`
`(12)
`
`United States Patent
`Wiegand et al.
`
`(10) Patent No.:
`(45) Date of Patent:
`
`US 7,306,799 B2
`*Dec. 11, 2007
`
`(54) USE OF VEGF INHIBITORS FOR
`TREATMENT OF EYE DSORDERS
`
`(75) Inventors: Stanley J. Wiegand, Croton on
`Hudson, NY (US); Nicholas J.
`Papadopoulos, LaGrangeville, NY
`(US); George D. Yancopoulos,
`Yorktown Heights, NY (US); James P.
`
`2005/0175610 A1* 8/2005 Wiegand et al. ......... 424,145.1
`2006/0030529 A1* 2/2006 Wiegand et al. .............. 514/12
`2006/0058234 A1* 3/2006 Daly et al..................... 514/12
`2006/0148705 A1* 7/2006 Daly et al..................... 514/12
`2006/0172944 A1* 8/2006 Wiegand et al. .............. 514/12
`
`
`
`Thomas J. Daly, New City, NY (US)
`(73) Assignee: Regeneron Pharmaceuticals, Inc.,
`Tarrytown, NY (US)
`
`WO
`WO
`WO
`
`WO97/.44453
`WO98, 13071
`WO99/03996
`
`11, 1997
`4f1998
`1, 1999
`
`(*) Notice:
`
`Subject to any disclaimer, the term of this
`patent is extended or adjusted under 35
`U.S.C. 154(b) by 285 days.
`
`This patent is Subject to a terminal dis-
`claimer.
`21) Appl. No.: 11/089
`(
`pp
`O
`803
`.
`9
`22) Filed
`Mar 25, 2005
`(
`1C
`ar. A5.
`
`(65)
`
`O
`O
`Prior Publication Data
`
`Related U.S. Application Data
`(63) Continuation-in-part of application No. 10/988,243.
`filed on Nov. 12, 2004, which is a continuation-in-part
`of application No. 10/009,852, filed as application
`No. PCT/US00/14142 on May 23, 2000, now Pat. No.
`7,070,959, 8. sing: 9 appli
`catio No. 9002 filed on Jun. 29, 2004, now
`Pat. No. 7.279,159, which is a continuation-in-part of
`application No. 10/609,775, filed on Jun. 30, 2003,
`now Pat. No. 7,087,411.
`(60) Provisional application No. 60/138,133, filed on Jun.
`8, 1999.
`(51) Int. Cl
`(2006.01)
`A6 IK 38/18
`(2006.01)
`C07K I4/7
`(2006.01)
`CI2N 5/62
`(52) U.S. Cl. ............................... 424/134.1; 424/192.1;
`514/2; 514/12:530/350,536/23.4
`(58) Field of Classification Search ................ ... None
`See application file for complete search history.
`References Cited
`
`(56)
`
`U.S. PATENT DOCUMENTS
`6,100,071 A
`8/2000 Davis-Smyth
`
`OTHER PUBLICATIONS
`Herley et al. (1999). Characterization of the VEGF binding site on
`the Flt-1 receptor. Biochem Biophys Res Commun. 262(3):731
`738.*
`Witmer et al. (2003). Vascular endothelial growth factors and
`angiogenesis in eye disease. Prog. Retin. Eye Res. 22(1):1-29
`:1-29.*
`Terman, B.I., et al., “Identification of a new endothelial cell growth
`factor receptor tyrosine kinase”. Oncogene (1991) 6:1677-1683.
`Terman, B.I., et al., “Identification ofteh KDR tyrosine kinase as a
`receptor for vascular endothelial cell growth factor'. Biochem
`
`Davis-Smyth, T., et al., 1996, The EMBO Journal 15(18):4919
`4927.
`Holash, J., et al., (2002) PNAS 99(17): 11393-11398.
`Heidaran, M.A., et al., (1990).J. Bio. Chem. 265(31): 18741-18744.
`Cunningham, S.A., et al., (1997) Biochem. Biophys. Res. Comm.
`231:596-599.
`Fuh, G, et al., (1998) J. Bio. Chem. 273(18): 11197-11204.
`Wiesmann, C., et al., (1997) Cell 91.695-704.
`Barleon, B., et al., (1997) J. Bio, Chem. 272(6):10382-10388.
`Davis-S
`T. et al., (1998) J. Bio. Chem. 273 (6):3216-3222
`avis-Smyth, T., et al., (1998) J. Bio. Chem. 273(6):3216-3222.
`* cited by examiner
`
`Primary Examiner Christine J. Saoud
`Assistant Examiner—Jon M Lockard
`(74) Attorney, Agent, or Firm Valeta Gregg, Esq.
