(19) United States
`(12) Patent Application Publication (10) Pub. No.: US 2009/0131624 A1
`REEVIES et al.
`(43) Pub. Date:
`May 21, 2009
`
`US 20090131624A1
`
`(54) SYNTHESIS OF MORPHOLINO OLIGOMERS
`USING DOUBLY PROTECTED GUANINE
`MORPHOLINO SUBUNITS
`
`ABSTRACT
`(57)
`Morpholino compounds are provided having the structure:
`rp
`p
`p
`9.
`
`(75) Inventors:
`
`MATTHEW DALE REEVES,
`Albany, OR (US); DWIGHT D.
`WELLER, CORVALLIS, OR (US)
`
`Correspondence Address:
`King & Spalding LLP
`P.O. BOX 889
`Belmont, CA 94002-0889 (US)
`
`(73) Assignee:
`
`AVI BIOPHARMA, INC.,
`CORVALLIS, OR (US)
`
`(21) Appl. No.:
`
`12/271,040
`
`(22) Filed:
`
`Nov. 14, 2008
`Related U.S. Application Data
`(60) Provisional application No. 60/988,200, filed on Nov.
`15, 2007.
`
`Publication Classification
`
`(51) Int. Cl
`we
`CO7D 487/04
`C08G 73/06
`
`(2006.01)
`(2006.01)
`
`(52) U.S. Cl. .......................... 528/168; 544/118; 528/208
`
`O
`ls
`O
`RI
`
`N
`(
`
`Y
`
`O N
`
`O
`
`n
`O
`N
`als ls
`N
`N
`R2
`
`N
`
`R3
`
`where
`R" is selected from the group consisting of lower alkyl,
`di(lower alkyl)amino, and phenyl;
`R is selected from the group consisting of lower alkyl,
`monocyclic arylmethyl, and monocyclic (aryloxy)me
`thyl: y
`ry
`y
`y
`(aryloxy)
`R is selected from the group consisting of triarylmethyl
`and hydrogen; and
`Y is selected from the group consisting of a protected or
`unprotected hydroxyl oramino group; a chlorophospho
`ramidate group; and a phosphorodiamidate linkage to
`group
`pnosp
`9.
`the ring nitrogen of a further morpholino compound or a
`morpholino oligomer. Such compounds include doubly
`protected morpholino guanine (MoG) monomers. Also
`described is their use in synthesis of morpholino oligo
`CS.
`
`

`

`Patent Application Publication May 21, 2009 Sheet 1 of 11
`
`US 2009/O131624 A1
`
`HO
`
`P
`
`O
`
`N
`
`1, 2,6-lutidine/DCM
`( ) K) dichloridate
`O 1a - f, where P:
`
`2. N-methylimidazole
`3. N,N-dimethylphosphoramido-
`
`O
`I
`MeN-P-O
`
`o
`
`N
`
`c y )
`( ) K)
`2a - f O
`
`O
`
`a se 'O f
`N
`YN
`7
`
`O
`
`7 Ciu
`
`O
`
`Figure 1
`
`

`

`Patent Application Publication May 21, 2009 Sheet 2 of 11
`
`US 2009/O131624 A1
`
`fr 1c
`r
`1
`
`BDMS-C
`Dichloromethane
`
`N
`Tr
`
`3
`
`Triphenylphosphine
`DIAD
`4-nitrophenethyl alcohol
`
`N1SN 9
`(
`als
`NYN1N
`
`S-O
`
`Triethylamine - 3 HF
`
`& Cluo
`
`st
`
`N
`
`Dichloronethane
`2,6-utidine
`N-methylimidazole
`N,N-dimethylphosphoramidodichloridate
`
`O
`NN
`1.
`
`y
`(
`
`O
`
`Figure 2
`
`

`

`Patent Application Publication May 21, 2009 Sheet 3 of 11
`
`US 2009/O131624 A1
`
`O
`
`O
`
`t
`O
`t
`HO . CuO ---o .
`Imidazole
`y
`
`N
`Tr 1c
`
`TBDMS-C
`Dichloromethane
`
`O
`ful
`
`3
`
`TPS-C
`Triethylamine
`DMAP
`
`Q
`S
`O1 Yo
`
`N
`
`N-methylpyrrolidine; DBU
`4-nitrophenethyl alcohol
`
`O
`
`si-o
`
`N
`2
`N
`
`O
`
`{
`y
`
`N
`T
`r
`
`NS
`N
`1.
`N
`
`NH
`
`O
`
`HO
`
`Triethylamine -
`
`N1SN O
`II
`(
`NYN1NN
`
`O
`
`(
`C
`
`N
`Tr
`
`Dichloromethane
`4.
`2,6-lutidine
`N-methylimidazole
`N,N-dimethylphosphoramidodichloridate
`
`- X
`NN
`O
`1.
`
`NO
`
`O
`
`y
`(
`
`Figure 3
`
`

