J. Dairy Sci. 94:5811-5820
`doi:10.3168/jds.2011-4479
`© American Dairy Science Association®, 2011.
`
`J3-Galactosidase with transgalactosylation activity
`from Lactobacillus fermentum K4
`
`G. X. Liu ,* J. Kong,t W.W. Lu ,t W. T. Kong,t H. Tian,* X. Y. Tian,* and G. C. Huo*1
`*State Key Laboratory of Dairy Science , Northeast Agricultural University, Ministry of Education, No. 59 Mucai Street, Xiangfa ng District, Harbin ,
`Heilongjiang Province , 150030 , China
`tState Key Laboratory of Microbial Technology, Shandong University, No. 27 Shanda South Road , Jinan , Shandong Province , 250100 , China
`
`ABSTRACT
`
`INTRODUCTION
`
`r3-galactosidase of Lactobacillus fer(cid:173)
`The LacLM
`mentum K4 is encoded by 2 consecutive genes, lacL
`(large subunit) and lacM (sm all subunit) , t hat share
`17 overlapping nucleotides. Phylogen etic analysis re(cid:173)
`vealed t hat t his enzyme was closely relat ed to other
`Lactobacillus r3-galactosidases and provided significant
`insight int o its common and distinct characteristics.
`'vVe cloned both the lacL and lacM genes of L . fer(cid:173)
`mentum K4 and het erologously expressed each
`in
`Escherichia coli, although t he recomb inant enzyme was
`only functional when both were expressed on the same
`plasmid. We evaluated t he enzymatic propert ies of this
`species-specific LacLM r3-galactosidase and discovered
`t hat it act s as bot h a hydrolase, bioconverting lactose
`into glucose and galactose, and a transgalactosylase,
`generating pre biot ic galacto-oligosaccharides (GOS).
`The recombinant r3-galactosidase showed a broad pH
`optimum and st ability around neutral pH . The opt imal
`temperature and Michaelis constant (Km) for t he sub(cid:173)
`st rates o- nitrophenyl-
`-D-galactopyranoside and lactose
`were, respectively, 40°C and 45 to 50°C and 1.31 mM
`and 27 mM. The enzyme activity was stimulated by
`some cations such as Na+, K+, and Mg2+. In addit ion ,
`activity was also enhanced by ethanol (15%, wt / vol).
`The transgalactosylation activity of L. f ermentum K4
`-galactosidase effectively and rapidly generated GOS ,
`up t o 37% of t he total sugars from t he reaction . Col(cid:173)
`-galactosidase
`lectively, our results suggest ed that the
`from L . f ermentum K4 could be exploited for the for(cid:173)
`m ation of GOS.
`Key words:
`-galactosidase, Lactobacillus f ermentum,
`lactose, galacto-oligosaccharides
`
`Received April 24, 2011.
`Accepted September 5, 2011.
`1Corresponding author: gchuo58@126.com
`
`The carbohydrate-active enzymes ( CAZymes) are di(cid:173)
`vided among 5 fun ctional classes: glycoside hydrolases
`(GH), glycosylt ransferases , polysaccharide lyases, car(cid:173)
`bohydrat e esterases, and carbohydrate-binding modules
`(Cantarel et al. , 2009) . The r3-galactosidases (~-gal,
`E C 3.2.1.23) belong t o 4 different GH families (GHl ,
`GH2 , GH35, and GH42; htt p: //www.cazy.org/ ) and
`catalyze t he hydrolysis and t he transgalactosylation
`of r3-D-galactopyranoside substrates such as lactose.
`r3-Galactosidases are widely distributed
`throughout
`nature and have been charact erized in animals, plants,
`and microorganism s, including bacteria , fungi, and
`-gal from Escherichia coli has been part icu(cid:173)
`yeast . The
`larly well described because of t he universal application
`of t he lactose operon as a molecular t ool. Furt hermore,
`t he transgalactosylation activity of -galactosidases has
`gained considerable attent ion for its ability to produce
`( G OS) prebiot ics
`galacto-oligosaccharide
`( Ot ieno,
`2010; P ark and Oh, 2010).
`Galacto-oligosaccharides are enym atically produced
`upon lactose conversion , and t hey vary in saccharide
`chain length (between 2 and 8 monomeric units) and
`t he types of linkages between t he units. R ecent ly, how(cid:173)
`ever , certain invariable characteristics were described.
`The saccharide chain is composed of a single terminal
`glucose, galactose monosaccharides, and disaccharides
`comprising 2 galactose units (T zortzis and Vulevic,
`2009) . Ind us t rial processes aimed at producing low(cid:173)
`lact ose or lactose-free items are concerned wit h un(cid:173)
`desirable GOS byproducts , for fear of unknown side
`effects t hat may stimulate symptoms of lactose intol(cid:173)
`erance. However , GOS have demonstrated beneficial
`effects t hat are distinct from lactose. The GOS can
`increase the numbers of B ifidobacterium strains and
`other probiotics (Onishi and Tanaka , 1995; R abiu et
`al. , 2001 ; Rastall and Maitin, 2002; Macfarlane et al. ,
`2008) and contribute t o metabolic activity of colon mi(cid:173)
`crobiota (Knol et al. , 2005) . As such , GOS have been
`proposed as an em erging special class of prebiotics and
`have gained popularity as supplemental components to
`
`581 1
`
`

