. [0016]
`and does not include an antisense oligomer complementary to the 36th-60th
`nucleotides from the 5' end of the 53rd exon in the human dystrophin gene. The
`general part of the description can therefore not be used to generalise the
`H53_36-60 antisense oligomer.
`
`The general statements in par. [0014] and [0123] that the invention is not limited
`to the embodiments or examples are too vague to form the basis of the
`generalisation from the H53_36-60 antisense oligomer to granted claim 1.
`
`Furthermore, it is not derivable from par. [0194] that the core of the invention
`relates to ascertaining the position of the oligomer in exon 53 that causes exon
`skipping.
`
`3.4
`
`The opposition division is therefore of the preliminary opinion that the main
`request contravenes Article 76(1) EPC.
`
`4
`
`4.1
`
`4.2
`
`4.3
`
`5
`
`5.1
`
`5.2
`
`Priority
`
`The priority document is in Japanese. In the absence of a translation of the
`priority document into an official EPO language, it is not possible to assess the
`validity of the priority.
`
`The opposition division therefore considers the priority not to be valid.
`
`The only cited document published between the priority date and the filing date
`is document D13 which is used by opponent 1 as alternative closest prior art in
`an objection of lack of inventive step. However, this objection is not
`substantiated.
`
`In conclusion, the validity of the priority and document D13 are at present not
`relevant.
`
`Novelty
`
`Documents D1 and D6 are published after the filing date and are therefore not
`prior art.
`
`Document D4 discloses (par. [0015], [0028]) antisense oligonucleotides which
`cause skipping of exon 53 in the human dystrophin gene which comprise at
`least 25 base length from SEQ ID NO:10-12, wherein SEQ ID NO:10-12 are
`complementary to positions 33-62, 36-65 or 30-59 of exon 53.
`
`EPO Form 2906 01 .91 TRI
`
`

`

`Datum
`Date
`Date
`
`2 2 . 0 2 . 2 0 2 1
`
`Blatt
`Sheet
`Feuille
`
`4
`
`Anmelde-Nr:
`Application No:
`Demande n°:
`
`15 199 455.5
`
`Although antisense oligonucleotides consisting of a sequence complementary to
`position 36-60 of exon 53 fall within in the above disclosure of D4, this generic
`disclosure does not take away the novelty of the specific subject-matter of
`granted claim 1 (see Guidelines G-VI, 5).
`
`5.3
`
`The opposition division is therefore of the preliminary opinion that the main
`request is novel.
`
`6
`
`6.1
`
`Inventive step
`
`Closest prior art
`
`The opponents selected document D5 as closest prior art. The opposition
`division sees no reason to take a different document as closest prior art.
`
`Document D5 discloses morpholino antisense oligomers which cause skipping
`of exon 53 in the human dystrophin gene. PMO-G, PMO-A and PMO-H (Table
`1) are the preferred oligomers (p. 7, right col., I. 14-17 and p. 8, right col., par.
`3).
`
`PMO-A is 25 nt long and is complementary to position 35-59 of exon 53.
`
`PMO-G is 30 nt long and is complementary to position 30-59 of exon 53.
`
`PMO-H is 30 nt long and is complementary to position 33-62 of exon 53.
`
`In normal human skeletal muscle cells, PMO-H causes 87.2% skipping, PMO-G
`causes 52.4% skipping and PMO-A causes 12.7% skipping (Table 1 ). However,
`studies in normal human skeletal muscle cells are limited as they do not allow
`assessment of the therapeutic effect at the protein level (p. 3, left col., par. 3).
`Therefore, studies were performed in DMD patient myoblasts and in a
`humanised mouse model to identify oligomers having therapeutic potential.
`
`In DMD patient myoblasts experiments, PMO-G is superior but PMO-A and
`PMO-H also perform very well (p. 3, right col., last sentence of penultimate
`par.).
`
`In a humanised DMD mouse model, PMO-G and PMO-A perform similar
`whereas PMO-H has a slightly lower level of skipping (p. 6, left col., par. 1 ).
`
`6.2
`
`Difference
`
`The subject-matter of granted claim 1 differs from the oligomers of D5 in that it
`consists of a sequence complementary to position 36-60 of exon 5.
`
`6.3
`
`Technical effect
`
`EPO Form 2906 01 .91 TRI
`
`