`

`Patent Application Publication May 21, 2009 Sheet 4 of 11
`
`US 2009/O131624 A1
`
`er ju
`
`O
`
`N
`7
`
`NH O
`
`N.
`
`NH
`
`so
`O
`y
`N
`Tr
`
`
`
`N
`
`NH
`
`Oxone
`
`TPS-C
`Triethylamine
`DMAP +-
`
`N-methylpyrrolidine; DBU
`Ho-n-Sir
`where R = methyl; phenyl
`
`4.
`
`o1N1-S-r
`c
`
`N n
`7
`N
`
`O
`
`O
`
`N
`
`NH
`
`N
`where R is methyl;
`r pheny
`
`O
`S-R
`o1N18
`N-N1SN
`N
`O
`//
`(
`fu) HO
`o
`s
`Triethylamine-3HF
`
`9
`o-ra-i-r
`O
`NN
`O
`N
`(
`el
`NYN1NN
`N where R = methyl; phenyl
`
`$-
`
`r
`
`where R = methyl; phenyi
`
`Dichloromethane
`2,6-lutidine
`N-methylimidazole
`N,N-dimethylphosphoramidodichloridate
`
`-N-S-r
`N
`O
`( NN
`O
`N
`els
`O
`N. NH
`
`c-P-o
`
`ity N
`
`

`

`Patent Application Publication May 21, 2009 Sheet 5 of 11
`
`US 2009/O131624 A1
`
`O
`
`N c
`1. Y's
`
`ju)
`
`N
`
`N-methylpyrrolidine; DBU
`2-(Trimethylsilyl)ethanol
`
`O
`
`CCiu
`- s
`N
`C 1
`T
`
`PAC-a-O
`
`N-methylimidazole/DCM
`Phenyiacetyl chloride
`
`TPS-C
`Triethylamine
`DMAP
`
`Q
`S
`O1 Y
`N1SN 1 o
`
`8.
`--- N YNH
`
`N
`r
`
`Si(CHs)
`
`O
`
`N
`
`NS
`
`12
`
`PActro-O
`
`N
`
`N
`
`1.
`
`s
`
`O
`
`c
`c O
`o
`o
`s
`HO
`y
`Tetramethylguanidine y
`
`y
`Tr
`
`Ethanol/DCM
`
`N
`Tr
`
`Dichloronethane
`2,6-lutidine
`N-methylimidazole
`N,N-dimethylphosphoramidodichloridate
`
`O
`
`C
`
`N
`<
`N
`
`N
`N
`s
`
`O
`
`Figure 5
`
`

`

`Patent Application Publication May 21, 2009 Sheet 6 of 11
`
`US 2009/O131624 A1
`
`O
`
`O
`
`N
`
`N
`
`HO Sir ud -- -o ... ud
`y
`Imidazole
`r
`
`N
`Tr 1c
`
`TBDMS-C
`Dichloronethane
`
`N
`r
`
`3
`
`TIPS-C 1
`Triethylamine
`DMAP
`
`
`
`N
`(
`N
`
`NS
`als
`
`O
`
`N
`r
`
`H2
`
`4
`
`H
`
`H
`
`H
`
`O
`
`N-methylpyrrolidine; DBU
`H
`H2
`Ha
`
`HO
`
`Where H. His can be substituted
`with various electron-withdrawing
`groups
`
`H
`
`O
`
`H
`
`H4
`
`Hs
`
`O
`
`8.
`NN1SN
`N
`o, NYN1 NH
`---0
`y
`Triethylamine - 3 HF
`
`N
`Tr
`
`Hs
`NN
`
`O
`
`- Ciu
`2/
`O
`N
`r
`
`H2
`
`H
`
`Ha
`
`H
`O
`
`Dichloronethane
`2,6-lutidine
`N-methylimidazole
`N,N-dimethylphosphoramidodichloridate
`
`O
`His
`NN
`d
`n-els
`
`O
`
`Figure 6
`
`

`

`Patent Application Publication May 21, 2009 Sheet 7 of 11
`
`US 2009/O131624 A1
`
`O
`
`.
`
`N
`(CiU)
`s-o- oN-N-NH
`y
`DIEA/Pyridine/DMF
`t
`ci-NR,
`
`N
`
`3
`
`O
`
`O
`o-SNR,
`N
`ju)
`(
`so
`NYN1 NH
`y
`
`N1
`Tr
`
`nS
`
`2
`
`NR2 =
`PhN
`s
`CN
`Otan
`Me N
`Phy
`
`3 HF
`Tiethylami
`lethylamine -
`
`O o-SNR,
`N1SN N
`(
`els
`N
`NH
`
`O
`
`Dichloromethane
`2,6-lutidine
`N-methylimidazole
`N,N-dimethylphosphoramidodichloridate
`
`o
`
`e
`
`c
`O
`
`N
`
`O
`
`els
`N.
`NH
`
`Figure 7
`
`