`

`58 12
`
`LI U ET AL.
`
`Table 1. Bacterial strains and plasmids included in this study
`
`Strain or plasmid
`
`Characteristic1
`
`Strain
`Lactobacillus fermentum K4
`Escherichia coli Origami B (DE3)
`
`Isolated from Chinese traditional dairy products
`F' ompT hsdS8 (r 8' m 8 ') gal dcm lac Yi ahpC(DE3 ) gor522:: Tn 10
`trxB (Kan', Tet'); derived from a LacZY mutant of DE3 and carries
`trxB/ gor mutations for cytoplasmic disulfide bond formation
`
`Source
`
`This work
`ovagen, Germany
`
`P lasmid
`pET-226(+)
`pET Duet-1
`p22bLM
`pDuetL
`pDuetLM
`
`Amp', 5.5 kb, C-terminal His-Tag, T 7 promoter/ lac operator, pelB leader
`Amp' , 5.4 kb, T7 promoter/ lac operator, Co/El replicon, two MCS, His-Tag, S-Tag
`Amp', 8.3 kb, pET 22b( +) derivative with lacLM genes inserted before His-Tag
`Amp', 7.3 kb, pET Duet- 1 derivative with lacL gene inserted after His-Tag
`Amp', 8.2 kb, pET Duet-1 derivative with lacL gene inserted
`after His-Tag and lacM gene inserted before S-Tag
`
`Novagen, Germany
`ovagen, Germany
`This work
`This work
`This work
`
`1Amp' = ampicillin resistant; Kan'= kanamycin resistant ; Tet' = tetracycline resistant ; MCS = multiple clone site.
`
`infant formula powder, wherein t hey replicate t he oli(cid:173)
`gosaccharide effect of human milk (Torres et al. , 2010).
`It is now believed that combining prebiotic GOS wit h
`probiotics in food sources will strongly benefit overall
`human health.
`Lactic acid bacteria (L A B ) are an established and
`crucial component of modern dairy processing and t he
`food industry. The most common species applied are
`from the genera Lactobacillus, Lactococcus, Bifido bac(cid:173)
`terium, and Streptococcus. Lactobacillus fermentum is a
`heterofermentative LAB t hat acts within a broad range
`of environmental niches, including dairy, meat , cereal,
`and vegetable fermentations, and even in the human
`gastrointestinal tract (Walter , 2008). The probiotic
`properties of some L . fermentum strains have been de(cid:173)
`scribed, such as that of t he ME-3 strain, which is also
`considered to elicit a prebiotic effect (Calderon Santoyo
`et al. , 2003; Songisepp et al. , 2004, 2005; Mikelsaar and
`Zilmer, 2009) .
`In recent years, whole-genome sequencing studies of
`LAB model strains have provided signifi cant insights
`into t he molecular mechanisms by which these bacteria
`affect biological processes. The principal objective of
`this study was to investigate the transgalactosylation
`properties of ~-gal from L. fermentum K4. To this end ,
`the LacLM ~-gal was heterologously expressed and the
`recombinant protein purified . The amino acid sequenc(cid:173)
`es of LacLlVI and putative active sites were analyzed ,
`and homology with other GH2 ~-gal from various LAB
`strains was investigated. Our results indicated t hat t he
`~-gal from L. fermentum K4 could be used to yield
`GOS.
`
`MATERIALS AND METHODS
`
`aerobically at 37°C in standard Lactobacillus de Man,
`Rogosa, and Sharpe broth (Difeo, Detroit , MI) con(cid:173)
`taining 2% lactose (wt/ vol) . Escherichia coli Origami
`B (DE3) (Table 1) was grown at 37°C under aeration
`in Luria-Bertani broth, supplemented with 100 µ,g /
`mL ampicillin and 30 µ,g / mL kanamycin for plasmid
`maintenance.
`
`Gene Cloning and Vector Construction
`
`Chromosomal D A was extracted from L . fermen(cid:173)
`tum K4 using the T IANamp bacteria genomic DNA
`extraction kit (Tiangen , Beijing, China). Amplification
`primers for the lacL and lacM genes encoding ~-gal
`were designed according to the complete genome se(cid:173)
`quences of L . fermentum IFO 3956 (GenBank accession
`no. AP008937) and L. f ermentum CECT 5716 (Gen(cid:173)
`Bank accession no. CP002033; Table 2). Amplifica(cid:173)
`tion of t he lacLM genes using Lf22b-F and Lf22b-R
`primers resulted in introduction of (5') Neal and (3')
`Xhol restriction enzyme recognition sites, respectively.
`Likewise, amplification of the large subunit (lacL) gene
`using LfDuetL-F and LfDuetL-R primers introduced
`(5') BamHI and (3') Pstl sites, and amplification of
`the small subunit ( lacM) gene using LfDuet 1-F and
`LfDuetM-R primers introduced (5') Ndel and (3') BglII
`sites.
`Expression vectors pETDuet-1 and pET-22b( +)
`(Novagen , Darmstadt, Germany) were restructured
`with digested P CR products of lacL and lacLM genes,
`respectively, to generate pDuetL and p22bLlVI. Subse(cid:173)
`quently, pDuetL was used to construct the pDuetLM
`plasmid containing t he complete lacLM genes. The
`restructured plasmids (Table 1) were confirmed by re(cid:173)
`striction enzyme digestion and sequencing.
`
`Bacterial Strains and Culture Conditions
`
`Expression and Purification
`
`Lactobacillus ferm entum strain K4 (16S rDI A Gen(cid:173)
`Bank accession no . EU621 85 1; Table 1) was grown an-
`
`The recombinant plasmids p22bLM, pDuetL, and
`pDuetLM were transformed into E. coli Origami B
`
`Journal of Dairy Science Vol. 94 No. 12, 201 1
`
`