`
`(57)
`
`ABSTRACT
`
`Modified chimeric polypeptides with improved pharmaco
`kinetics and improved tissue penetration are disclosed useful
`for treating eye disorders, including age-related macular
`degeneration and diabetic retinopathy.
`
`11 Claims, 11 Drawing Sheets
`
`Regeneron Exhibit 2037
`Page 01 of 32
`
`
`
`U.S. Patent
`
`Dec. 11, 2007
`
`Sheet 1 of 11
`
`US 7,306,799 B2
`
`
`
`
`
`
`
`
`
`
`
`
`
`Ç0’0 °F 96°0neq\s+ ºffelony
`
`TO?ITOLOG ||
`
`Regeneron Exhibit 2037
`Page 02 of 32
`
`
`
`U.S. Patent
`
`Dec. 11, 2007
`
`Sheet 2 of 11
`
`US 7,306,799 B2
`
`es
`
`- Fitt (1-3)-Fc(A40)
`-- st Fiti D2FIki D3.FcdeltaC1(a)
`- t Fiti D2FIk1 D3.FcdeltaC1(a)
`- tWEGFR1R2-FcdeltaC1(a)
`N
`
`100
`
`S.
`5, 10
`5
`3 1.
`
`Cl
`O)
`
`
`
`O
`.9)
`
`d
`
`0.1
`
`O.O1
`
`Regeneron Exhibit 2037
`Page 03 of 32
`
`
`
`U.S. Patent
`
`Dec. 11, 2007
`
`Sheet 3 of 11
`
`US 7,306.799 B2
`
`
`
`OO
`
`5, 10
`
`s
`O)
`3
`
`1
`
`SD
`3 0.1
`d
`
`O.O.
`
`- Fitt (1-3)-Fc(A40)
`-- Fitt D2VEGFR3D3.FcdeltaC1(a)
`- Fit1D2FIk1D3.FcdeltaC1(a)
`
`Days
`
`Fig. 3
`
`Regeneron Exhibit 2037
`Page 04 of 32
`
`
`
`U.S. Patent
`
`Dec. 11, 2007
`
`Sheet 4 of 11
`
`US 7,306.799 B2
`
`
`
`WGT 2.5mg/kg
`
`Control
`
`Fig.
`
`4
`
`Regeneron Exhibit 2037
`Page 05 of 32
`
`
`
`U.S. Patent
`
`Dec. 11, 2007
`
`Sheet 5 of 11
`
`US 7,306.799 B2
`
`
`
`Control
`
`VEGF Trap
`
`Fig. 5
`
`Regeneron Exhibit 2037
`Page 06 of 32
`
`
`
`U.S. Patent
`
`Dec. 11, 2007
`
`Sheet 6 of 11
`
`US 7,306.799 B2
`
`( mmx10)
`60
`
`
`
`P<0.0001
`
`SO
`
`40
`
`30
`
`2 O
`
`
`
`O
`
`O
`
`(n=19)
`
`VEGF-TRAP
`(n=17)
`
`Fig. 6
`
`Regeneron Exhibit 2037
`Page 07 of 32
`
`
`
`U.S. Patent
`
`Dec. 11, 2007
`
`Sheet 7 of 11
`
`US 7,306.799 B2
`
`P=0.04519
`0.9 —
`0.8
`
`0.7
`
`0.6
`
`0.5
`
`0.4
`
`0.3
`
`0.2
`
`0.1
`
`0.9
`O.8
`0.7
`0.6
`0.5
`0.4
`0.3
`0.2
`O.
`
`(n = 18)
`
`VEGF-TRAP
`(n = 18)
`
`Fig. 7 A
`
`
`
`P=0.04.0595
`
`Fic
`(n = 20)
`
`VEGF-TRAP
`(n = 20)
`
`Fig. 7B
`
`Regeneron Exhibit 2037
`Page 08 of 32
`
`
`
`U.S. Patent
`
`Dec. 11, 2007
`
`Sheet 8 of 11
`
`US 7,306,799 B2
`
`Suture injury
`
`Chemical injury
`
`P & O.O.
`P & O.O.
`- r
`
`so
`
`
`
`400
`
`300
`
`200
`
`OO
`
`Control
`
`Suture
`
`Suture-VGT
`
`Control
`
`Chemical injury
`
`Chern-VGT
`
`Fig. 8
`
`Regeneron Exhibit 2037
`Page 09 of 32
`
`
`
`III it S" 5
`
`G.
`
`val
`
`S
`
`U.S. Patent
`
`Dec. 11, 2007
`
`Sheet 9 of 11
`
`US 7,306.799 B2
`
`
`
`Sp
`
`g
`G
`5
`
`25
`
`a
`g.
`E.
`
`3
`to
`a
`
`3
`2
`
`s
`E.