`

`Patent Application Publication May 21, 2009 Sheet 8 of 11
`
`US 2009/O131624 A1
`
`O
`
`y
`fr
`
`11c
`
`Imidazole
`TBDMS-C
`Dichloromethane
`
`&r O lu
`--
`so
`o,
`s
`y
`
`TIPS-C
`Triethylamine
`DMAP
`
`---o
`
`Q
`PY
`
`s
`
`r
`
`O
`
`r
`
`N N
`
`O
`
`(DCliu?)
`N
`1SN1,NH
`C N
`-()-o
`O
`(r.
`N1 N
`
`3
`
`N-methylpyrrolidine; DBU
`
`-()—o
`
`- X-os
`l
`
`O
`
`NN
`
`1f
`
`O
`
`N
`7
`N
`
`N
`r
`
`h-
`
`N
`r
`5
`
`y
`
`Triethylamine - 3 HF
`
`aw-exase-os
`
`Dichloronethane
`2,6-lutidine
`N-methylimidazole
`N,N-dim
`
`idodichloridate
`
`C
`T - H()
`
`N
`('S
`els
`O
`N.
`NH
`MeN y
`
`C-p-o
`
`2f
`
`N
`
`Figure 8
`
`

`

`Patent Application Publication May 21, 2009 Sheet 9 of 11
`
`US 2009/O131624 A1
`
`O
`Ho-n-S-s-n-O 1. Carbonyldiimidazole ( )
`N y-or
`O 7
`6
`2. NTPFree Base
`
`2
`
`O
`( )
`
`NaOH, 6
`
`Triphenylphosphine
`J.-- S-s-n-OH
`
`1,1-Carbonyldiimidazole
`
`Figure 9
`
`

`

`Patent Application Publication May 21, 2009 Sheet 10 of 11
`
`US 2009/O131624 A1
`
`KX
`
`N
`
`Pheny Chloroformate
`, DCM/H2O
`
`K2CO3
`
`-
`
`O
`
`---
`
`O
`
`O
`
`/ \l
`V /
`O 10
`
`NaH/NMP
`Triethylene glycol
`95 C
`
`Succinic anhydride/DMAP O 1
`THF; 55 C
`
`O CO
`O CO-r's
`
`O 12
`
`O
`
`HO-N
`
`O
`EDC
`DMAP
`C O DCM; reflux
`
`\-/
`
`3
`
`() ()-----'o-
`O is
`
`C
`
`O
`
`Figure 10
`
`

`

`Patent Application Publication May 21, 2009 Sheet 11 of 11
`
`US 2009/O131624 A1
`
`
`
`NH2 am-ma-e-
`
`NHCOOEt
`
`14
`
`Aminomethyl
`polystyrene resin
`
`
`
`e
`
`O
`
`o'-o'-o'-
`
`O
`
`Trity
`
`O
`
`O
`
`O
`13
`
`NHCOOEt
`
`S
`
`O
`
`or
`Nrity
`
`Figure 11
`
`