`

`~-GALACTOSIDAS E OF LA CTOBAC/LLUS FERMENTUM
`
`5813
`
`Table 2. Sequences of the primers used in this study
`
`Primer
`
`Lf22b-F
`Lf22b-R
`LilluetL-F
`LilluetL-R
`LilluetM-F
`LilluetM-R
`
`Target
`fragment
`
`lacLM
`
`lacL
`
`lacM
`
`Annealing
`temperature (°C)
`
`61
`
`60
`
`58
`
`Size
`(bp)
`
`2,838
`
`1,887
`
`975
`
`Restriction
`enzyme
`
`Sequence' (5' to 3')
`
`Neal
`Xhol
`BamHI
`Pstl
`Ndel
`BglII
`
`GCACCATGGAAGCAGAGCTGAAATG
`TAGCTCGAGGTTAAGCTCGGGCAC
`GGTGGATCCTATGGAAGCAGAGCTGA
`GCGCTGCAGTTTGTGTAATCCATAGT
`GCTCATATGGATTACACAAATAAGCTG
`TTGAGATCTGTTAAGCTCGGGCAC
`
`'Restriction enzyme sites are underlined.
`
`(DE3) for expression. The transformants were grown at
`37°C in antibiotic-supplemented Luria Bertani medium
`with shaking until an optical density of 0.5 at 600 nm
`was reached. Isopropyl-~-D-thiogalactoside (IPTG , 1
`mM) was then added to the culture medium and in(cid:173)
`cubation continued at 25°C for 12 h . The induced cells
`were then harvested by centrifugation at 12,000 x g for
`10 m in at 4°C.
`The cell pellet was suspended with 50 mM sodium
`phosphate buffer (pH 6.5) and disrupted by sonication,
`after which the cell debris was pelleted by centrifugation
`(16,000 x g for 30 min at 4°C). The supernatant was
`t hen applied to a His-Trap HP column (GE Healthcare,
`Uppsala , Sweden) that had been pre-equilibrated with
`buffer A (20 mM sodium phosphate, 0.5 M NaCl, 20
`mM imidazole, pH 7.4). Nonspecific adsorbed materi(cid:173)
`als were removed by washing with buffer B (20 mM
`sodium phosphate, 0.5 M NaCl, 40 mM imidazole, pH
`7.4). The recombinant ~-gal was eluted with elution
`buffer (20 mM sodium phosphate, 0.5 MN aCl, 500 mM
`imidazole, pH 7.4). The active fractions were desalted
`and collected by ultrafiltration with Amicon Ultra-4
`(Niillipore, Billerica, MA). The concentration of protein
`was determined by t he Bradford method using BSA as
`standard (Bradford, 1976). T he expression level and
`purity of recombinant
`-gal were evaluated by resolu(cid:173)
`t ion by 12o/c SDS-PAGE and compared with a protein
`molecular weight marker (TaKaRa, Shiga, J apan ) after
`visualization with Coomassie Brilliant Blue staining.
`
`Enzyme Assays
`
`~-Galactosidase activity was determined using
`o-nitrophenyl-~-D-galactopyranoside ( oNPG) and lac(cid:173)
`tose as the substrates. The oNPG reaction was carried
`out in 100 µL of 50 mM sodium phosphate buffer (pH
`6.5) containing 40 µL of 20 mM o PG and 10 µL of
`diluted enzyme solution. After 10 min of incubation at
`reaction temperature, 100 µL of 1 M
`a.:iCO 3 was added
`to terminate the reaction. Activity of ~-gal was deter(cid:173)
`mined by the amount of o-nitrophenol ( oNP) released,
`
`as measured by absorbance at 405 nm on a microplate
`reader (Bio-Rad Laboratories, Hercules, CA). One unit
`of o IPG activity was defined as the amount of enzyme
`releasing one micromole of oNP per minute under the
`described conditions.
`The lactose substrate reaction was initiated by add(cid:173)
`ing 50 µL of diluted enzyme solution to 150 µL of 50
`mM sodium phosphate buffer (pH 6.5) with 200 mM
`lactose. After 10 min of incubation at reaction temper(cid:173)
`ature, the reaction was stopped by heating at 100°C for
`5 min. Activity of ~-gal was determined by measuring
`the amount of D-glucose released using a commercially
`available glucose oxidase kit (Biosino, Beijing, China)
`and reading absorbance at 490 nm. One unit of lactase
`activity was defined as t he amount of enzyme releasing
`one micromole of D-glucose per minute under the given
`conditions .
`
`Characterization of the Recombinant {3-ga/ Enzyme
`
`pH and Temperature D ependence of Activity
`and Stability. Both oNPG and lactose assays were
`variably performed so as to determine the optimum
`pH and temperature of the respective enzyme activity.
`The optimum pH was determined for the range of pH
`from 2.5 to 11.0 by using 50 mM Mcllvaine buffer (pH
`2.5- 5.5), 50 mM sodium phosphate buffer (pH 5.5- 8.0) ,
`or 50 mM glycine-NaOH buffer (pH 8.5- 11.0). The
`optimum temperature was determined by measuring
`the respective enzyme activity over a range from 20 to
`70°C (J uajun et al. , 2011). All other assay condit ions
`remained unchanged.
`The release of oNP from o IPG was measured to
`determine pH and thermal stability. For determination
`of pH stability, the enzyme samples were diluted with
`buffers of various pH values and incubated at 4°C for 3
`d . Temperature stability was determined by incubating
`at various temperatures in a range from 4 to 55°C for
`more than 120 min. The samples were separated at
`the desired t ime intervals, and the residual activity was
`measured under standard assay conditions .
`
`Journal of Dai ry Science Vol. 94 No. 12, 2011
`
`