`i
`22
`SS ---
`
`Suo Sey epeio 9,
`
`Regeneron Exhibit 2037
`Page 10 of 32
`
`
`
`U.S. Patent
`
`Dec. 11, 2007
`
`Sheet 10 of 11
`
`US 7,306,799 B2
`
`O T * 6 !! 3
`
`qw -10EA-??ue uo deu L IN 6oT
`
`9-/-8-6-O|-| || ~Z|-
`
`st
`
`y
`
`C\
`st
`CN C o co
`y
`s
`O O O O
`
`C
`O
`
`uu Ogiy O'SCW
`
`Regeneron Exhibit 2037
`Page 11 of 32
`
`
`
`U.S. Patent
`
`Dec. 11, 2007
`
`Sheet 11 of 11
`
`US 7,306.799 B2
`
`
`
`i
`
`se
`
`N
`
`co
`y
`
`CN
`y
`
`o
`O
`
`rt
`O
`
`C
`O
`
`uu Ogiy O "SOW
`
`Regeneron Exhibit 2037
`Page 12 of 32
`
`
`
`1.
`USE OF VEGF INHIBITORS FOR
`TREATMENT OF EYE DSORDERS
`
`CROSS-REFERENCE TO RELATED
`APPLICATIONS
`
`This application is a continuation-in-part of application
`Ser. No. 10/988,243 filed 12 Nov. 2004, which is a continu
`ation-in-part of application Ser. No. 10/009,852 filed 6 Dec.
`2001, now U.S. Pat. No. 7,070,959, which is the National
`Stage of International Application No. PCT/US00/14142
`filed 23 May 2000, which claims the benefit under 35 USC
`S 119(e) of U.S. Provisional 60/138,133 filed 8 Jun. 1999,
`and this application is a continuation-in-part of application
`Ser. No. 10/880,021 filed 29 Jun. 2004, now U.S. Pat. No.
`7.279,159 which is a continuation-in-part of application Ser.
`No. 10/609,775 filed 30 Jun. 2003, now U.S. Pat. No.
`7,087,411, which applications are herein specifically incor
`porated by reference in their entireties.
`
`10
`
`15
`
`BACKGROUND
`
`25
`
`30
`
`Statement Regarding Related Art
`A class of cell-derived dimeric mitogens with selectivity
`for vascular endothelial cells has been identified and desig
`nated vascular endothelial cell growth factor (VEGF).
`VEGF is a dimer with an apparent molecular mass of about
`46 kDa with each Subunit having an apparent molecular
`mass of about 23 kDa. The membrane-bound tyrosine kinase
`receptor, known as Flt (also known as VEGFR2), was shown
`to be a VEGF receptor (DeVries et al. (1992) Science
`255.989-991). Another form of the VEGF receptor, desig
`nated KDR or Flk-1 (also known as VEGFR3), is also
`known to bind VEGF and induce mitogenesis (Terman et al.
`(1991) Oncogene 6:1677-1683; Terman et al. (1992) Bio
`chem. Biophys. Res. Comm. 187: 1579-1586).
`U.S. Pat. No. 6,011,003 describes an altered, soluble form
`of Fit polypeptide capable of binding to VEGF comprising
`five or fewer complete immunoglobulin domains. WO
`97/.44453 describes chimeric VEGF receptor proteins com
`40
`prising amino acid sequences derived from VEGF receptors
`Flt1 and KDR.
`
`35
`
`BRIEF SUMMARY OF THE INVENTION
`
`The invention features a therapeutic method for treating
`or ameliorating an eye disorder, comprising administering a
`vascular endothelial growth factor (VEGF) inhibitor to a
`patient in need thereof. In one embodiment, the eye disorder
`treated is age related macular degeneration. In another
`embodiment, the eye disorder treated is diabetic retinopathy.
`Preferably, the VEGF inhibitor used in the method of the
`invention comprises an immunoglobulin-like (Ig) domain 2
`of a first VEGF receptor and Ig domain 3 of a second VEGF
`receptor, and a multimerizing component, wherein the first
`VEGF receptor is Flt1, the second VEGF receptor is Flk1 or
`Flt4, and the multimerizing component is selected from the
`group consisting of (i) an amino acid sequence between 1 to
`about 200 amino acids in length having at least one cysteine
`residue, and (ii) an immunoglobulin domain, or fragment of
`an immunoglobulin domain. In specific embodiments, the
`VEGF inhibitor is a fusion polypeptide “VEGF trap”
`selected from the group consisting of SEQ ID NO:2
`(Flt1D2.Flk1D3FcAC1(a)),
`SEQ
`ID
`NO:4
`(Flt1D2.VEGFR3D3.FCAC1(a)),
`SEQ ID
`NO:6
`(VEGFR1R2 FcAC1(a)), and SEQ ID NO:23. In another
`embodiment, the VEGF inhibitor is a fusion polypeptide
`
`45
`
`50
`
`55
`
`60
`
`65
`
`US 7,306,799 B2
`
`2
`encoded by a nucleotide sequence selected from the group
`consisting of SEQ ID NO:1, 3, 5, 22, and a nucleotide
`sequence which, as a result of the degeneracy of the genetic
`code, differs from the nucleotide sequence of SEQID NO:1,
`3, 5, and 22.