`

`US 2009/013 1624 A1
`
`May 21, 2009
`
`SYNTHESIS OF MORPHOLNO OLGOMERS
`USING DOUBLY PROTECTED GUANNE
`MORPHOLINO SUBUNITS
`
`0001. This patent application claims priority to U.S. Pro
`visional Patent Application No. 60/988,200 filed Nov. 15,
`2007, which is incorporated in its entirety herein by refer
`CCC.
`
`FIELD OF THE INVENTION
`0002 The invention relates to methods of synthesis using
`guanine morpholino (MoG) subunits with protection at both
`the N2 and O6/N1 groups of the guanine base. Morpholino
`oligomers synthesized using these Subunits are obtained in
`higher purity and yield compared to those synthesized using
`monoprotected guanine Subunits.
`
`REFERENCES
`0003 Gough et al. (1979) Nucleic Acids Research 7:1955
`1964.
`0004 Hata et al. (1983) Tetrahedron Lett. 24:2775-2778.
`0005 Jones et al. (1982A) Tetrahedron Lett. 23:2253
`2256.
`0006 Jones et al. (1982B) Tetrahedron Lett. 23:2257
`2260.
`0007 Mitsunobu, O. (1981) Synthesis 1:1-28.
`0008 Reese et al. (1981) Tetrahedron Lett. 22:4755-4758.
`0009 Reese et al. (1984) J. Chem. Soc., Perkin Trans.
`11263-1270.
`0010 Summerton, J. E. and Weller, D. D. (1993) U.S. Pat.
`No. 5,185,444.
`0011 Summerton, J. E. and Weller, D.D. (1997) Antisense
`Nucl. Acid Drug Dev. 7(3):187-195.
`
`BACKGROUND
`0012 Phosphorodiamidate-linked morpholino oligomers,
`or PMO, are nucleic acid analogs which bind tightly and
`sequence specifically to complementary RNA and are useful
`in modulating protein synthesis and thus gene expression.
`These oligomers are composed of base-pairing recognition
`moieties (heterocyclic bases) Supported by a morpholino
`backbone system. Morpholino subunits for use in synthesiz
`ing Such oligomers can be prepared easily from the corre
`sponding ribonucleosides, which are readily available and
`inexpensive precursors (see e.g. Summerton and Weller,
`1993, 1997).
`0013 During such synthesis, as in conventional oligo
`nucleotide synthesis, the functional groups on the heterocy
`clic bases are typically masked to prevent interference in the
`synthetic transformations. For example, activation of the
`N-tritylated morpholino monomer (1a-f: FIG. 1) entails reac
`tion of the 5'-hydroxyl with a suitable phosphoramido dichlo
`ridate to form the activated subunit 2a-f. At large scale (50
`100 Gallon reactor), the crude activated subunit is generally
`contaminated with a high level of by-products. Following
`chromatographic purification, the activated Subunit is iso
`lated in about 50% yield for A, C, I, T, U and their protected
`forms, but only in about 5% yield for the activated singly
`protected G subunit, which is believed to be due to the pres
`ence of the unprotected O6 oxygen.
`0014. The O6-unprotected guanine subunit also gives rise
`to side reactions at the oligomer stage. For example, the O6
`oxygen can react with activated Subunit during coupling
`steps, to form O6-phosphorylated or derivative species, and
`
`during final cleavage of the base protecting groups with
`ammonia, ammonia can react at C6 to displace these species,
`giving a diaminopurine derivative. Such impurities are diffi
`cult to remove by chromatography, and cause a large loss in
`yield.
`Various protection schemes have been proposed in
`00.15
`the art to reduce side reactions of unprotected guanine O6
`positions in conventional oligonucleotide synthesis (see e.g.
`Goughetal. 1979; Reese et al. 1981, 1984; Jones et al. 1982A,
`1982B). However, these protocols were largely unsuccessful
`when applied to PMO synthesis. Accordingly, improved
`methods were sought to increase yield and purity in PMO
`synthesis, particularly in the use of G morpholino Subunits.
`
`SUMMARY
`0016. In one aspect, the invention provides a morpholino
`compound comprising the structure I:
`
`N
`
`wherein
`I0017 R is selected from the group consisting of lower
`alkyl, di(lower alkyl)amino, and phenyl:
`I0018 R is selected from the group consisting of lower
`alkyl, monocyclic arylmethyl, and monocyclic (aryloxy)im
`ethyl:
`(0019 R is selected from the group consisting of triaryl
`methyl and hydrogen; and
`0020 Y is selected from the group consisting of a pro
`tected or unprotected hydroxyl oramino group; a chlorophos
`phoramidate group; and a phosphorodiamidate linkage to the
`ring nitrogen of a further morpholino compound or a mor
`pholino oligomer.
`0021. In selected embodiments, Y is selected from the
`group consisting of a protected or unprotected hydroxyl
`group and a chlorophosphoramidate group, e.g. a chlorophos
`phoramidate group of the form —O P(=O) N(CH)Cl.
`When Y is a protected hydroxyl group, it is preferably a
`trialkylsilyl-protected hydroxyl group.
`(0022. The group R is preferably selected from trityl
`(triphenylmethyl), 4-methoxytrityl, 4-methyltrity1, 4,4'-dim
`ethyltrityl, and 4,4',4'-trimethyltrityl. The group R' is pref
`erably lower alkyl, especially C-C alkyl, and most particu
`larly —C(CH), (tert-butyl). The group R is preferably
`selected from benzyl and —CH(CH), (isopropyl).
`0023. In a related aspect, the invention provides an
`improved method of synthesizing a morpholino oligomer, the
`method comprising:
`0024 (a) reacting a solid-phase-supported morpholino
`Subunit, having an unprotected ring nitrogen, with a base
`protected morpholino Subunit monomer, having a triarylm
`
`