`

`5814
`
`A
`
`0825581
`ilus AV 32871
`L.
`L.
`Iv cu IADX6'98 21
`L. johnsonilJE J598 81
`L. plant ru CAD655691
`L. sak 1ICAl560 81
`L. elbr
`11IAC 069861
`18088 I
`nu
`727 501
`I
`L. sahvartusjADJ7,86
`I
`S. thermo
`ilus AV6 0
`L. r
`nos us CA 8'63651
`IS A1 060781
`. la
`. cohl:BAl538551
`Cons ns
`
`B
`
`LI U ET AL.
`
`AG
`AG
`AG
`AG
`G
`G
`G
`
`3
`!l
`1S
`
`G
`G
`
`G
`G
`G
`G
`G
`G
`
`(a)
`
`(b)
`
`F igure 1. Multiple alignments of the possible active sites (A) and conservative frequency (B) of ~-galactosidases of different species (genera:
`L. = Lactobacillus spp., B. = Bifidobacterium spp., S. = Streptococcus spp. , and E. = Escherichia) . GenBank accession numbers follow the spe(cid:173)
`cies names. Conserved catalytic amino acids proposed to be the key residues in the active sites are indicated with black arrows. Color version
`available in the online PDF.
`
`D etermination of Kin et ic Parameters. Kinetic
`parameters were evaluated by performing t he oNPG
`and lactose assays at 30°C using 50 mN[ sodium phos(cid:173)
`phate buffer (pH 6.5) with substrate concentrations
`ranging from 0.5 to 22 mM for oNPG and from 1 to
`600 mM for lactose (Nguyen et al. , 2006) .
`Effect of Various Cations and R eagents. To
`study the effect of various cations and reagents on t he
`activity of ~-gal, t he enzyme samples were assayed with
`aqueous solution containing 20 mM oNPG at the opti(cid:173)
`mum temperature for 10 min in the presence of various
`cations and reagents added at a final concentration of 5
`mM, or at 15% (vol/ vol) for ethanol and glycerol. T he
`measured activities were compared with the activity
`
`of the enzyme solution under t he same condit ions but
`without added cations or reagents.
`
`Formation of GOS
`
`Cell extracts were incubated for 48 h at 45°C in
`50 mM sodium phosphate buffer (pH 6.5) with either
`lactose solut ion (20% or 40%, wt / vol) or milk conta in(cid:173)
`ing 5% (wt/ vol) lactose , respectively. Samples were
`withdrawn at certa in time intervals and immediately
`heated at 100°C for 5 m in to inactivate the enzyme.
`The composit ions of GOS mixtures were analyzed us(cid:173)
`ing t hin-layer chromatography (TLC ) and an HPLC
`system . The T LC was carried out on silica-gel 60 plates
`
`Journal of Da iry Science Vol. 94 No. 12, 2011
`
`