`

`Datum
`Date
`Date
`
`2 2 . 0 2 . 2 0 2 1
`
`Blatt
`Sheet
`Feuille
`
`5
`
`Anmelde-Nr:
`Application No:
`Demande n°:
`
`15 199 455.5
`
`There are no data on file of exon skipping of the claimed oligomer in the model
`systems of D5.
`
`There are data on file of exon skipping of the H53_36-60 oligomer of the
`invention versus oligomers corresponding to PMO-A and PMO-H of D5 in
`human rhabdomyosarcoma "RD" cells. Fig. 16 and 17 of the patent show that
`H53_35-59 [which corresponds to PMO-A] performs better than H53_36-60.
`The experimental data filed during the examination procedures show that
`H53_36-60 performs better than H53_33-62 [which corresponds to PMO-H].
`From these data, it can be concluded that the performance of the H53_36-60
`oligomer of the invention lies in between that of PMO-A and PMO-H.
`
`6.4
`
`Objective technical problem
`
`The objective technical problem in view of the disclosure of document D5 as a
`whole is the provision of an alternative antisense oligomer which causes
`skipping of exon 53 in the human dystrophin gene.
`
`The opposition does not follow the approach wherein one of PMO-G, PMO-A
`and PMO-H is taken as closest prior art. The reasons therefore being the
`following: (i) PMO-A and PMO-H perform similar in the most relevant
`experimental models of D5, (ii) the performance of the H53_36-60 oligomer of
`the invention lies in between that of PMO-A and PMO-H according to the data
`on file, and (iii) there are no comparative data on file for PMO-G.
`
`The problem is solved because it is a feature of claim 1 that the antisense
`oligomer causes skipping of exon 53 in the human dystrophin gene.
`
`6.5
`
`Is the solution obvious?
`
`The authors of D5 recommend PMOs targeting within position 30-65 of exon 53
`for achieving exon skipping (p. 7, right col., par. 2). The claimed antisense
`oligomer is shifted a single base versus the PMO-A oligomer of D5 and is
`comprised in the PMO-H oligomer of D5. The skilled person would therefore
`reasonably expect a PMO targeting position 36-60 to be capable of causing
`exon skipping.
`
`Document D5 is not considered to teach away from using PMOs of 25 nt in
`length. The statement that all 30mers tested were more bioactive relative to
`their 25mer counterpart (p. 7, right col., par. 2, last full sentence) also applies to
`PMO-A which is the 25mer counterpart of the 30mer PMO-G. Nevertheless,
`PMO-A is one of the preferred oligomers. Moreover, the objective technical
`problem is merely the provision of an alternative antisense oligomer, not the
`provision of an improved antisense oligomer.
`
`EPO Form 2906 01 .91 TRI
`
`