`

`US 2009/013 1624 A1
`
`May 21, 2009
`
`ethyl-protected ring nitrogen and an activated phosphorami
`date group on a 5'-exocyclic carbon,
`0025 thereby forming a phosphorodiamidate linkage
`between the 5'-exocyclic carbon and the unprotected ring
`nitrogen;
`0026 (b) deprotecting the protected ring nitrogen, to form
`an unprotected ring nitrogen; and
`0027 (c) repeating steps (a) and (b) one or more times with
`further base-protected morpholino Subunit monomers;
`0028 wherein at least one of the base-protected mor
`pholino Subunit monomers is a doubly protected guanine
`morpholino compound having the structure I:
`
`O --,
`
`O
`
`n N
`
`O
`
`4. N
`H
`
`R2
`
`Y
`
`N
`
`N
`
`O
`
`N
`
`R3
`
`wherein
`I0029) R' is selected from the group consisting of lower
`alkyl, di(lower alkyl)amino, and phenyl:
`I0030) R is selected from the group consisting of lower
`alkyl, monocyclic arylmethyl, and monocyclic (aryloxy)im
`ethyl:
`I0031) R' is selected from the group consisting of triaryl
`methyl and hydrogen; and
`0032 Y is a chlorophosphoramidate group.
`0033 Selected embodiments of the variables represented
`in the above structure include those described above.
`0034. These and other objects and features of the invention
`will become more fully apparent when the following detailed
`description of the invention is read in conjunction with the
`accompanying drawings.
`
`BRIEF DESCRIPTION OF THE DRAWINGS
`
`0035 FIG. 1 illustrates the formation of an activated mor
`pholino Subunit.
`0036 FIG. 2 illustrates a route of formation for a doubly
`protected morpholino G subunit (DPG) derivative in which
`the N2 position is phenylacetylated and the O6 position is
`protected with the 4-nitrophenethyl (NPE) group.
`0037 FIG. 3 illustrates an alternate route of formation for
`a doubly protected morpholino G subunit (DPG) derivative in
`which the N2 position is phenylacetylated and the O6 position
`is protected with the 4-nitrophenethyl (NPE) group.
`0038 FIG. 4 illustrates the formation of a DPG derivative
`in which the N2 position is phenylacetylated and the O6
`position is protected with either the phenylsulfonylethyl
`(PSE) or methylsulfonylethyl (MSE) group.
`0039 FIG. 5 illustrates the formation of a DPG derivative
`in which the N2 position is phenylacetylated and the O6
`position is protected with the trimethylsilylethyl (TMSE)
`group.
`
`0040 FIG. 6 illustrates the formation of a DPG derivative
`in which the N2 position is phenylacetylated and the O6
`position is protected with a series of aryl derivatives.
`0041
`FIG. 7 illustrates the formation of a DPG derivative
`in which the N2 position is phenylacetylated and the O6
`position is protected with a series of carbamoyl derivatives.
`0042 FIG. 8 illustrates the formation of the DPG deriva
`tive in which the N2 position is phenylacetylated and the O6
`position is protected with the 4-(pivaloyloxy)benzyloxy
`(POB) group.
`0043 FIG. 9 illustrates the preparation of a disulfide
`anchor, for use in modification of a synthesis resin used for
`stepwise preparation of a morpholino oligomer, allowing fac
`ile release of the oligomer by treatment with a thiol.
`0044 FIG. 10 illustrates the preparation of a triethylene
`glycol containing moiety ("Tail') which increases aqueous
`solubility of synthetic antisense oligomers.
`0045 FIG. 11 illustrates the preparation of resins useful
`for the solid phase synthesis of morpholino oligomers.
`
`DETAILED DESCRIPTION OF THE INVENTION
`
`I. Definitions
`
`0046. The terms below, as used herein, have the following
`meanings, unless indicated otherwise:
`0047. A “morpholino oligomer refers to a polymeric
`molecule having a backbone which supports bases capable of
`hydrogen bonding to typical polynucleotides, wherein the
`polymer lacks a pentose Sugar backbone moiety, and more
`specifically a ribose backbone linked by phosphodiester
`bonds which is typical of nucleotides and nucleosides, but
`instead contains a ring nitrogen with coupling through the
`ring nitrogen. A preferred morpholino oligomer is composed
`of “morpholino subunit' structures, such as shown below,
`which in the oligomer are preferably linked together by (thio)
`phosphorodiamidate linkages, joining the morpholino nitro
`gen of one subunit to the 5' exocyclic carbon of an adjacent
`Subunit. Each Subunit includes a purine or pyrimidine base
`pairing moiety Pi which is effective to bind, by base-specific
`hydrogen bonding, to a base in a polynucleotide.
`
`r ur
`
`0048 Morpholino oligomers are detailed, for example, in
`co-owned U.S. Pat. Nos. 5,698,685, 5,217.866, 5,142,047,
`5,034,506, 5,166,315, 5,185,444, 5,521,063, and 5,506,337,
`all of which are expressly incorporated by reference herein.
`0049. A "phosphorodiamidate” group comprises phos
`phorus having two attached oxygen atoms and two attached
`nitrogen atoms, and herein may also refer to phosphorus
`having one attached oxygenatom and three attached nitrogen
`atoms. In the intersubunit linkages of the oligomers described
`herein, one nitrogen is typically pendant to the backbone
`chain, and the second nitrogen is the ring nitrogen in a mor
`pholino ring structure, as shown in formula II below. Alter
`natively or in addition, a nitrogen may be present at the
`5'-exocyclic carbon, as shown in formulas III and IV below.
`
`