`

`~-GALAC TOSI DAS E OF LACTOBAC/LL US FERMENTUM
`
`5815
`
`7
`
`8
`
`5
`
`8
`
`8
`
`10
`
`Lael
`
`Lacz
`
`L crispatus ST1 ICBL50863I
`L. amy/ovorus GRL 11121ADQ59581 I
`L. ullunensis DSM 160471EEJ728361
`L. acidophilus NCFMIAA V432871
`L. he/veticus H1 0IADX698421
`L. johnsonii ATCC 332001EEJ59848I
`L. reuteri DSM 200161ABQ825581
`L. vagina/is ATCC 495401EEJ408451
`L. oris PB013-T2-31EFQ529731
`L. antri DSM 160411EEW526881
`1~ - - • L. fermentum K4
`L. coleohominis 101-4-CHN 1EEU296641
`L. brevis subsp. gravesensis ATCC 27305 1EE1714751
`2 11---1-0~ L buchneri ATCC 11577 1EEl200031
`10 L. hilgardii ATCC 8290 IEEl231471
`L plantarum WCFS1 ICA0655691
`L. coryniformls IABD966101
`Pediococcus pentosaceus A TCC 257 45IABJ673061
`Pediococcus acidi/actici DSM 202841EFL960501
`L. sakei subsp. sakei 23KICAl560181
`_. _ . _ . _ . _ . _ . _ . 4 . _.._ __ - . -_-.--WJV~~/liLJ)a!clfIJP}iIVltf:.roiIJ.f:Ui u;c..;3.ll1 ~ER"l!4~l- . _ . _. _ . _ . _
`C/ostridium perfringens C s1r. JGS14951EDS793891
`L. salivarius CECT 5713IADJ78641 I
`- - - - Paenibacil/us polymyxa SC21ADO54271 I
`1 . . . . - - - Bacillus halodurans C-1251BAB064421
`- - - Geobacillus sp. Y412MC61 1ACX772161
`- - - - L. ruminis ATCC 256441EFZ33771 1
`Streptococcus thermophilus LMG 18311 fAA V61011 I
`L. delbrueckii subsp. /actis DSM 200721EGD281381
`1 o L. delbrueckii subsp. bulgaricusfACE069861
`.----- Bifidobacterium breve DSM 202131EFE886541
`Bifidobacterium adolescentis ATCC 157031BAF403861
`- - - Bifidobacterium longum subsp. inrantis ATCC 558131EEl80881 I
`1 o Bifidobacterium longum subsp. /ongum JCM 1217fBAJ671531
`, - - - - - Escherichia coli SE151BAl538551
`Leuconostoc kimchii IMSNU 111541ADG39689f
`- - - - Lactococcus lactis subsp. lactis ll14031AAK060781
`.---- Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293fABJ624121
`Leuconostoc gasicomitatum LMG 18811 ICBL912091
`L. casei BL231CAQ654171
`1 o
`L. rhamnosus GG ICAR86231 I
`
`....._.
`0.1
`
`Figure 2. Phylogenetic tree of ~-galactosidase from some lactic acid bacteria (where L. = Lactobacillus). Lactobacillus fermentum K4 is
`marked with a black circle. GenBank accession numbers follow the species names. The ~-galactosidases above the dotted line pertain to the
`LacLM type, and those below the dotted line pertain to t he LacZ type, except the ~-galactosiclases of glycoside hyclrolase group (GH)42 from
`Lactobacillus rhamnosus GG and Lactobacillus casei BL23 .
`
`(Merck, Darmstadt, Germany) in a solvent composed
`of n-butanol:n-propanol:ethanol:water (2:3 :3 :2, vol/
`vol/ vol/ vol), as described previously (Splechtna et
`al. , 2006 ) . For further analysis of GOS , the samples
`were diluted appropriately, filtered , and injected into
`the HPLC system on a column of Aminex HPX 87H
`(Bio-Rad Laboratories) at 50°C using 5 mM H 2SO4
`solution as t he mobile phase (0.3 m L / min) and refrac(cid:173)
`tive index detection. The yield of GOS was calculated
`by the previously described method (J ¢rgensen et al. ,
`2001) .
`
`Nucleotide Sequence Accession Numbers
`
`The genes of lacL and lacNI were submitted to the
`GenBank database under accession numbers HQ727550
`and HQ727551, respectively.
`
`RESULTS
`
`Sequence Analysis of /3-gal from L. fermentum K4
`
`The L . f ermentum K4 genome sequences of lacL and
`lacM share an overlapping region of 17 nucleotides.
`
`Journal of Dairy Science Vol. 94 No. 12, 20 11
`
`