`In a second aspect, the invention features a method for the
`treatment of a human Subject diagnosed with an eye disor
`der, comprising administering an effective amount of a
`vascular endothelial growth factor (VEGF) inhibitor to the
`human Subject, the method comprising administering to the
`subject an initial dose of at least approximately 25-4000
`micrograms VEGF inhibitor protein to an affected eye, and
`administering to the Subject a plurality of Subsequent doses
`of the VEGF inhibitor protein in an amount that is approxi
`mately the same or less than the initial dose, wherein the
`Subsequent doses are separated in time from each other by
`at least two weeks. The eye disorder is one of age-related
`macular degeneration or diabetic retinopathy. In various
`embodiments, the initial dose is at least approximately 25 to
`4000 micrograms of VEGF inhibitor protein. In various
`embodiments, the Subsequent doses are separated in time
`from each other by at least two weeks to 12 months; more
`preferably, the Subsequent doses are separated in time from
`each other by at least 3-6 months. The VEGF inhibitor
`protein is administered directly to the affected eye, including
`by use of eye drops or intravitreal injection. Preferably, the
`VEGF inhibitor is a dimer having two fusion polypeptides
`consisting essentially of an immunoglobulin-like (Ig)
`domain 2 of Flt1 and Ig domain 3 of Flk1 or Flt4, and a
`multimerizing component. In specific embodiments, the
`VEGF inhibitor is a dimer comprising the fusion polypep
`tide of SEQ ID NO:2, 4, 6, or 23.
`Other objects and advantages will become apparent from
`a review of the ensuing detailed description.
`
`BRIEF DESCRIPTION OF THE FIGURES
`
`FIG. 1. Biacore analysis of binding stoichiometry. Bind
`ing Stoichiometry was calculated as a molar ratio of bound
`VEGF165 to the immobilized Flt1D2Flk1D3.FcAC1(a) or
`VEGFR1R2-FcAC1(a), using the conversion factor of 1000
`RU equivalent to 1 ng/ml.
`FIG. 2. Pharmacokinetics of Flt1 (1-3)-Fc (A40),
`Flt1D2. Flk1D3.FcAC1(a) and VEGFR1R2-FcAC1(a).
`FIG. 3. Pharmacokinetics of Flt1 (1-3)-Fc (A40),
`Flt1D2. Flk1D3.FcAC1(a) and Flt1D2.VEGFR3D3.FcAC1
`(a).
`FIG. 4. VEGFR1R2-FcAC1(a) prevents neovasculariza
`tion induced by retinal ischemia. Serial 10um cross sections
`were collected and stained with hematoxylin and eosin. For
`each animal, nuclei in preretinal neovessels were counted in
`a series often sections within 300 microns of the optic nerve
`head and averaged. Counts were obtained in three indepen
`dent experiments, n24 for each treatment group in each
`study.
`FIG. 5. Effect of subcutaneous VEGFR1R2-FcAC1(a)
`injections on choroidal neovascularization area. The size of
`CNV lesions was measured in choroidal flat mounts. The
`images were digitized using an Axioskop microscope
`equipped with a video camera, and the total area of choroidal
`neovascularization associated with each laser burn was
`measured using Image-Pro Plus Software.
`FIG. 6. VEGFR1R2-FcAC1(a) inhibits subretinal neovas
`cularization in Rho/VEGF transgenic mice.
`FIG. 7A-B. VEGF-Induced breakdown of the blood reti
`nal barrier. A. Following intravitreal injections of VEGF,
`adult mice (C57BL/6) treated with injections of
`
`Regeneron Exhibit 2037
`Page 13 of 32
`
`
`
`US 7,306,799 B2
`
`3
`VEGFR1R2-FcAC1(a) had a significantly smaller retina to
`lung leakage ratio than mice treated with Fc fragment,
`indicating less breakdown of BRB. B. Double transgenic
`mice treated with injections of VEGFR1R2-FcAC1(a) had a
`significant reduction in the retina to lung leakage ratio
`compared to mice treated with Fc fragment.