`

`US 2009/013 1624 A1
`
`May 21, 2009
`
`II
`
`III
`
`IV
`
`0050. In a thiophosphorodiamidate linkage, one oxygen
`atom, typically an oxygen pendant to the backbone in the
`oligomers described herein, is replaced with sulfur.
`0051. A “solid-phase-supported morpholino subunit can
`be the first or any Subsequent morpholino Subunit monomer
`incorporated into a morpholino oligomer by Solid-phase step
`wise synthesis as described herein. The subunit is attached to
`the Solid Support, or to a growing oligomer chain on the Solid
`support, via its 5' exocyclic carbon. “Base-protected refers
`to protection of the base-pairing groups, e.g. purine or pyri
`midine bases, on the morpholino subunits with protecting
`groups Suitable to prevent reaction or interference of the
`base-pairing groups during stepwise oligomer synthesis.
`0052 An “activated phosphoramidate group' is typically
`a chlorophosphoramidate group, having Substitution at nitro
`gen which is desired in the eventual phosphoramidate linkage
`
`in the oligomer. An example is (dimethylamino)chlorophos
`phoramidate, i.e. —O—P(=O)(NMe)Cl.
`0053. The terms “charged”, “uncharged”, “cationic' and
`"anionic” as used herein refer to the predominant state of a
`chemical moiety at near-neutral pH, e.g. about 6 to 8. Prefer
`ably, the term refers to the predominant state of the chemical
`moiety at physiological pH, i.e. about 7.4.
`0054 “Lower alkyl refers to an alkyl radical of one to six
`carbon atoms, as exemplified by methyl, ethyl, n-butyl, i-bu
`tyl, t-butyl, isoamyl. n-pentyl, and isopentyl. In selected
`embodiments, a “lower alkyl group has one to four carbon
`atoms, or 1-2 carbonatoms; i.e. methyl or ethyl. Analogously,
`“lower alkenyl refers to an alkenyl radical of two to six,
`preferably three or four, carbonatoms, as exemplified by allyl
`and butenyl.
`0055. A “non-interfering substituent is one that does not
`adversely affect the ability of an antisense oligomer as
`described herein to bind to its intended target. Such substitu
`ents include Small and preferably non-polar groups such as
`methyl, ethyl, methoxy, ethoxy, hydroxy, or fluoro.
`
`II. Base Protection in PMO Synthesis
`0056. Due to the specific challenges of the morpholino
`chemistry, a base protecting group must fill several require
`ments. The protecting group should be readily introduced
`onto the heterocyclic moiety and thereafter be stable to sub
`unit activation and purification conditions, and solid phase
`synthesis. The protecting group should not be reactive with
`the morpholino amine moiety of the growing chain, and
`should allow the activated morpholino subunit to couple
`cleanly with the growing oligomer chain. The protecting
`group should be cleaved, preferably by ammonia, without
`introducing new impurities. Finally, it should result in crys
`talline subunit derivatives, in order to avoid the need for
`chromatographic purification prior to activation.
`0057. As described below and in the comparative
`Examples, protecting groups reported in the literature for
`doubly protected guanosines, as used for nucleic acid synthe
`sis, did not adequately meet these criteria. Thus, a new pro
`tecting strategy was required for morpholino G subunits. As
`described below, use of the 4-(pivaloyloxy)benzyloxy group
`at 06 was found to meet all of the above criteria.
`0.058 A. O6 Protecting Groups: Comparative Data
`0059 A1. 4-nitrophenethyl ether (NPE)
`0060. This derivative was prepared as shown in FIG. 2
`(Mitsunobu 1981) or FIG. 3 (Jones et al. 1982B). While the
`crude 06 protected subunit could be prepared in reasonable
`yield, the compound was not readily crystalline and could be
`adequately purified only by silica gel chromatography, which
`is undesirable for large-scale production. After testing an
`extensive range of reslurrying and/or recrystallization condi
`tions, it was found that butoxyethanol-containing solvent
`combinations could, with some difficulty, crystallize the
`material. However, excess butoxyethanol could not be
`removed from the final product, as the compound likely crys
`tallized as a solvate. The presence of excess alcoholic solvent
`would not be acceptable in the activation reaction.
`0061 The NPE group is cleaved with strong base via a
`B-elimination mechanism. These conditions tend to generate
`the reactive by-product 4-nitrostyrene, which can then react
`with reactive sites on the oligomer. While various scavenging
`agents (e.g. thiols and 1,3-dicarbonyl compounds) were intro
`duced into the deprotection mixture in an attempt to prevent
`trapping of the by-product by the oligomer, none were com
`pletely successful in eliminating this internal return problem.
`Even after purification, oligomers prepared with this subunit
`had a yellow tint.
`
`