`

`58 16
`
`KDa
`116 _
`97_2 -
`66.4-
`
`44.3 -
`
`29.0 -
`
`20.1-
`
`Figure 3 . Sodium dodecyl sulfate-PAGE analyses of !3-galactosidase
`(LacLM) from Lactobacillus fermentum K4 expression in Escherichia
`coli Origami B (DE3) . Lane 1 = protein molecular weight marker; lane
`2 = cells of E. coli Origami B (DE3) ; lane 3 = cells of E. coli con(cid:173)
`taining p22bLM without induction; lanes 4 and 5 = cells grown with
`pD uetL (lane 4) and p22bLM (lane 5) for 12 h with 1 mM isopropyl-
`13-D-thiogalactoside induction, respectively; lane 6 = purified protein
`of !3-galactosidase LacLM.
`
`Sequence alignment by the basis local alignment tool
`(http: //blast .ncbi.nlm.nih.gov/ Blast.cgi) revealed that
`these 2 genes have 99.81 % identity to t hose published
`from L. fermentum strains IFO 3956 and CECT 5716.
`Based on the deduced amino acid sequences of the
`~-gal large subunit LacL and small subunit LacM, the
`theoretical molecular weights were estimated to be
`72.29 and 35.8 kDa, respectively (http ://au.expasy.
`org/ tools/ pi_tool.html). The L. fermentum K4 ~-gal
`resembles the GH2 family members that are classified
`as LacLM type as opposed to Lacz type (Schwab et
`al. , 2010). The potential active sites in L. fermentum
`K4 LacLM were identified by comparison with those
`defined for the other major LAB by using the CLC
`sequence viewer (F igure lA) and WebLogo (F igure lB ;
`htt p: //weblogo.berkeley.edu/ logo.cgi). The E. coli Lac Z
`acid/ base and nucleophile regions are located at resi(cid:173)
`dues Glu461 and Glu537 (Cupples et al. , 1990; , Gebler
`et al. , 1992 ; Henrissat and Bairoch, 1993; Hung et al. ,
`2001; l\!Iatthews, 2005). These regions were located in
`L. fermentum K4 LacLM at Glu466 (Figure lBa) and
`Glu534 (Figure lBb) and exhibited remarkably high
`identity with the corresponding ones from E. coli Lacz.
`However, when the entire AA sequence of L. fermentum
`K4 LacLM was compared with that of E. coli LacZ,
`only 31.66% ident ity was observed.
`Phylogenetic t rees were constructed for LacL and
`LacM of L . fermentum K4 using MEGA 5 software
`(www.megasoftware.net) with the bootstrap method
`and using all of the putative ~-galactosidases discov(cid:173)
`ered thus far in Lactobacillus spp. and some of t he LAB
`strains that are prevalent in food manufacturing. Fig(cid:173)
`ure 2 shows the LacL phylogenetic t ree of L. fermentum
`
`Journal of Dairy Science Vol. 94 No. 12, 201 1
`
`2
`
`3
`
`4
`
`5
`
`6
`
`LI U ET AL.
`
`A 100
`
`•
`•
`
`2
`
`3
`
`4
`
`5
`
`6
`
`7
`pH
`
`8
`
`9
`
`10 11
`
`12
`
`,......_
`::R
`
`80
`
`0 ->-- 60
`
`">
`:;:;
`t) ro 40
`Q)
`>
`:;:; ro 20
`Q)
`0:::
`
`0
`
`B 100
`
`,......_ 80
`::R
`
`0 ->--·s: 60
`
`:;:;
`t) ro
`Q) 40
`>
`:;:;
`ro
`Q)
`0::: 20
`
`0
`
`20
`
`30
`
`60
`50
`40
`Temperature (°C)
`
`70
`
`80
`
`Figure 4. pH (A) and temperature (B) optima of !3-galactosidase
`from
`using
`0-nitrophenyl-!3-D(cid:173)
`f ermentum K4
`Lactobacillus
`galactopyranoside (black circles) and lactose (gray circles) as t he sub(cid:173)
`strates, respectively. For a ll the graphs, the values are the mean of 3
`determinations.
`
`K4 . Both LacL and LacM (data not shown) were most
`closely related to the ~-gal from other Lactobacillus spp.
`
`Expression of {3-ga/ from L. fermentum in E. coli
`
`The ~-gal LacLM from L. fermentum K4, which
`is encoded by the lacLM operon, was amplified and
`cloned into pET-22b( + ), resulting in t he p22bLlVI ex(cid:173)
`pression vector. To study the detailed characteristics
`of this strain-specific
`-gal, t he large subunit gene
`lacL was cloned and expressed as an IPTG-inducible
`recombinant protein ( as described in Materials and
`Methods). Sodium dodecyl sulfate-PAGE analysis
`of t he ~-gal samples at various steps of the expres-
`
`