`FIG.8. Effect of VEGFR1R2-FcAC1(a) administration on
`corneal thickness in Suture and alkaliburn models of corneal
`trauma. Corneas were injured by Suture placement or appli
`cation of NaOH as described, and a single dose of
`VEGFR1R2-FcAC1(a) (25 mg/kg, ip) or saline (n=5 per
`group) was administered immediately following injury. The
`contralateral cornea served as normal, undamaged controls.
`Corneas were collected 7 days later and cross-sections were
`cut and stained with hematoxylin and eosin. Corneal thick
`ness was measured as an index of corneal edema.
`FIG. 9. System or intravitreal VEGF trap protein admin
`istration prevents laser-induced choroidal neovasculariza
`tion (CNV) and reverses vascular leak in established lesions.
`FIG. 10. Dose response curve of Baf/Flt cells grown in
`VEGF.
`FIG. 11. Inhibition of VEGF growth response by VEGF
`trap VEGFR1R2-FcAC1(a) or anti-VEGF antibody.
`
`10
`
`15
`
`4
`not limited to, bacterial cells, yeast cells, insect cells, and
`mammalian cells. Any of the methods known to one skilled
`in the art for the insertion of DNA fragments into a vector
`may be used to construct expression vectors encoding the
`chimeric polypeptide molecules under control of transcrip
`tional/translational control signals. These methods may
`include in vitro recombinant DNA and synthetic techniques
`and in vivo recombinations (See Sambrook, et al., Molecular
`Cloning, A Laboratory Manual, Cold Spring Harbor Labo
`ratory; Current Protocols in Molecular Biology, Eds.
`Ausubel, et al., Greene Publ. Assoc., Wiley-Interscience,
`NY).
`Expression of nucleic acid molecules encoding the chi
`meric polypeptide molecules may be regulated by a second
`nucleic acid sequence so that the chimeric polypeptide
`molecule is expressed in a host transformed with the recom
`binant DNA molecule. For example, expression of the
`chimeric polypeptide molecules described herein may be
`controlled by any promoter/enhancer element known in the
`art.
`Thus, according to the invention, expression vectors
`capable of being replicated in a bacterial or eukaryotic host
`comprising chimeric polypeptide molecule-encoding
`nucleic acids as described herein, are used to transfect the
`host and thereby direct expression of Such nucleic acids to
`produce the chimeric polypeptide molecules, which may
`then be recovered in a biologically active form. As used
`herein, a biologically active form includes a form capable of
`binding to VEGF. Expression vectors containing the chi
`meric nucleic acid molecules described herein can be iden
`tified by three general approaches: (a) DNA-DNA hybrid
`ization, (b) presence or absence of “marker gene functions,
`and (c) expression of inserted sequences. In the first
`approach, the presence of a foreign gene inserted in an
`expression vector can be detected by DNA-DNA hybridiza
`tion using probes comprising sequences that are homologous
`to the inserted chimeric polypeptide molecule sequences. In
`the second approach, the recombinant vector/host system
`can be identified and selected based upon the presence or
`absence of certain “marker gene functions (e.g., thymidine
`kinase activity, resistance to antibiotics, transformation phe
`notype, occlusion body formation in baculovirus, etc.)
`caused by the insertion of foreign genes in the vector. For
`example, if the chimeric polypeptide molecule DNA
`sequence is inserted within the marker gene sequence of the
`vector, recombinants containing the insert can be identified
`by the absence of the marker gene function. In the third
`approach, recombinant expression vectors can be identified
`by assaying the foreign gene product expressed by the
`recombinant. Such assays can be based, for example, on the
`physical or functional properties of the chimeric polypeptide
`molecules.
`Cells of the present invention may transiently or, prefer
`ably, constitutively and permanently express the chimeric
`polypeptide molecules.
`The chimeric polypeptide molecules may be purified by
`any technique which allows for the Subsequent formation of
`a stable, biologically active chimeric polypeptide molecule.
`For example, and not by way of limitation, the factors may
`be recovered from cells either as soluble proteins or as
`inclusion bodies, from which they may be extracted quan
`titatively by 8M guanidinium hydrochloride and dialysis
`(see, for example, U.S. Pat. No. 5,663,304). In order to
`further purify the factors, conventional ion exchange chro
`matography, hydrophobic interaction chromatography,
`reverse phase chromatography or gel filtration may be used.
`
`DETAILED DESCRIPTION OF THE
`INVENTION
`
`25
`
`It has been a longstanding problem in the art to produce
`a receptor-based VEGF antagonist that has a pharmacoki
`netic profile that is appropriate for consideration of the
`antagonist as a therapeutic candidate. Applicants describe
`herein, for the first time, a chimeric polypeptide molecule,
`capable of antagonizing VEGF activity, that exhibits
`improved pharmacokinetic properties as compared to other
`known receptor-based VEGF antagonists. The chimeric
`polypeptide molecules described herein thus provide appro
`priate molecules for use in therapies in which antagonism of
`VEGF is a desired result.