`

`US 2009/013 1624 A1
`
`May 21, 2009
`
`0062 A2. Phenylsulfonylethyl (PSE) and Methylsulfo
`nylethyl (MSE)
`0063. These groups were introduced via the correspond
`ing 2-thioethanol derivatives (Jones et al. 1982A, 1982B), as
`shown in FIG. 4. However, no successful crystallization pro
`cedure could be found for the resulting subunits.
`0064. Like the NPE group, above, these groups are
`cleaved via a B-elimination mechanism. After incorporation
`into an oligomer, these derivatives gave the same problems
`seen with the NPE group; that is, internal return of the reactive
`alkene by-product formed during deprotection.
`0065 A3. Trimethylsilylethyl ether
`0066. As reported by Jones (Jones et al. 1982B), an
`O6-TMSE-modified morpholino guanine subunit was pre
`pared as shown in FIG. 5, but it was not stable during oligo
`mer synthesis. Oligomers made with this subunit showed a
`range of by-products similar to those made from O6-unpro
`tected G subunits.
`0067 A4. Phenyl ether
`0068 Morpholino guanine subunits with O6-phenyl sub
`stitution (FIG. 6) were prepared according to the procedure of
`Reese et al. (1981, 1984). The derivatives included unsubsti
`tuted phenyl, 2,5-dichlorophenyl, pentafluorophenyl, and
`3-fluorophenyl. Such subunits could be incorporated into
`PMO, but deprotection with the usual reagents, such as 2-ni
`trobenzaldehyde oXime and strong base, could not be carried
`to completion without degradation of the oligomer.
`0069. A5. Carbamate
`0070. Several O6-carbamate derivatives were synthe
`sized, according to the procedure of Hata et al. 1983 (FIG. 7).
`Use of these derivatives in oligomer synthesis gave varying
`results depending on the derivative used. For the more labile
`species, such as the diphenyl carbamoyl analog, transfer of
`the protecting group to the 3'-nitrogen of the growing chain
`was noted during the coupling step of Solid phase synthesis,
`resulting in truncated oligomers containing a 3'-diphenylcar
`bamoyl moiety. In addition, the O6-carbamates have two
`possible sites of reaction with ammonia. While the more
`reactive moieties such as the diphenylcarbamoyl group gave
`relatively selective attack at the carbonyl, the more stable
`dimethyl and pyrrolidinyl carbamates showed significant
`competing reaction of ammonia at the C6 position, with con
`version to diaminopurine.
`0071
`B. 4-(Pivaloyloxy)benzyloxy Protecting Group
`0072 4-(Pivaloyloxy)benzyloxy alcohol (4a, FIG. 8) was
`introduced into the morpholino guanine subunit via an effi
`cient, high-yielding synthesis. The subunit prior to activation
`(compound 1f in FIGS. 1 and 8) can be synthesized and
`reproducibly isolated at large scale without chromatographic
`purification, and it can be crystallized from a variety of Sol
`vents (e.g. THF/water, THF/heptane, acetonitrile, various
`ester/hydrocarbon mixtures). Ten batches of this subunit
`
`made at the 50-200 gallon scale (batch size:8-27 kg of com
`pound 1c) gave an average yield of 65% of product, having a
`purity (by HPLC) of 97.6% to 99.2%.
`0073. The subunit is converted to activated subunit (i.e.,
`conversion to the 5'-chlorophosphoramidate compound)
`much more cleanly than mono-protected G, and it can be
`more easily purified by silica gel chromatography. At scale,
`overall yield from compound 1 f to compound 2f (FIG. 1) is
`approximately 50%.
`0074 The POB protecting group may be employed with
`other combinations of protecting groups for the N2 and mor
`pholinoring nitrogens. Suitable N2 protecting groups include
`phenylacetyl (as illustrated in FIG. 8) as well as acetyl, pro
`pionyl, isobutyryl, and phenoxyacetyl. Trityl species Suitable
`for morpholino ring nitrogen protection between coupling
`steps include unsubstituted trityl, 4-methyl-, 4,4'-dimethyl-,
`and 4,4',4'-trimethyltrityl, and 4-methoxytrity1.
`0075 Other acyl protecting groups can also be used in
`place of pivaloyl for the phenol moiety of the POB group.
`Suitable alternatives include N,N-dimethylcarbamoyl and
`benzoyl.
`0076. During PMO synthesis, no products are seen
`wherein the pivaloyl group has become attached to the 3'-ter
`minus of smaller fragments of the full length PMO, a side
`reaction common to the O6-carbamates discussed above. The
`only notable side product detected was a PMO containing a
`phenolic residue, resulting from reaction with the deprotec
`tion by-product quinone methide. However, this by-product
`could be reduced to trace levels by sufficient dilution of the
`ammoniacal deprotection solution. In addition, it is easily
`removed by virtue of strong binding of the phenolic residue to
`the polymeric resins used for strong anion exchange chroma
`tography. In general, the overall yield of purified PMO is
`greatly increased, as seen in Table 1.
`(0077. The improvement in PMO production fostered by
`the POB protected guanine group is most evident in the puri
`fication following PMO solid phase synthesis, where the dif
`ficulty in removing diaminopurine and related byproducts
`can lead to severe loss during strong anion exchange (SAX)
`chromatography. For example, crude purities for AVI-4126
`prepared with CPM and MPG (mono-protected guanine sub
`unit, 2c) are in the 68-73% range, which calculates to approxi
`mately 58% crude yield of the PMO. During the Trityl-On
`and Trityl-Off purifications, significant material is lost to
`obtain pure product, and the overall recovery from the chro
`matography is 52%. For the AVI-4126 made using CYTFA
`and DPG (di-protected guanine subunit), the crude purities
`are 70-75%, with comparable N-1 levels by mass spectrom
`etry (indicating that detritylation efficiencies of CYTFA and
`CPM reagents are approximately equivalent) and crude yields
`of about 61%. However, application of the usual purification
`methods recovers 80% of the PMO from the crude mixture.
`
`TABLE 1.
`
`PMO SEQ
`AVI- ID NO: Sequence
`
`Detritylation Guanline
`reagent'
`Monomer Scale Yield
`
`4126
`
`1.
`
`ACGTTGAGGGGCATCGTCGC
`
`45.57
`
`2
`
`CTGGGATGAGAGCCATCACT
`
`4126
`
`1.
`
`ACGTTGAGGGGCATCGTCGC
`
`CAA
`
`CAA
`
`CAA
`
`CPM
`
`CPM
`
`CPM
`
`2c
`
`2c
`
`2c
`
`2c
`
`2c
`
`2c
`
`54 g
`
`183
`
`24 g
`
`183
`
`48 g
`
`153
`
`25 g
`
`25&
`
`25 g
`
`273
`
`25 g
`
`3O8.
`
`