`

`~-GALACTOS IDASE OF LA CTOBAC/LLUS FERMENTUM
`
`581 7
`
`A 100
`
`- 80
`~ 0 ->. 60
`
`....,
`·;;
`:.::;
`(.)
`ro
`Q)
`>
`:.::;
`ro
`Q)
`0:::
`
`.
`,,
`
`-
`
`40
`
`20
`
`0
`
`.---•
`'
`
`I
`I
`
`I
`I
`I
`
`.. ,
`
`4
`
`5
`
`6
`
`7
`
`8
`
`pH
`
`...
`
`9
`
`10
`
`11
`
`B 100
`
`- 80
`
`~
`.._..
`0
`....,
`>,
`·;;
`:.::;
`(.)
`ro
`Q)
`>
`:.::;
`ro
`Q)
`0:::
`
`60
`
`40
`
`20
`
`0
`
`----~
`
`.
`
`I
`I
`I
`I
`I
`I
`I
`I
`I
`
`..
`
`.
`
`-~ ,
`'
`
`..........
`...... ,
`
`' •,
`' ~ -
`
`10
`
`40
`20
`30
`Temperature (°C)
`
`50
`
`60
`
`F igure 5. pH (A) and temperature (B) stability of f3-galactosidase
`from Lactobacillus fermentum K4. The enzyme was incubated for dif(cid:173)
`ferent periods: A: 24 h (black circles), 48 h (gray circles), 72 h (gray
`t riangles); B: 20 min (black circles), 40 min (gray circles), 100 min
`(gray triangles). For all graphs, the values are the mean of 3 determi(cid:173)
`nations.
`
`sion and purification process are shown in F igure 3.
`The purified recombinant LacLM consisted of a large
`subunit and a small subunit , which were estimated to
`b e approximately ~ 72 and 35 kDa, respectively (lane
`6). The large subunit LacL, which was encoded by the
`lacL gene from vector pDuet L, was expressed (lane 4)
`wit h no activity. However, the whole protein LacLM
`encoded by t he recombinant plasmid pDuetLNI ( and
`generated by insert ing the lacM gene before t he S-t ag
`of pDuetL) was active.
`
`Properties of /3-ga/
`
`T he opt imal pH of ~-gal LacL ti were determined to
`be pH 6. 5 and 7.0 for lactose and oNPG substrates,
`
`respectively (F igure 4A). The enzyme exhibited very
`low activity outside the range of pH from 5.5 to 8.5.
`Optimum temperature was 40°C for the t ransgalac(cid:173)
`t osylation activity wit h oNP G (Figure 4B) and 45 t o
`50°C for lactose hydrolysis. The kinetic parameters Km
`(Michaelis const ant) and V.nax (maximum rate) of t he
`purified enzyme were determined t o be approximat ely
`1.31 mM and 184.4 µm ol·min- 1-mg- 1 for oNPG , and
`27 mM and 41 µm ol·min- 1-mg- 1 for lactose hydrolysis.
`T he purified recombinant ~-galact osidase protein
`was determined to be more st able at pH 8.0 after 3 cl of
`incubation at 4°C (Figure 5A) , which was distinct from
`t he optimal pH. T he protein was also found to ret ain
`about 40% of its enzyme activity in neut ral pH after
`incubation for 72 h. Thermal st ability was observed in
`t he range of 10 to 20°C (Figure 5B) , and 35 to 50%
`of the maximum act ivity was ret ained after incubation
`in t he temperature range for 2 cl (dat a not shown).
`Incubation at 55°C inactivated the enzyme wit hin 20
`min (Figure 5B).
`
`Effect of Various Cations and Reagents
`
`T he activity of L. fermentum K4 recombinant ~-gal
`was enhanced upon exposure to 15% (wt/ vol) ethanol
`and 5 mM Na+, K +, and
`tlg2+ (Figure 6). The reagent
`dithiothreitol had almost no effect on enzymatic activ(cid:173)
`ity. The activity was moderately inhibited by glycerol,
`2-mercapt oethanol, and urea, and was clearly inhibited
`by Fe2+, Mn2+, and Zn 2+. Glutathione, Cu2+, and Fe3+
`complet ely deactivated t he enzyme. Thus, the cations
`K+ and Mg2+ were considered and applied as cofactors
`to enhance the efficiency of L. fermentum ~-gal.
`
`Bioconversion of Lactose
`
`Certain microbial ~-gal can mediate the transfer of
`t heir hydrolyzed galactose products ont o lactose t o
`yield GOS (P anesar et al. , 2006; Park and Oh, 2010).
`-gal LacLM from L. fermentum K4 exhibits such
`The
`transgalact osylation activit ies . During lactose conver(cid:173)
`sion, we observed that t he transgalactosylation reaction
`was rapidly init iated , as demonstrated by the formation
`of GOS in 0. 5 h (Figure 7 A). The weight of GOS as a
`percentage of the total sugars in the reaction mixture
`was determined by HP LC. The value reached a maxi(cid:173)
`mum of 37% when the incubation involving 50 mM so(cid:173)
`dium phosphat e buffer (pH 6. 5) at 45°C with 40o/c (wt /
`vol) lactose solution was extended to 9 h. Beyond 9 h,
`however , hydrolysis prevailed over t ransgalactosylation,
`and the total amounts of GOS trended downwards, ac(cid:173)
`companied by an increase in galactose content (Figure
`7B). When a lower lactose content solut ion was used
`(as in milk), t he amount of bioconverted GOS was less.
`
`Jou rn al of Dairy Science Vol. 94 No. 12, 20 11
`
`