`The extracellular ligand binding domain is defined as the
`portion of a receptor that, in its native conformation in the
`cell membrane, is oriented extracellularly where it can
`contact with its cognate ligand. The extracellular ligand
`binding domain does not include the hydrophobic amino
`acids associated with the receptor's transmembrane domain
`or any amino acids associated with the receptors intracel
`lular domain. Generally, the intracellular or cytoplasmic
`domain of a receptor is usually composed of positively
`charged or polar amino acids (i.e., lysine, arginine, histidine,
`glutamic acid, aspartic acid). The preceding 15-30, predomi
`nantly hydrophobic or apolar amino acids (i.e., leucine,
`valine, isoleucine, and phenylalanine) comprise the trans
`membrane domain. The extracellular domain comprises the
`amino acids that precede the hydrophobic transmembrane
`stretch of amino acids. Usually the transmembrane domain
`is flanked by positively charged or polar amino acids such as
`lysine or arginine. Von Heijne has published detailed rules
`that are commonly referred to by skilled artisans when
`determining which amino acids of a given receptor belong to
`the extracellular, transmembrane, or intracellular domains
`(See, von Heijne (1995) BioEssays 17:25).
`Nucleic Acid Constructs and Encoded Fusion Polypeptides
`The present invention provides for the construction of
`nucleic acid molecules encoding chimeric polypeptide mol
`ecules that are inserted into a vector that is able to express
`the chimeric polypeptide molecules when introduced into an
`appropriate host cell. Appropriate host cells include, but are
`
`30
`
`35
`
`40
`
`45
`
`50
`
`55
`
`60
`
`65
`
`Regeneron Exhibit 2037
`Page 14 of 32
`
`
`
`US 7,306,799 B2
`
`10
`
`15
`
`35
`
`40
`
`25
`
`5
`The method of the invention encompasses the use of a
`fusion protein consisting essentially of first and second
`vascular endothelial growth factor (VEGF) receptor com
`ponents and a multimerizing component, wherein the first
`VEGF receptor component is an immunoglobulin-like (Ig)
`domain 2 of Flt1, the second VEGF receptor component is
`an Ig domain 3 of a Flk1 or Flt4, and the multimerizing
`component is selected from the group consisting of (i) a
`multimerizing component comprising a cleavable region
`(C-region), (ii) a truncated multimerizing component, (iii)
`an amino acid sequence between 1 to about 200 amino acids
`in length having at least one cysteine residue, (iv) a leucine
`Zipper, (v) a helix loop motif. (vi) a coil-coil motif, and (vii)
`an immunoglobulin domain. Examples of the VEGF inhibi
`tors useful in the method of the invention include fusion
`proteins encoded by a nucleotide sequence selected from the
`group consisting of the nucleotide sequence of SEQ ID
`NO:1, 3, 5, 22, and a nucleotide sequence which, as a result
`of the degeneracy of the genetic code, differs from the
`nucleotide sequence of SEQID NO:1, 3, 5, or 22, and fusion
`protein selected from the group consisting of SEQID NO:2
`(Flt1D2.Flk1D3FcAC1(a)),
`SEQ
`ID
`NO:4
`(Flt1D2.VEGFR3D3.FcAC1(a)),
`SEQ
`ID
`NO:6
`(VEGFR1R2 FcAC1(a)) and (SEQ ID NO:23).
`Therapeutic Methods
`The present invention also has diagnostic and therapeutic
`utilities. In particular embodiments of the invention, meth
`ods of detecting aberrancies in the function or expression of
`the chimeric polypeptide molecules described herein may be
`used in the diagnosis of disorders. In other embodiments,
`manipulation of the chimeric polypeptide molecules or
`agonists or antagonists which bind the chimeric polypeptide
`molecules may be used in the treatment of diseases. In
`further embodiments, the chimeric polypeptide molecule is
`utilized as an agent to block the binding of a binding agent
`to its target.
`By way of example, but not limitation, the method of the
`invention may be useful in treating clinical conditions that
`are characterized by vascular permeability, edema or inflam
`mation Such as brain edema associated with injury, stroke or
`tumor, edema associated with inflammatory disorders such
`as psoriasis or arthritis, including rheumatoid arthritis;
`asthma; generalized edema associated with burns; ascites
`and pleural effusion associated with tumors, inflammation or
`trauma; chronic airway inflammation; capillary leak Syn
`drome; sepsis: kidney disease associated with increased
`leakage of protein; and eye disorders such as age related
`macular degeneration and diabetic retinopathy.