`

`Datum
`Date
`Date
`
`2 2 . 0 2 . 2 0 2 1
`
`Blatt
`Sheet
`Feuille
`
`6
`
`Anmelde-Nr:
`Application No:
`Demande n°:
`
`15 199 455.5
`
`6.6
`
`7
`
`7.1
`
`The opposition division is therefore of the preliminary opinion that the main
`request is inventive.
`
`Sufficiency of disclosure
`
`The opponents did not raise serious doubts substantiated by verifiable facts.
`The patent discloses in TEST EXAMPLE 6 one antisense oligomer consisting of
`a sequence complementary to the 36th-60th nucleotides from the 5' end of the
`53rd exon in the human dystrophin gene which causes skipping of exon 53.
`Using his common general knowledge, the skilled person can modify this
`oligomer without undue burden in order to provide further antisense oligomers
`which cause skipping of exon 53.
`
`7.2
`
`Although the obtained oligomers may have different exon skipping efficiencies,
`exon skipping efficiency is not a feature of the claims.
`
`The opposition division is therefore of the preliminary opinion that the claimed
`invention is sufficiently disclosed by the patent.
`
`AUXILIARY REQUESTS
`
`8
`
`9
`
`9.1
`
`The auxiliary requests appear to meet the requirements of Rule 80 and Articles
`123(2), 123(3) and 84 EPC.
`
`Article 76(1) EPC
`
`In AR1 and AR5, the antisense oligomer of claim 1 is limited to 100%
`complementarity.
`
`In the light of par. [0024] of the description, this is still a generalization from the
`H53_36-60 antisense oligomer.
`
`9.2
`
`AR2 to AR4 and AR6 use different wording to limit the antisense oligomer
`essentially to the nucleotide sequence of SEQ ID NO:57.
`
`The opposition division is of the opinion that unmodified SEQ ID NO:57 is
`directly and unambiguously disclosed in Table 7. However, claim 1 of these
`auxiliary requests is broader since the sequence may be modified, as is evident
`from dependent claims 3 and 4.
`
`9.3
`
`The opposition division is therefore of the preliminary opinion that all auxiliary
`requests contravene Article 76(1) EPC.
`
`EPO Form 2906 01 .91 TRI
`
`

`

`Datum
`Date
`Date
`
`2 2 . 0 2 . 2 0 2 1
`
`Blatt
`Sheet
`Feuille
`
`7
`
`Anmelde-Nr:
`Application No:
`Demande n°:
`
`15 199 455.5
`
`10
`
`Novelty
`
`The opposition division is of the preliminary opinion that all auxiliary requests
`are novel, for the same reasons as for the main request.
`
`11
`
`12
`
`Inventive step
`
`The opposition division is of the preliminary opinion that none of the auxiliary
`requests is inventive, for the same reasons as for the main request.
`
`13
`
`Sufficiency of disclosure
`
`The opposition division is of the preliminary opinion that all auxiliary requests
`are sufficiently disclosed, for the same reasons as for the main request.
`
`PROVISIONAL CONCLUSION
`
`After having carefully taken into consideration the grounds of opposition and the
`submissions advanced by the parties, the opposition division is of the preliminary
`opinion that the Main Request meets the requirements of Articles 54, 83 and 123(2)
`EPC, but does not meet the requirements of Articles 76(1) and 56 EPC. The same
`applies to the auxiliary requests.
`
`Consequently, the oppositions cannot be rejected. Neither can the patent be maintained
`in the form of the auxiliary requests.
`
`Considering that the aims in the interest of both the public and the parties to the
`proceedings are to bring the proceedings to a conclusion as rapidly as possible, and to
`avoid unnecessary costs, both parties are invited to declare within the given time limit
`whether, in view of the provisional conclusion set forth above, the requests for oral
`proceedings are maintained.
`
`The opposition division furthermore would like to draw the attention of the parties to
`Rule 116 EPC which will be strictly applied. Amendments of the claims with features
`from the description will usually not be accepted during oral proceedings.
`
`According to Article 113(2) EPC, the opposition division is restricted to the text
`submitted to it or agreed by the proprietor. As a consequence, the requirements of
`Article 84 EPC are in general not fulfilled when amended claims are filed without the
`corresponding adapted description and therefore the proprietor is requested to file a
`description corresponding to the amended claims of each request, if any. The parties
`
`EPO Form 2906 01 .91 TRI
`
`

`

`Datum
`Date
`Date
`
`2 2 . 0 2 . 2 0 2 1
`
`Blatt
`Sheet
`Feuille
`
`8
`
`Anmelde-Nr:
`Application No:
`Demande n°:
`
`15 199 455.5
`
`are informed that in the absence of the proprietor at oral proceedings the lack of an
`appropriately adapted description may result in the revocation of the patent in
`accordance with Article 101 (3)(b) EPC.
`
`EPO Form 2906 01 .91 TRI
`
`