`

`5818
`
`LI U ET AL.
`
`Glutathione
`Cu2+
`Fe3+
`Fe2+
`Zn2+
`Mn2+
`Glycerol
`Ethanol
`EDTA
`Urea
`OTT
`2 me
`Ca2+
`Mg2+
`K+
`Na+
`Control
`
`0
`
`150
`100
`50
`Relative activity (%)
`
`200
`
`Figure 6. Effect of various cations and reagents on the activity of i3-galactosiclase from Lactobacillus f ermentum K4. DTT = clith..iothreitol.
`
`Likewise, as the lactose concentration was increased
`in the reaction solution, more and larger GOS were
`produced (Figure 7). This result was consistent with
`that from a previous report (Albayrak and Yang, 2002).
`
`DISCUSSION
`
`-gal from L. f ermentum strain K4 was cloned,
`The
`expressed , purified, and analyzed to determine its dis(cid:173)
`tinctive enzymatic properties and indicate its poten(cid:173)
`tial as a manipulable molecular tool for bioconversion
`of GOS. The recombinant
`-gal showed a broad pH
`optimum and stability around neutral pH (6 .5-8.5) ,
`preferably utilized lactose between 45 and 50°C , and
`was quickly inactivated at 55°C. The cations Na+, K+,
`and Mg2+ improved enzymatic activity, consistent with
`findings from previous studies on other LacLM-type
`~-gal (Nguyen et al. , 2006 , 2007; Iqbal et al. , 2010).
`The effect of Mn2+ was especially noteworthy, because
`it increases ~-gal activity from both L . f ermentum
`K4 and Lactobacillus plantarum WCFSl (Iqbal et al. ,
`2010) , but inhibits that from Lactobacillus acidophilus
`
`Journal of Dairy Science Vol. 94 No. 12, 201 1
`
`(Nguyen et al. , 2007) . Another interesting finding was
`that ethanol was a stimulator of ~-gal LacLM enzyme,
`a finding yet to be reported with any other of the LAB .
`This m ay be a reflection of the relatively broad range of
`environmental niches in which L. f ermentum is known
`to function; it is possible that a symbiotic relationship
`evolved with other ethanol-producing strains, such as
`Saccharomyces cerevisiae or Zymomonas mobilis. In ad(cid:173)
`dit ion, t he types and total amounts of GOS t hat were
`produced by the L. fermentum LacLIVI were mediated
`by the concentration of lactose solution, not the tem(cid:173)
`perature or pH.
`The ~-gal enzyme is known to catalyze the hydro(cid:173)
`lysis and transglycosylation of its substrates through
`a double-displacement reaction involving both galacto(cid:173)
`sylation and degalactosylation steps (Bras et al. , 2010).
`The preference for transglycosylation activity can be
`enhanced by exposure to high concentrations of lactose,
`as demonstrated by measuring the difference between
`glucose and galactose products that arise from specific
`reaction conditions. In our study, we observed that the
`greatest yield of GOS was achieved when the differ-
`
`

`

`~-GALACTOSIDAS E OF LA CTOBAC/LLUS FERMENTUM
`
`5819
`
`A
`
`Glucose
`Galactose
`
`Lactose
`
`GOS
`
`E D
`
`0
`(II ~ ~
`~ ~ ~
`
`D E
`
`B
`
`A
`
`B
`
`C
`
`:-0----o
`• -
`--o---o
`
`--·-
`
`3 6 9 12
`
`36
`30
`24
`18
`Reaction time (h)
`
`42 48
`
`Figure 7. Thin layer chromatography (A) and HPLC (B) analysis
`of transgalactosylation products. (A) A = milk substrate; B = 20%
`lactose solution ; C = 40% lactose solution; D = standard substance;
`E = commercial galacto-oligosaccharides (GOS) . (B) T he enzyme was
`incubated in 50 mM sodium phosphate buffer (pH 6.5) at 45°C with
`40% (wt/ vol) lactose solution: lactose (0 ), galactose (■) , glucose (• )
`and GOS (e ). For all graphs, the values are the mean of 3 determina(cid:173)
`t ions.
`
`ence value was greatest . Fort unat ely, the recombinant
`LacLM was able to bioconvert GOS from milk lactose
`(which exist s at very low concentrations) .
`As mentioned above, the ~-gal from L. f erm entum
`K4 is composed of a large subunit (LacL) and a small
`subunit (LacM) and belongs to the GH2 family of car(cid:173)
`bohydrate-active enzymes. Most Lactobacillus st rains
`contain the LacLM type ~-gal, and some LAB that
`are involved in fermentation (particularly in t he food
`
`industry) pertain to the LacZ type, such as Bifidobac(cid:173)
`terium spp. , Lactococcus spp. , and Streptococcus spp.
`(Hung et al. , 2001 ; J 0rgensen et al. , 2001 ; Hung and
`Lee, 2002 ; Lamoureux et al. , 2002 ; Hsu et al. , 2007) .
`Phylogenetic analysis revealed that both the large sub(cid:173)
`unit LacL and small subunit LacM of L. fermentum K4
`~-galactosidase had high homology wit h most of the
`~-galactosidase from other Lactobacillus spp. It should
`be noted that t he probiot ic Lactobacillus rhamnosus
`CG contains the
`-gal ebgA (CAR86365) and bgaC
`(CAR86231 ) , which belong to GH2 and GH42 , respec(cid:173)
`tively, which is distinct from the other Lactobacillus
`-gal from t he genus Pediococcus
`spp .. Furthermore,
`were also represented in the LacLM group. In general,
`4 subgeneric groups were g