`Combination Therapies
`In numerous embodiments, a VEGF inhibitor may be
`administered in combination with one or more additional
`compounds or therapies, including a second VEGF inhibitor.
`Combination therapy includes administration of a single
`pharmaceutical dosage formulation which contains a VEGF
`55
`inhibitor molecule and one or more additional agents; as
`well as administration of a VEGF inhibitor and one or more
`additional agent(s) in its own separate pharmaceutical dos
`age formulation. For example, a VEGF inhibitor and a
`cytotoxic agent, a chemotherapeutic agent or a growth
`inhibitory agent can be administered to the patient together
`in a single dosage composition Such as a combined formu
`lation, or each agent can be administered in a separate
`dosage formulation. Where separate dosage formulations are
`used, the VEGF-specific fusion protein of the invention and
`one or more additional agents can be administered concur
`rently, or at separately staggered times, i.e., sequentially. The
`
`45
`
`50
`
`60
`
`65
`
`6
`therapeutic methods of the invention may also be combined
`with other agents or medical procedures used for treatment
`of eye disorders.
`Treatment Population
`The eye comprises several structurally and functionally
`distinct vascular beds, which Supply ocular components
`critical to the maintenance of vision. These include the
`retinal and choroidal vasculatures, which Supply the inner
`and outer portions of the retina, respectively, and the limbal
`vasculature located at the periphery of the cornea. Injuries
`and diseases that impair the normal structure or function of
`these vascular beds are among the leading causes of visual
`impairment and blindness. For example, diabetic retinopa
`thy is the most common disease affecting the retinal vascu
`lature, and is the leading cause of vision loss among the
`working age population in the United States. Vascularization
`of the cornea secondary to injury or disease is yet another
`category of ocular vascular disease that can lead to severe
`impairment of vision.
`"Macular degeneration is a medical term that applies to
`any of several disease syndromes which involve a gradual
`loss or impairment of eyesight due to cell and tissue degen
`eration of the yellow macular region in the center of the
`retina. Macular degeneration is often characterized as one of
`two types, non-exudative (dry form) or exudative (wet
`form). Although both types are bilateral and progressive,
`each type may reflect different pathological processes. The
`wet form of age-related macular degeneration (AMD) is the
`most common form of choroidal neovascularization and a
`leading cause of blindness in the elderly. AMD affects
`millions of Americans over the age of 60, and is the leading
`cause of new blindness among the elderly. It is characterized
`and usually diagnosed by the presence of elevated levels of
`two types of cellular debris within the retina, called drusen
`and lipofuscin.
`There are several types of symptomatic treatment, how
`ever, that have been used with limited and isolated success,
`depending on the particular condition of the patient, to treat
`exudative (wet form) macular degeneration. Laser photoco
`agulation therapy may benefit certain patients with macular
`degeneration. However, there are high recurrence rates for
`selected choroidal neovascular membranes which may ini
`tially respond to laser therapy. Vision loss may also result
`from the laser therapy. Low dose radiation (teletherapy) has
`also been hypothesized as a possible treatment to induce
`regression of choroidal neovascularization. Surgical
`removal of neovascular membranes is another possible
`treatment, but it is a highly specialized procedure and
`reportedly has not had promising results to date. There is
`presently no effective treatment for non-exudative (dry
`form) macular degeneration. Management of non-exudative
`macular degeneration is limited to early diagnosis and
`careful follow-up to determine if the patient develops cho
`roidal neovascularization. Protection against exposure to
`ultraviolet light and prescribed dosages of anti-oxidant Vita
`mins (e.g., vitamin A, B-carotene, lutein, Zeaxanthin, Vita
`min C and vitamin E) and Zinc may also be of some benefit,
`but as yet these treatments remain unproven.
`Accordingly, the population to be treated by the method
`of the invention is preferably one of (i) a human subject
`diagnosed as Suffering from macular degeneration, (ii) a
`human Subject diagnosed as Suffering from diabetes-related
`retinopathy, and (iii) a human Subject Suffering from patho
`logical vascularization of the cornea secondary to injury or
`disease.
`
`Regeneron Exhibit 2037
`Page 15 of 32
`
`
`
`US 7,306,799 B2
`
`10
`
`25
`
`30
`
`35
`
`7
`Methods of Administration and Compositions
`Preferably, administration of the VEGF inhibitor will be
`directly to the eye, e.g., topical. Topical methods of admin
`istration include, for example, by eye drops, Subconjunctival
`injections or implants, intravitreal injections or implants,
`Sub-Tenon's injections or implants, incorporation in Surgical
`irrigating Solutions, etc.