`

`US 2009/013 1624 A1
`
`May 21, 2009
`
`TABLE 1 - continued
`
`PMO SEQ
`AVI- ID NO: Sequence
`
`Detritylation Guanline
`reagent'
`Monomer Scale? Yield
`
`4O2O
`
`4126
`
`4O65
`
`3
`
`1
`
`4
`
`CTTAGTCATCGAGATCTTCGTG
`
`CPM
`
`ACGTTGAGGGGCATCGTCGC
`
`GTGCTCATGGTGCACGGTC
`
`CYTFA
`
`CYTFA
`
`CYTFA
`
`CYTFA
`
`2c
`
`2f
`
`2f
`
`2f
`
`2f
`
`30 g
`
`32%
`
`25 g
`
`49%
`
`120 g
`
`46%
`
`120 g
`
`49%
`
`120 g
`
`50%
`
`0078 Syntheses were performed in accordance with
`methods described in co-owned U.S. application Ser. No.
`1 1/801.885, using the modifications indicated in the table; see
`Examples 2-5 below. All PMO have a 5'-'tail” and are unsub
`stituted at the 3'-terminus.
`1. CAA=11% Cyanoacetic acid (w/w) in a mixture of 20%
`acetonitrile/DCM (v/v), CPM=2%3-Chloropyridinum meth
`anesulfonate (w/v) and 0.9% ethanol (v/v) in 20% trifluoro
`ethanol/DCM (v/v), CYTFA=2%3-Cyanopyridinum trifluo
`roacetate (w/v) and 0.9% ethanol (v/v) in 20%
`trifluoroethanol/DCM (v/v).
`2. Scale is weight of starting resin in grams. Resin loading is
`480-520 micromoles/g
`3. Combined output of 4x12 g and 1x8 gruns.
`4. Combined output of 2x12 g runs.
`5. Combined output of 4x12 g runs.
`6. Addition of the final C subunit was performed with an
`activated morpholino C subunit with 4-methoxytrityl protec
`tion on the morpholino nitrogen.
`007.9
`Thus, the invention provides a method of synthesiz
`ing a morpholino oligomer in increased purified yield relative
`to prior art methods, and particularly in comparison to puri
`fied yields observed when a monoprotected MoG monomer,
`or other protected MoG monomer not of the invention, is
`employed. In particular, the method preferably generates a
`reduced level of diaminopurine species than would be
`obtained using a MoG monomer not of the invention.
`
`III. Doubly Protected Guanine Morpholino Subunits
`0080. The doubly protected guanine (DPG) morpholino
`subunits of the invention have the structure I:
`
`where
`I0081) R' is selected from the group consisting of lower
`alkyl, di(lower alkyl)amino, and phenyl:
`I0082 R is selected from the group consisting of lower
`alkyl, monocyclic arylmethyl, and monocyclic (aryloxy)im
`ethyl:
`I0083) R is selected from the group consisting of triaryl
`methyl and hydrogen; and
`I0084 Y is selected from the group consisting of a pro
`tected or unprotected hydroxyl oramino group; a chlorophos
`phoramidate group; and a phosphorodiamidate linkage to the
`ring nitrogen of a further morpholino compound or a mor
`pholino oligomer.
`I0085. In selected embodiments, Y is a protected or unpro
`tected hydroxyl group (as in the pre-activated monomer) or a
`chlorophosphoramidate group (as in the activated monomer).
`Preferred protecting groups for the hydroxyl group include
`trialkylsilyl groups, such as tert-butyldimethylsilyl (TB
`DMS).
`I0086 Embodiments in which Y is a phosphorodiamidate
`linkage to the ring nitrogen of a further morpholino com
`pound, or a phosphorodiamidate linkage to a morpholino
`oligomer, refer to species formed during the synthesis of a
`morpholino oligomer, prior to base deprotection.
`0087. As discussed below, the substituents on the chloro
`phosphoramidate group (in the activated monomer) can vary
`depending on the specific phosphorodiamidate linkage
`desired.
`I0088. The invention also provides, correspondingly, a
`method of synthesizing a morpholino oligomer, the method
`comprising:
`I0089
`(a) reacting a solid-phase-supported morpholino
`Subunit, having an unprotected ring nitrogen, with a base
`protected morpholino Subunit monomer, having a triarylm
`ethyl-protected ring nitrogen and an activated phosphorami
`date group on a 5'-exocyclic carbon,
`0090 thereby forming a phosphorodiamidate linkage
`between said 5'-exocyclic carbon and said unprotected ring
`nitrogen;
`0091
`(b) deprotecting said protected ring nitrogen, to
`form an unprotected ring nitrogen; and
`0092 (c) repeating steps (a) and (b) one or more times with
`further base-protected morpholino Subunit monomers;
`0093 wherein at least one of said base-protected mor
`pholino subunit monomers is a doubly protected guanine
`morpholino compound having the structure I:
`
`

`

`US 2009/013 1624 A1
`
`May 21, 2009
`
`-continued
`
`O --,
`
`Z, O
`|
`||
`5'-N- - OR
`
`C
`
`O
`
`n
`
`4. N
`H
`
`R2
`
`Y
`
`N
`
`N
`
`O
`
`N
`
`R3
`
`wherein
`I0094) R' is selected from the group consisting of lower
`alkyl, di(lower alkyl)amino, and phenyl:
`0095 R is selected from the