`Compositions suitable for topical administration are
`known to the art (see, for example, U.S. Patent Application
`2005/0059639). In various embodiments, compositions of
`the invention can comprise a liquid comprising an active
`agent in Solution, in Suspension, or both. As used herein,
`liquid compositions include gels. Preferably the liquid com
`position is aqueous. Alternatively, the composition can take
`form of an ointment. In a preferred embodiment, the com
`15
`position is an in situ gellable aqueous composition, more
`preferably an in situ gellable aqueous solution. Such a
`composition can comprise agelling agent in a concentration
`effective to promote gelling upon contact with the eye or
`lacrimal fluid in the exterior of the eye. Aqueous composi
`tions of the invention have ophthalmically compatible pH
`and osmolality. The composition can comprise an oph
`thalmic depot formulation comprising an active agent for
`Subconjunctival administration. The microparticles compris
`ing active agent can be embedded in a biocompatible
`pharmaceutically acceptable polymer or a lipid encapsulat
`ing agent. The depot formulations may be adapted to release
`all or substantially all the active material over an extended
`period of time. The polymer or lipid matrix, if present, may
`be adapted to degrade sufficiently to be transported from the
`site of administration after release of all or substantially all
`the active agent. The depot formulation can be a liquid
`formulation, comprising a pharmaceutical acceptable poly
`mer and a dissolved or dispersed active agent. Upon injec
`tion, the polymer forms a depot at the injections site, e.g. by
`gelifying or precipitating. The composition can comprise a
`solid article that can be inserted in a suitable location in the
`eye, Such as between the eye and eyelid or in the conjuctival
`sac, where the article releases the active agent. Solid articles
`Suitable for implantation in the eye in Such fashion generally
`comprise polymers and can be bioerodible or non-bioerod
`ible.
`In one embodiment of the method of the invention, a
`human Subject with at least one visually impaired eye is
`treated with 25-4000 micrograms of a VEGF inhibitor
`protein via intravitreal injection. Improvement of clinical
`symptoms are monitored by one or more methods known to
`the art, for example, indirect ophthalmoscopy, fundus pho
`tography, fluorescein angiopathy, electroretinography, exter
`nal eye examination, slit lamp biomicroscopy, applanation
`tonometry, pachymetry, and autorefaction. Subsequent doses
`may be administered weekly or monthly, e.g., with a fre
`quency of 2-8 weeks or 1-12 months apart.
`Other features of the invention will become apparent in
`the course of the following descriptions of exemplary
`embodiments which are given for illustration of the inven
`tion and are not intended to be limiting thereof.
`
`8
`FcAC1(a) respectively, wherein R1 and Flt1D2=Ig domain 2
`of Flt1 (VEGFR1); R2 and Flk1D3=Ig domain 3 of Flkl
`(VEGFR2); and R3 and VEGFR3D3–Ig domain 3 of Flt4
`(VEGFR3)) were much less sticky to ECM, as judged by an
`in vitro ECM binding assay and had greatly improved PK as
`described herein. In addition, these molecules were able to
`bind VEGF tightly and block phosphorylation of the native
`Flk1 receptor expressed in endothelial cells.
`plasmid
`Construction
`of
`the
`expression
`plasmids
`pFlt1D2. Flk1D3.FcAC1(a).
`Expression
`pMT21. Flt1(1-3).Fc (6519 bp) and pMT21.Flk-1 (1-3).Fc
`(5230 bp) are plasmids that encode amplicillin resistance and
`Fc-tagged versions of Ig domains 1-3 of human Flt1 and
`human Flk1, respectively. These plasmids were used to
`construct a DNA fragment consisting of a fusion of Ig
`domain 2 of Flt1 with Ig domain 3 of Flk1, using PCR
`amplification of the respective Ig domains followed by
`further rounds of PCR to achieve fusion of the two domains
`into a single fragment. For Ig domain 2 of Flt1, the 5' and 3'
`amplification primers were as follows: 5': bsp/flt1D2 (5'-
`GACTAGCAGTCCGGAGGTAGACCTTTCG
`TAGAGATG-3') (SEQ ID NO:8), 3': Flt1D2-Flk1D3.as
`(5'-CGGACTCAGMCCACATCTATGATTGTATTGGT-3')
`(SEQ ID NO:9). The 5' amplification primer encodes a
`BspE1 restriction enzyme site upstream of Ig domain 2 of
`Flt1, defined by the amino acid sequence GRPFVEM (SEQ
`ID NO:10) corresponding to amino acids 27-33 of SEQ ID
`NO:2. The 3' primer encodes the reverse complement of the
`3' end of Flt1 Ig domain 2 fused directly to the 5' beginning
`of Flk1 Ig domain 3, with the fusion point defined as TIID
`of Flt1 (corresponding to amino acids 123-126 of SEQ ID
`NO:2) and continuing i